The role of the Cronobacter sakazakii ProP C-terminal coiled coil domain in osmotolerance

Abstract

We investigate the role of the C-terminal coiled coil of the secondary proline porter ProP in contributing to Cronobacter sakazakii osmotolerance.
The extended C-terminal domain of ProP1 (encoded by ESA_02131) was spliced onto the truncated C-terminal end of ProP2 (encoded by ESA_01706); creating a chimeric protein (ProPc) which exhibits increased osmotolerance relative to the wild type.
It appears that the C-terminal coiled coil domain tunes ProP at low osmolality, whereas ProP transporters lacking the coiled coil domain are more active at a higher osmolality range.

Full text

S H O R T R E P O R T Open Access
The role of the Cronobacter sakazakii ProP
C-terminal coiled coil domain in osmotolerance
Audrey Feeney
†
, Christopher D Johnston
†
, Alan Lucid, Jim O’Mahony, Aidan Coffey, Brigid Lucey
and Roy D Sleator
*
Abstract
Background: We investigate the role of the C-terminal coiled coil of the secondary proline porter ProP in contributing
to Cronobacter sakazakii osmotolerance.
Findings: The extended C-terminal domain of ProP1 (encoded by ESA_02131) was spliced onto the truncated
C-terminal end of ProP2 (encoded by ESA_01706); creating a chimeric protein (ProPc) which exhibits increased
osmotolerance relative to the wild type.
Conclusions: It appears that the C-terminal coiled coil domain tunes ProP at low osmolality, whereas ProP
transporters lacking the coiled coil domain are more active at a higher osmolality range.
Introduction
Survival of the foodbourne pathogen Cronobacter sakaza-
kii in low water activity (a
w
) environments, e.g. powdered
infant formula (PIF), is largely attributed to the accumula-
tion of organic compounds termed osmolytes or compat-
ible solutes [1,2]. Synthesised de novo, or transported from
the bathing solution[3], compatible solutes function to
increase cell turgor thereby counterbalancing the external
osmotic upshift and preventing water loss from the cell,
which if left unchecked can lead to plasmolysis and ultim-
ately cell death [4].
In Escherichia coli, a model organism for the study
of bacterial osmoadaptation, the transmembrane protein
ProP is perhaps the best characterised compatible solute
uptake system; facilitating the uptake of both proline and
glycine betaine [5]. A member of the major facilitator
superfamily (MFS), E. coli ProP is a 500-amino acid
protein comprising of 12 transmembrane domains and
a characteristic carboxy-terminal extension [5,6]. In a
previous in silico studyweidentifiedsevenProPhomo-
logues on the C. sakazakii BAA-894 genome; one of
which, ESA_02131, encodes a protein exhibiting 90%
identity to E. coli ProP [2]. While the remaining six ho-
mologues encode proteins exhibiting features of classic
secondary transporters, they are all 60–70 amino acids
shorter than the E. coli ProP; lacking the extended
carboxyl tail [2]. Notwithstanding the lack of structural
consistency, particularly at the C-terminal end, we have
shown that six of the seven C. sakazakii proP homo-
logues contribute to C. sakazakii osmotolerance, albeit
to varying degrees [7].
Culham et al. [5] first described the E. coli ProP as
harbouring unusual structural features which appeared
unique within the transporter superfamily. This study
predicted the formation of an alpha helical coiled coil
resulting from the presence of the carboxyl terminal ex-
tension [5]. Indeed, a synthetic polypeptide corresponding
to the C-terminal extension of ProP formed a dimeric
alpha helical coiled coil [6]. Interestingly, when amino acid
changes were introduced to the coiled coil, ProP required
a larger osmotic upshift to become activated [6], suggest-
ing that the C-terminal domain likely plays a role in osmo-
sensing. Furthermore, a derivative of ProP which lacked
the 26 amino acid C-terminal domain was expressed, but
inactive [6]. In contrast, despite the structural degeneracy
observed between the homologues, C. sakazakii ProP ho-
mologues lacking the C-terminal extension do contribute
to osmotolerance, albeit to a lesser extent than the
extended ProP (which we designate Prop1) encoded by
ESA_02131 [7].
