No full-text available
To read the full-text of this research,
you can request a copy directly from the authors.
Determination of Cisplatin 1,2-Intrastrand Guanine-Guanine DNA Adducts in Human Leukocytes by High-Performance Liquid Chromatography Coupled to Inductively Coupled Plasma Mass Spectrometry
Abstract
Platinum-containing drugs are widely used to treat cancer in a variety of clinical settings. Their mode of action involves the formation of DNA adducts, which facilitate apoptosis in cancer cells. Cisplatin binds to the N7 position of the purine DNA bases forming intrastrand cross-links between either two adjacent guanines [cis-Pt(NH(3))(2)d(pGpG), 1,2-GG] or an adjacent adenine and guanine [cis-Pt(NH(3))(2)d(pApG), 1,2-AG)]. The cytotoxic efficacy for each of the different types of DNA adducts and the relationship between adduct levels in tumor cells and blood are not well understood. By using these Pt-containing adduct species as biomarkers, information on a patient's response to chemotherapy would be directly related to the mode of action of the drug. This type of analysis requires the most sensitive and specific methods available, to facilitate detection limits sufficient to measure the DNA adduct in the limited sample quantities available from patients. This was achieved in the current study by coupling a highly specific enzyme-based adduct isolation method with a sensitive detection system based on HPLC coupled to inductively coupled plasma mass spectrometry to measure the 1,2-GG cisplatin adducts formed in DNA. The method was developed and validated using calf thymus DNA and two different adenocarcinoma cell lines. The values for the limit of detection (LOD) and the limit of quantitation determined for the 1,2-GG cisplatin adduct were 0.21 and 0.67 fmol per microg DNA, respectively. This corresponds to an absolute LOD of 0.8 pg as Pt for the 1,2-GG adduct. Cisplatin-sensitive (H23) and -resistant (A549) tumor cells were exposed to the drug, and the 1,2-GG adduct levels were measured over a 24 h time period. The results showed a statistically significant (P < 0.05) higher concentration in the sensitive cells as compared to the resistant cells after repair for 7 h. Although the adduct concentration present fell at subsequent time points (12 and 24 h), the levels in each cell line were broadly similar. The protocol was then applied to the analysis of patient samples taken before and then 1 h after treatment. The 1,2-GG cisplatin adduct was present in the range from 113 to 1245 fg Pt per microg DNA in all of the patient samples taken after treatment. Although the adduct was not present at levels greater than the LOD in the initial pretreatment samples, trace amounts were discernible in some patient samples on their third treatment cycle.
... 2,7,9,10 Since most of these processes are ultimately associated with the prevention of cisplatin-DNA adduct formation, or with their fast removal from the exposed DNA, the accurate detection and quantitation of DNA adducts may be a valuable tool in the early prediction of resistance. [11][12][13][14][15] However, there are some inconsistencies in the literature regarding the value of the cisplatin-DNA adduct level per se as a resistance predictive factor. 8,12 It has been known for several years that cisplatin treatment is able to modify cell cycle progression, [16][17][18] and that this modification could be different for sensitive and resistant cells. ...
... 17 Furthermore, cisplatin can also induce genomic instability, which is generally measured as the presence of DNA strand breaks. [19][20][21][22] Nevertheless, studies combining these two parameters with cisplatin-induced adduct levels are scarce, and most of them make use of rather high and/or different cisplatin concentrations to evaluate each parameter, 13,21,23 thus preventing their comparison. Moreover, significant correlations among parameters have rarely been detected, probably due to difficulties in quantitating DNA adducts accurately. ...
... The intermediate viability of the A549 cells against cisplatin treatment agrees with their classification as cisplatin sensitive 28 or resistant. 13 Our results are also in agreement with the previously described lack of cisplatin-induced apoptosis in this cell line. 15,50 Moreover, comparisons to the GM04312 and A2780 cells suggest that some factor other than adduct levels and cisplatin influx/ efflux must be influencing A549 sensitivity/resistance to this drug. ...