While several studies have focused on elucidating the
role of the carboxyl extension in E. coli [5,6,8], little is
* Correspondence: roy.sleator@cit.ie
†
Equal contributors
Department of Biological Sciences, Cork Institute of Technology, Rossa
Avenue, Bishopstown, Cork, Ireland
© 2014 Feeney et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative
Commons Attribution License (http://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and
reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain
Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article,
unless otherwise stated.
Feeney et al. Gut Pathogens 2014, 6:46
http://www.gutpathogens.com/content/6/1/46

known about the role, if any, of the ProP1 carboxyl ex-
tension in the far more osmotolerant C. sakzakii. Herein,
we investigate the role of the C-terminal coiled coil of
ProP1 in contributing to C. sakazakii osmotolerance,
by creating a chimeric protein (ProPc) in which the exten-
ded C-terminal domain of ProP1 (encoded by ESA_02131)
is spliced onto the truncated C-terminal end of ProP2
(encoded by ESA_01706).
Material and methods
Bacterial strains and growth conditions
Bacterial strains and plasmids used in this study are
listed in Table 1.
Creation of the chimeric ProPc protein
PCR primers (Table 2) were designed for each proP ho-
mologue based on C. sakazakii strain BAA-894 sequence
data available from the NCBI database (NC_009778.1).
The formation of the chimeric ProP protein (ProPc),
which consists of the extended coiled coil region of ProP1
(amino acid position 422 to 505) fused to the C-terminus
of ProP2 (encoded by ESA_01706), was performed using a
modified SOEing (Splicing by overlap extension) tech-
nique [12]. In silico comparative analysis of the native
ProP1 and ProP2 sequences, revealed a point of amino
acid homology within the twelfth predicted transmem-
brane domain, a leucine/isoleucine/threonine triplet (LIT)
at position 422–424 and 437–439 respectively, which was
selected as the splice site. Briefly, the fusion was per-
formed using three separate PCR reactions: the first PCR
(primer set Chimeric-01706) resulted in an ESA_01706
(proP2) amplicon lacking the C-terminal extension but
containing a 15-bp 3’overhang corresponding to the LIT
triplet of the ProP1 C- terminal extension. The second
PCR (primer set Chimeric-02131CTE) formed an am-
plicon of 210-bp encoding ProP1 C-terminal extension
with a 5’-overhang, also corresponding to the LIT triplet.
The final PCR (primer set Chimeric-01706-F Chimeric-
02131tail-R) was performed with the two previous ampli-
cons as template; resulting in a final product of 1,623-bp,
representing the ESA_01706 native promoter and modi-
fied coding region (encoding the fused ProP1 C-terminal
extension after the LIT triplet). This product was digested
with restriction enzymes BamHI and HindIII and ligated
to a similarly digested pUC18 vector forming pUC18:
ESA_01706CTE (C-Termini Extension). The integrity
ofthechimericsequencewasconfirmedbysequencing
(MWG Operon, Germany and GATC, Germany) and
transformed into E. coli MKH13.
Osmotolerance assay
Overnight cultures of E. coli MKH13 clones expressing
the wild-type and chimeric ProP proteins (ProP1, ProP2
and ProPC respectively) were grown at 37°C with shak-
ing at 200 rpm in either 10 ml LB or M9 minimal media
containing 0.5% glucose, 0.04% arginine, 0.04% isoleu-
cine, 0.04% valine (Sigma-Aldrich Co.). Cells were pelleted
by centrifugation at 5,000 g, washed and re-suspended in
200 μl ¼ strength Ringer’s solution. The cell suspension
was added to the appropriate filter sterilized media with
varying concentrations (0-10%) of added NaCl. Growth
was monitored in the relevant media over a 48 hour
period, with optical density (OD
600
) readings being taken
every hour. Triplicate readings were taken and graphs
were plotted using SigmaPlot version 11.0. E. coli MKH13
harbouring the empty pUC18 plasmid was used as a nega-
tive control.