Cisplatin, one of the most extensively used metallodrugs in cancer treatment, presents the important drawback of patient resistance. This resistance is the consequence of different processes including those preventing DNA adducts formation, and/or their quick removal. Thus, an accurate detection and quantitation of cisplatin-induced adducts might be a valuable tool in patient’s resistance prediction. To prove the validity of such assumption, highly sensitive plasma mass spectrometry (ICP-MS) strategies have been applied to determine DNA adduct levels and intracellular Pt concentration. These two metal-relative parameters were combined with the evaluation of biological responses in terms of genomic stability (with the Comet assay) and cell cycle progression (by flow cytometry), in four human cell lines, with different origins and cisplatin sensitivity (A549, GM04312, A2780 and A2780cis), treated with low cisplatin doses (5, 10 and 20 μM for 3 hours). Cell viability and apoptosis were determined as resistance indicators. Univariate linear regression analyses indicated that cisplatin-induced G-G intra-strand adducts, measured 1h after treatment, were the best predictor for viability and apoptosis in all cell lines. Multivariate linear regression analyses revealed that the prediction improved when intracellular Pt content, or when Comet data, were included in the analysis, for all sensitive and for A2780 and A2780cis cell lines, respectively. Thus, a reliable cisplatin-resistance prediction model, that combines adduct quantitation by HPLC-ICP-MS, and their repair, with intracellular Pt content and induced genomic instability, might be essential to identify early therapy failure.
... LC-MS/MS was employed successfully for the quantification of the 1,2-GpG adduct using a stable isotope-labeled internal standard at a detection limit of 3 fmol/μg DNA [9]; however, the described protocol was limited in that it could not be extended to include other cisplatin-DNA adducts. Moreover, the use of a single internal standard did not correct for the variation in enzymatic digestion efficiency that occurs due to the blocking nature of the different cisplatin adducts [10][11][12][13][14][15][16][17][18][19][20][21][22]. Thus, development of a quantitative LC-MS/MS-based method for the detection of cisplatin-bearing DNA necessitates optimization of the enzymatic digestion procedures for the release of the aforementioned cross-link lesions from DNA. ...
... Fig. S7-S13). As was previously reported with unlabeled cisplatin, we observed m/z values corresponding to cisplatin-chelated (*) 1,2-GpG dinucleoside digestion products harboring one [structure II, d(G*pG*)] [9,11,12,16,17,20,22,31] or two [structure I, d(pG*pG*) or d(G*pG*p)] [13,15,18,19,22,[31][32][33][34][35] phosphate groups. Similarly, a cisplatin-containing 1,2-ApG dinucleoside digestion products bearing one [structure IV, d(A*pG*)] or two [structure III, d(pA*pG*) or d(A*pG*p)] [11][12][13]15,[17][18][19][20] phosphate groups were observed. ...
... We also digested the cisplatin-modified ODNs with a cocktail of four enzymes and characterized the digestion products using LC-MS/MS. Similar as previously reported [9,[11][12][13][15][16][17][18][19][20]22,[31][32][33][34][35], digestion of the 1,2-GpG and 1,2-ApG sequences gave rise to dinucleoside products carrying an internal phosphate (Fig. 8, structures I and III, respectively), or containing both an internal and a terminal phosphate (Fig. 8, structures II and IV, respectively). By analyzing digestion products of ODNs containing a 1,2-GpG on the 5′ or 3′ terminus, we demonstrated unambiguously that the terminal phosphate group was located on the 5′-side of the cisplatin adduct. ...
Background:
The primary mode of action for cis-diamminedichloroplatinum (II), referred to as cisplatin, toward the treatment of solid malignancies is through formation of cross-links with DNA at purine sites, especially guanines.
Methods:
We prepared oligodeoxyribonucleotides (ODNs) containing a 1,2-GpG, 1,2-ApG, or 1,3-GpXpG cisplatin intrastrand cross-link and the corresponding ODNs modified with (15)N2-labeled cisplatin, and characterized these ODNs with electrospray ionization mass spectrometry (ESI-MS) and tandem MS (MS/MS). We also employed LC-MS/MS to characterize the digestion products of these ODNs after treatment with a cocktail of 4 enzymes (nuclease P1, phosphodiesterases I and II, and alkaline phosphatase).