Table 1 Bacterial strains and plasmids
Strain or plasmid Relevant genotype or characteristics Source or
reference
Plasmids
pUC18 Amp
r
, lacZ', pMB9 replicon [9]
pUC18: ESA_02131 pUC18 harboring ESA_02131 gene under control of the native promoter [7]
pUC18: ESA_01706 pUC18 harboring ESA_01706 gene under control the native promoter [7]
pUC18: ESA_01706CTE pUC18 harboring chimeric ESA_01706 with fused C-terminal extension (ESA_02131) under
control of the native promoter
This work
Strains
Cronobacter sakazakii BAA-894 C.sakazakii strain isolated from powdered formula associated with neonatal intensive care unit [10]
Escherichia coli DH5αIntermediate cloning host.supE44 ΔlacU169(80lacZΔM15)R17 recA1 endA1 gyrA96 thi-1 relA1 Invitrogen
MKH13 MC4100Δ(putPA)101Δ(proP)2Δ(proU) [11]
MKH13 pUC18:ESA_02131+ Host strain harbouring pUC18: ESA_02131 plasmid. Amp
r
[7]
MKH13 pUC18:ESA_01706+ Host strain harbouring pUC18: ESA_01706 plasmid. Amp
r
[7]
MKH13 pUC18:ESA_01706CTE Host strain harbouring pUC18: ESA_01706CTE plasmid. Amp
r
This work
Amp
r
. This strain is resistant to ampicillian.
Feeney et al. Gut Pathogens 2014, 6:46 Page 2 of 6
http://www.gutpathogens.com/content/6/1/46

Results
C. sakazakii ProP structures
Based on sequence similarity to the E. coli ProP protein,
we identified ProP1 (the product of ESA_02131) as the
most likely ProP homolog in C. sakazakii; exhibiting
90% amino acid sequence identity and structural features
characteristic of E. coli ProP. Indeed, further analysis
using TMHMM and TexTopo software predicted ProP1
to be a membrane protein with 12-transmembrane do-
mains, an extended central hydrophilic loop and carboxy
terminal extension (Figure 1). While the remaining five
ProP homologues on the C. sakazakii BAA-894 genome
were also predicted to encode proteins with 12 trans-
membrane domains and an extended central hydrophilic
loop, they each lacked the extended carboxy-terminal
domain identified in ProP1, a feature which likely affects
the final protein structure and function.
Figure 1B illustrates the tertiary structure for ProP1
(predicted using the I-TASSER server [13,14]). Most not-
ably the presence of a coiled coil domain is evident as a
result of the extended carboxy-terminal identified by se-
quence analysis. The coiled coil domain likely protrudes
into the intracellular cytoplasm of the organism where
its function remains unclear. By contrast, the tertiary
structure of ProP2 (Figure 1A), representative of the
remaining 6 ProP homologues and exhibiting 40% iden-
tity to E. coli ProP and 49% identity to ProP1, lacks the
coiled coil domain at the carboxy-terminal end.
Chimeric protein (ProPc) expression in E. coli MKH13
The osmoprotective properties of ProP1, ProP2 and
ProPc were measured and compared in E. coli MKH13;
an osmosensitive mutant incapable of growth in high
osmolality environments (≥4%). The pUC18 plasmid con-
taining each gene of interest was transformed to E. coli
MKH13. Transformation efficiencies of 60 CFU/μgDNA
were achieved, with successful transformation being con-
firmed by colony PCR, followed by sequencing. Transfor-
mants were screened for osmotolerance on media (both
LB and M9 plus 1 mM proline) containing between 4%
and 10% added NaCl.
Assessment of osmotolerance
To determine the effect of each ProP homologues, both
native (ProP1 and ProP2) and chimeric (ProPc), on the
osmotolerance of E. coli MKH13, each of the strains was
grown in media containing varying concentrations of
NaCl. Growth was monitored over a 48 hour period in
minimal media supplemented with 1 mM proline and
containing 0-10% added NaCl.