Results:
1,2-GpG was released from the ODNs as a dinucleoside monophosphate or a dinucleotide. Analyses of the digestion products of ODNs containing a 1,2-GpG cross-link on the 5' or 3' terminus revealed that the dinucleotide carries a terminal 5' phosphate. On the other hand, digestion of the 1,3-GpXpG intrastrand cross-link yielded 3 dinucleoside products with 0, 1, or 2 phosphate groups.
Conclusion:
The availability of the ODNs carrying the stable isotope-labeled lesions, MS/MS analyses of the cisplatin-modified ODNs, and the characterization of the enzymatic digestion products of these ODNs set the stage for the future LC-MS/MS quantification of the 1,2-GpG, 1,2-ApG, and 1,3-GpXpG lesions in cellular DNA.
... When cisplatin enters the cells, its two chloride atoms are hydrolyzed, resulting in two positive charges (Masters and Koberle 2003;Behmand et al. 2015). Although the hydrolyzed molecule presumably reacts with many molecules in the cell, its therapeutic cytotoxicity is generally considered to stem from reactions with the N7 atoms of purine bases in DNA (Harrington et al. 2010;Dasari and Tchounwou 2014;Behmand et al. 2015). Most cisplatin-DNA adducts are crosslinks between two adjacent guanines (GpG, 65%) or between an adenine and a guanine (5'-ApG-3', 25%). ...
... Since cisplatin forms adducts on purines, we would expect reduced numbers of mutations when G and A is on the transcribed strand (C and T are on the sense strand). As expected, C>A, C>T and T>A SBSs were strongly reduced on the non-transcribed strand (Supplementary Figure 4) (Fousteri and Mullenders 2008;Harrington et al. 2010;Dasari and Tchounwou 2014;Behmand et al. 2015;Hu et al. 2016). Also consistent with TC-NER, strand bias for C>A, C>T and T>A mutations was stronger in more highly expressed genes (p = 2.20×10 -16 , one-sided Chi-squared test for all MCF-10A clones combined, Figure 2A, Supplementary Figure 5). ...
Background and aims
Cisplatin reacts with DNA, and thereby likely generates a characteristic pattern of somatic mutations, called a mutational signature. Despite widespread use of cisplatin in cancer treatment and its role in contributing to secondary malignancies, its mutational signature has not been delineated. We hypothesize that cisplatin’s mutational signature can serve as a biomarker to identify cisplatin mutagenesis in suspected secondary malignancies. Knowledge of which tissues are at risk of developing cisplatin-induced secondary malignancies could lead to guidelines for non-invasive monitoring for secondary malignancies after cisplatin chemotherapy.
Methods
We performed whole genome sequencing of 10 independent clones of cisplatin-exposed MCF-10A and HepG2 cells, and delineated the patterns of single- and dinucleotide mutations in terms of flanking sequence, transcription strand bias, and other characteristics. We used the mSigAct signature presence test and non-negative matrix factorization to search for cisplatin mutagenesis in hepatocellular carcinomas and esophageal adenocarcinomas.
Results
All clones showed highly consistent patterns of single- and dinucleotide substitutions. The proportion of dinucleotide substitutions was high: 8.1% of single nucleotide substitutions were part of dinucleotide substitutions, presumably due to cisplatin’s propensity to form intra-and inter-strand crosslinks between purine bases in DNA. We identified likely cisplatin exposure in 9 hepatocellular carcinomas and 3 esophageal adenocarcinomas. All hepatocellular carcinomas for which clinical data were available and all esophageal cancers indeed had histories of cisplatin treatment.
Conclusions
We experimentally delineated the single- and dinucleotide mutational signature of cisplatin. This signature enabled us to detect previous cisplatin exposure in human hepatocellular carcinomas and esophageal adenocarcinomas with high confidence.
... 3 Cisplatin could form interstrand crosslinks or adducts with the DNA strand. 4 These adducts can cause the DNA duplex to bend, facilitating the binding of various proteins, and eventually leading to cell apoptosis. Cisplatin's interaction and reaction with other proteins has also been linked to cellular damage. ...