Media containing 5% NaCl yielded the most discrimin-
atory results. While E. coli MKH13 expressing the empty
pUC18 vector showed no growth at 5%, each of the other
three strains tested conferred some degree of osmotoler-
ance on the host (Figure 2A). The strain expressing ProP1
was the most osmotolerant, with a maximum optical
density (OD
600
) of 0.326 after 37 hours growth at 5%
NaCl. The strain possessing ProPc grew to an OD signifi-
cantly higher than the strains expressing either ProP1
or ProP2. E. coli MKH13expressingProP2in5%NaCl
grew to a maximum OD of 0.111 after 48 hours, whereas
E. coli MKH13 containing ProPc grew to a final OD of
0.189 at the same time point. Interestingly, growth of the
stains expressing ProP2 and the chimeric protein contin-
ued to increase up to 48 hours, while growth of E. coli
MKH13 expressing ProP1 reached maximum OD after
only 37 hours.
Each E. coli MKH13 strain expressing a proP gene of
interest conferred osmotolerance (Figure 2B). As expec-
ted, E. coli MKH13 demonstrated a significant reduction
in growth rate as NaCl concentrations increased, with
a final growth rate of 0.0004 hr
−1
recorded in media
supplemented with 4% NaCl and no subsequent growth
recorded thereafter. E. coli MKH13 expressing ProP1
demonstrated the highest osmotolerance of all the strains
tested with growth rates of 0.009 hr
−1
to 0.004 hr
−1
re-
corded in media supplemented with 5% to 10% NaCl re-
spectively. The next most osmotolerant strain was that
Table 2 Primers
Primer name Primer sequence (5' to 3') Length Characteristics
ESA_02131 F CATCGGCCGACAGGCCAGTCAATGAATGATGC 32 EagI cut site
R CATTCTAGAGAGTACAACGGAATGCGGGG 29 XbaI cut site
ESA_01706 F CATTCTAGAGTCGGGCGGCTCTTTATCTGG 30 XbaI cut site
R CATGGATCCTTGACCAGATGACGCAGTCTTTC 32 BamHI cut site
Chimeric-01706 F AATAAGCTTGTGGCTTTTTATGCCGGGCTGC 31 HindIII cut site
R CAGGCCAGTAATCAGCGCCGCGCCCATGAC 30 3' SOEing overhang
Chimeric-02131CTE F CGCGGCGCTGATTACTGGCCTGACGATGAAAG 32 5' SOEing overhang
R AATGGATCCTTACTCGTTAATACGAGGATGCTGG 34 BamHI cut site
pUC18 MCS Check F CATTAGCTCACTCATTAGGCACC 23 pUC18 insert check
R CATTGTAAAACGACGGCCAGTG 22 pUC18 insert check
Feeney et al. Gut Pathogens 2014, 6:46 Page 3 of 6
http://www.gutpathogens.com/content/6/1/46

expressing ProPc. Growth rates of 0.004 hr
−1
to 0.003 hr
−1
were recorded in media supplemented with 5% to 10%
NaCl respectively (Table 3). This was higher than the
growth rates observed when E. coli MKH13 expressing
the native ESA_01706 gene (ProP2) was grown in a
high osmolality environment, suggesting an important
role for the C. sakazakii ProP C-terminal extension in
osmotolerance.
Discussion
A unique feature of the neonatal pathogen C. sakazakii
is its ability to survive for prolonged periods in environ-
ments of low a
W
, such as powdered infant formula (PIF),
making it a significant cause for concern [15]. Indeed,
up to 80% of infants infected with C. sakazakii die within
days of birth, while survivors often suffer delayed neu-
rological symptoms, brain abscesses or hydrocephalus
[16,17]. However, despite this, little is known about the
molecular mechanisms that allow this organism to sur-
vive in environments such as PIF where it is subject to
extreme hyper-osmotic stress.
In a previous in silico study we identified seven copies
of an E. coli proP homolog on the BAA-894 genome.
Physiological analysis confirmed that six of the proP ho-
mologues identified played a role in osmotolerance. The
availability of osmolytes in the media also had an effect
on the osmotolerance of the host, with growth rates
varying depending on the type or variety of compatible
solutes present [7]. While all six ProP proteins exhibited
features characteristic of classic secondary transporters,
Figure 1 Predicted transmembrane and tertiary structures of A) ProP2 encoded by ESA_01706, B) ProP1 encoded by ESA_02131 and
C) ProPc.
Feeney et al. Gut Pathogens 2014, 6:46 Page 4 of 6
http://www.gutpathogens.com/content/6/1/46

fiveoftheproteinswerebetween60–70 amino acids
shorter than ProP1; lacking the characteristic C-terminal
cytoplasmic extension Previous studies in our lab have
demonstrated that the six C. sakazakii ProP homo-
logues lacking the C-terminal coiled coil are signifi-
cantly less osmoprotective than ProP1 [7], suggesting
an important role for this domain in modulating C.
sakazakii osmotolerance.
In the current study, the C. sakazakii ProP2 (encoded
by ESA_01706) was chosen as the prototypical ProP
homologue to study the role of the alpha helical coiled
coil in osmotolerance. Genetic splicing yielded a chime-
ric protein structure (ProPc) possessing the native ProP2
domains in addition to the C-terminal alpha helical coiled
coil domain from ProP1 (Figure 1C). E. coli MKH13
expressing ProPc grew to a higher OD in minimal media
supplemented with proline, when compared to the native
protein ProP2 which lacked the extended coiled coil
domain (Figure 2A). These data demonstrate that the
addition of the coiled coil domain from ProP1 to ProP2
results in a protein with an increased osmoprotective
effect on the usually osmotically sensitive E. coli MKH13.
However, as the osmolality of the medium increased, this
trend appeared to reverse with OD readings becoming
similar at 9% NaCl and the chimeric protein growing to a
higher OD than the native in 10% NaCl, suggesting that
the extent of osmotic pressure also has a role to play in
the activity of the proteins.
The role of the C-terminal domain of other osmolyte
transporters, such as BetP (Corynebacterium glutamicum)
and OpuA (Bacillus subtilis), was demonstrated to be im-
portant for the activation of these proteins during an in-
crease in the osmolality of the surrounding medium [18].
Furthermore, Culham et al. created a synthetic polypep-
tide corresponding to the C-terminal domain of E. coli
ProP which formed a dimeric alpha helical coiled coil
structure [6], similar to the coiled coil structure of ProP1
(illustrated in Figure 1A). In the same study ProP proteins
from both E. coli and Agrobacterium tumefaciens, posses-
sing the characteristic alpha helical coiled coil, were acti-
vated at a lower osmolality than orthologues lacking the
coiled coil structure. C. glutamicum possesses a ProP
protein which lacks the C-terminal alpha helical coiled
coil domain and, presumably as a result of this, requires
a higher osmolality for activation [6]. E. coli ProP variants
lacking the coiled coil or with an amino acid substitution
disrupting the formation of the alpha helical coiled coil,
also require a larger osmotic upshift than the wild-type
transporter [6,19]. This study demonstrates that the
activity of these ProP orthologues is dependent on the
osmolality of the surrounding medium, and the alpha
helical coiled coil is believed to tune the transporter to
Table 3 Growth rate and optical density @ 600 nm
Protein
expressed
Gene locus
tags
Name 5% 6% 7% 8% 9% 10%
Max.
OD
Growth
rate (hr
−1
)
Max.
OD
Growth
rate (hr
−1
)
Max.
OD
Growth
rate (hr
−1
)
Max.
OD
Growth
rate (hr
−1
)
Max.
OD
Growth
rate (hr
−1
)
Max.