... This reaction resulted in primarily 1,2-intrastrand or 1,3-intrastrand crosslinks or adducts (Fig. 1a). 4 Therefor, the binding of cisplatin to DNA changed the intensities of the original CD peaks, i.e., a decreased positive peak at 221 nm, an increased negative peak at 248 nm and a decreased positive peak at 277 nm, which indicated that cisplatin was intercalated into DNA tetrahedron. ...
Cisplatin is the most widely used anticancer drug, but its side effects limit the maximum systemic dose. To circumvent the side effects, a DNA tetrahedron-affibody nanoparticle was prepared by combination of a DNA chain with cisplatin via interstrand crosslinks or adducts. Each nanocarrier can bind ∼68 molecules of cisplatin. This cisplatin nanoparticle exhibited high selectivity and inhibition for breast cancer HER2 overexpressing cells BT474 and lower toxicity in MCF-7 cells with low HER2 expression. The nano-drug inhibited the growth of BT474 cells by 94.57% at 512 nM (containing 33.3 μM cisplatin), which was higher than that of cisplatin (82.9%, 33.3 μM).
... When cisplatin enters the cells, its two chloride atoms are hydrolyzed, resulting in two positive charges (Masters and Koberle 2003;Behmand et al. 2015). Although the hydrolyzed molecule presumably reacts with many molecules in the cell, its therapeutic cytotoxicity is generally considered to stem from reactions with the N7 atoms of purine bases in DNA (Harrington et al. 2010;Dasari and Tchounwou 2014;Behmand et al. 2015). Most cisplatin-DNA adducts are crosslinks between two adjacent guanines (GpG, 65%) or between an adenine and a guanine (5'-ApG-3', 25%). ...
... Since cisplatin forms adducts on purines, we would expect reduced numbers of mutations when G and A is on the transcribed strand (corresponding to C and T on the sense strand). As expected, C>A, C>T and T>A SBSs were strongly reduced on the sense strand (Supplemental Fig. S5) (Fousteri and Mullenders 2008;Harrington et al. 2010;Dasari and Tchounwou 2014;Behmand et al. 2015;Hu et al. 2016). Also consistent with TC-NER, strand bias for C>A, C>T and T>A mutations was stronger in more highly expressed genes (p = 1.45×10 -50 and 1.20×10 -116 , one-sided Chisquared test for all MCF-10A and for all HepG2 clones combined, respectively, Figure 2A, Supplemental Fig. S6). ...
Cisplatin reacts with DNA and thereby likely generates a characteristic pattern of somatic mutations, called a mutational signature. Despite widespread use of cisplatin in cancer treatment and its role in contributing to secondary malignancies, its mutational signature has not been delineated. We hypothesize that cisplatin's mutational signature can serve as a biomarker to identify cisplatin mutagenesis in suspected secondary malignancies. Knowledge of which tissues are at risk of developing cisplatin-induced secondary malignancies could lead to guidelines for noninvasive monitoring for secondary malignancies after cisplatin chemotherapy. We performed whole genome sequencing of 10 independent clones of cisplatin-exposed MCF-10A and HepG2 cells and delineated the patterns of single and dinucleotide mutations in terms of flanking sequence, transcription strand bias, and other characteristics. We used the mSigAct signature presence test and nonnegative matrix factorization to search for cisplatin mutagenesis in hepatocellular carcinomas and esophageal adenocarcinomas. All clones showed highly consistent patterns of single and dinucleotide substitutions. The proportion of dinucleotide substitutions was high: 8.1% of single nucleotide substitutions were part of dinucleotide substitutions, presumably due to cisplatin's propensity to form intra- and interstrand crosslinks between purine bases in DNA. We identified likely cisplatin exposure in nine hepatocellular carcinomas and three esophageal adenocarcinomas. All hepatocellular carcinomas for which clinical data were available and all esophageal cancers indeed had histories of cisplatin treatment. We experimentally delineated the single and dinucleotide mutational signature of cisplatin. This signature enabled us to detect previous cisplatin exposure in human hepatocellular carcinomas and esophageal adenocarcinomas with high confidence.