OD
Growth
rate (hr
−1
)
Native ESA_02131 ProP1 0.326 0.009 0.144 0.005 0.152 0.004 0.177 0.004 0.181 0.004 0.204 0.004
Native ESA_01706 ProP2 0.111 0.003 0.096 0.002 0.083 0.002 0.074 0.002 0.127 0.002 0.171 0.002
Chimeric ESA_02131
ESA_01706
ProPc 0.189 0.004 0.130 0.003 0.113 0.003 0.117 0.003 0.124 0.003 0.141 0.003
Figure 2 Physiological analysis of E. coli MKH13 expressing
ProP1, ProP2, ProPc and the empty pUC18
plasmid. A) Optical density was measured over a 48 hour period in
media supplemented with 0-10% added NaCl. B) Thegrowthrateof
E. coli MKH13 expressing each of the proteins of interest was
measured in media supplemented with 0-10% added NaCl.
Feeney et al. Gut Pathogens 2014, 6:46 Page 5 of 6
http://www.gutpathogens.com/content/6/1/46

osmoregulate the cell over a low osmolality range [19].
These data may therefore offer an explanation for the
increased growth observed in E. coli MKH13 expressing
ProP2, which lacks the coiled coil domain, in media
supplemented with 10% NaCl relative to either ProP1 or
ProPc (Figure 2). It is likely that the coiled coil domain of
C. sakazakii ProP1 has a similar tuning function. Further-
more, the presence of multiple ProP porters lacking the
C-terminal coiled coil domain, and therefore only active at
a higher osmolality, may well explain the extreme osmoto-
lerance unique to C. sakazakii; allowing the pathogen to
survive in environments like PIF. The ProP1 protein, on
the other hand possessing the coiled coil, may be the only
osmolyte transporter required to respond to low or mod-
erate hyperosmotic challenge.
Conclusion
The addition of the coiled coil domain from ProP1 to
ProP2 resulted in a chimeric protein (ProPc) which dem-
onstrated higher osmotolerance compared to the native
ProP2 (under moderate osmotic stress conditions). Fur-
thermore, the growth rate of E. coli MKH13 expressing
ProP2 increased in minimal media supplemented with
10% NaCl; suggesting that, as is the case in E. coli [19], the
coiled coil domain tunes ProP at low osmolality, whereas
ProP transporters lacking the coiled coil domain are more
active at a higher osmolality range.
Competing interests
The authors declare that they have no competing interests.
Authors’contributions
AF, CJ and AL carried out the the experimental work. AF drafted the
manuscript together with together with CJ, AL and RDS. All authors read
and approved the final manuscript.
Acknowledgements
RDS is Coordinator of the EU FP7 ClouDx-i project (grant number 324365).
AF is funded by an IRCSET EMBARK Postgraduate Scholarship RS/2010/2300,
AL is funded by an IRC fellowship (RS/2012/219), CJ is funded by the
Department of Agriculture under the Food Institutional Research Measure
(08RDCIT617).
Received: 29 October 2014 Accepted: 25 November 2014
References
1. Yancey PH, Clark ME, Hand SC, Bowlus RD, Somero GN: Living with water
stress: evolution of osmolyte systems. Science 1982, 217(4566):1214–1222.
2. Feeney A, Sleator RD: An in silico analysis of osmotolerance in the
emerging gastrointestinal pathogen Cronobacter sakazakii. Bioeng Bugs
2011, 2(5):260–270.
3. Sleator RD, Gahan CG, Hill C: Identification and disruption of the
proBA locus in Listeria monocytogenes: role of proline biosynthesis in
salt tolerance and murine infection. Appl Environ Microbiol 2001,
67(6):2571–2577.
4. Sleator RD, Hill C: Bacterial osmoadaptation: the role of osmolytes in
bacterial stress and virulence. FEMS Microbiol Rev 2002, 26(1):49–71.
5. Culham DE, Lasby B, Marangoni AG, Milner JL, Steer BA, Van Nues RW,
Wood JM: Isolation and sequencing of escherichia coli gene proP reveals
unusual structural features of the osmoregulatory proline/betaine
transporter, ProP. J Mol Biol 1993, 229(1):268–276.
6. Culham DE, Tripet B, Racher KI, Voegele RT, Hodges RS, Wood JM: The role
of the carboxyl terminal α-helical coiled-coil domain in osmosensing by
transporter ProP of Escherichia coli. J Mol Recognit 2000, 13(5):309–322.
7. Feeney A, Johnston CD, Govender R, O’Mahony J, Coffey A, Sleator RD:
Analysis of the role of the Cronobacter sakazakii ProP homologues in
osmotolerance. Gut Pathogens 2014, 6:15.
8. Verheul A, Wouters JA, Rombouts FM, Abee T: A possible role of ProP,
ProU and CaiT in osmoprotection of Escherichia coli by carnitine.
J Appl Microbiol 1998, 85(6):1036–1046.
9. Vieira J, Messing J: The pUC plasmids, an M13mp7-derived system for
insertion mutagenesis and sequencing with synthetic universal primers.
Gene 1982, 19(3):259–268.
10. Kucerova E, Clifton SW, Xia X-Q, Long F, Porwollik S, Fulton L, Fronick C,
Minx P, Kyung K, Warren W, Fulton R, Feng D, Wollam A, Shah N, Bhonagiri
V, Nash WE, Hallsworth-Pepin K, Wilson RK, McClelland M, Forsythe SJ:
Genome sequence of Cronobacter sakazakii BAA-894 and comparative
genomic hybridization analysis with other Cronobacter species. PLoS One
2010, 5(3):e9556.
11. Kempf B, Bremer E: OpuA, an osmotically regulated binding protein-
dependent transport system for the osmoprotectant glycine betaine in
bacillus subtilis. J Biol Chem 1995, 270(28):16701–16713.
12. Sleator RD, Gahan CGM, O'Driscoll B, Hill C: Analysis of the role of betL in
contributing to the growth and survival of Listeria monocytogenes
LO28. Int J Food Microbiol 2000, 60(2–3):261–268.
13. Zhang Y: I-TASSER server for protein 3D structure prediction. BMC Bioinformatics
2008, 9(1):40.
14. Roy A, Kucukural A, Zhang Y: I-TASSER: a unified platform for automated
protein structure and function prediction. Nat Protoc 2010, 5(4):725–738.
15. Feeney A, Sleator RD: The human gut microbiome: the ghost in the
machine. Future Microbiol 2012, 7(11):1235–1237.
16. Townsend SM, Hurrell E, Gonzalez-Gomez I, Lowe J, Frye JG, Forsythe S,
Badger JL: Enterobacter sakazakii invades brain capillary endothelial cells,
persists in human macrophages influencing cytokine secretion and
induces severe brain pathology in the neonatal rat. Microbiol 2007,
153(Pt 10):3538–3547.
17. Burdette JHSC: Enterobacter sakazakii brain abscess in the neonate:
the importance of neuroradiologic imaging. Pediatric Radiology 2000,
30(1):33–34.
18. Keates RAB, Culham DE, Vernikovska YI, Zuiani AJ, Boggs JM, Wood JM:
Transmembrane Helix I and Periplasmic Loop 1 of Escherichia coli ProP
are involved in osmosensing and osmoprotectant transport. Biochemistry
2010, 49(41):8847–8856.
19. Tsatskis Y, Khambati J, Dobson M, Bogdanov M, Dowhan W, Wood JM:
The osmotic activation of transporter ProP is tuned by both its
c-terminal coiled-coil and osmotically induced changes in phospholipid
composition. J Biol Chem 2005, 280(50):41387–41394.
doi:10.1186/s13099-014-0046-9
Cite this article as: Feeney et al.:The role of the Cronobacter sakazakii
ProP C-terminal coiled coil domain in osmotolerance. Gut Pathogens
2014 6:46.
Submit your next manuscript to BioMed Central
and take full advantage of:
• Convenient online submission
• Thorough peer review
• No space constraints or color figure charges
• Immediate publication on acceptance
• Inclusion in PubMed, CAS, Scopus and Google Scholar
• Research which is freely available for redistribution
Submit your manuscript at
www.biomedcentral.com/submit
Feeney et al. Gut Pathogens 2014, 6:46 Page 6 of 6
http://www.gutpathogens.com/content/6/1/46