... All other chemicals and reagents were purchased from BOSTER. A constant injection volume of 20 μL was used throughout the study, and the baseline was set to zero after the injection of the sample [16]. ...
... We next confirmed the effect of EHD1 on the efficacy of CDDP by stably overexpressing EHD1 in NSCLC cells. The indicated cell lines were treated with increasing concentrations (2,4,8,16, 32 and 64 μM) of CDDP for 24 and 48 h before measuring inhibition. Cells that overexpressed EHD1 (A549-EHD1) exhibited higher survival rates than the control line in response to increasing concentrations of CDDP ( Fig. 3b and d). ...
Background
Non-small cell lung cancer (NSCLC) is one of the most aggressive types of cancer. However, resistance to cisplatin (CDDP) remains a major challenge in NSCLC treatment. The purpose of this study was to investigate the ability of EHD1 [Eps15 homology (EH) domain - containing protein 1] to confer CDDP resistance in NSCLC cells and to investigate mechanisms of this resistance.
Methods
The associations between EHD1 expression in NSCLC specimens and clinicopathological features, including prognosis, were assessed by immunohistochemistry (IHC). Using DNA microarrays, we performed a genome-wide analysis of cisplatin-resistant NSCLC cells to identify the involvement of the EHD1 gene in this resistance. We overexpressed and knocked down EHD1 in cell lines to investigate the effect of this gene on proliferation and apoptosis. A quantitative analytical method for assessing CDDP in cells was developed. High-performance liquid chromatography was used to measure the concentration of cisplatin in cells.
Results
The immunohistochemistry assay showed that adjuvant chemotherapy-treated NSCLC patients expressing EHD1 exhibited reduced OS compared with patients who did not express EHD1 (P = 0.01). Moreover, DNA microarrays indicated that the EHD1 gene was upregulated in CDDP- resistant NSCLC cells. The IC50 value of CDDP in cells that overexpressed EHD1 was 3.3-fold greater than that in the A549-control line, and the IC50 value of EHD1 knockdown cells was at least 5.2-fold lower than that of the control cells, as evidenced by a CCK-8 assay. We found that the percentage of early apoptotic cells was significantly decreased in A549-EHD1 cells, but the rates of early apoptosis were higher in the EHD1 knockdown cell line than in the A549/DDP control line, as indicated by a flow cytometry analysis. High-performance liquid chromatography (HPLC) showed that the total platinum level was lower in A549-EHD1 cells than in control cells, and the concentration of CDDP was higher in the EHD1 knockdown cells than in the A549/DDP control cells.
Conclusion
We conclude that EHD1 is required for tumour growth and that it is a regulator of CDDP accumulation and cytotoxicity. The selective knockdown of EHD1 in tumours offers a strategy for enhancing the efficacy of CDDP.
Electronic supplementary material
The online version of this article (doi:10.1186/s12885-016-2527-3) contains supplementary material, which is available to authorized users.
... Several methodologies have been employed for assessing cisplatin-DNA damage, including immunohistochemical assays, 32P postlabeling, ICP-MS, and tandem mass spectrometry. 96,97 Baskerville-Abraham et al. have developed a highly sensitive and specific isotope dilution UPLC-MS/MS assay for quantifying 1,2 guanineguanine intrastrand cisplatin adducts [CP-d(GpG)].98 DNA was digested enzymatically and spiked with 15 N 10 -CP-d( GpG) internal standard. ...
... The use of accurate mass MS in combination with nanoHPLC adducts shows great promise for measuring low abundance adducts in human samples. Other state of the art methodologies for DNA adduct detection include inductive plasma mass spectrometry 96 and accelerator mass spectrometry, 145 which are beyond the scope of the present review. While many of the earlier applications of mass spectrometry in DNA adduct analysis have been limited to studies in laboratory animals where high exposure concentrations induce significant degree of DNA damage, recent advancements in HPLC and MS instrumentation have led to unparalleled sensitivity, enabling their increased use in human biomonitoring, analysis of endogenous DNA damage, and risk assessment. ...
Exposure to endogenous and exogenous chemicals can lead to the formation of structurally modified DNA bases (DNA adducts). If not repaired, these nucleobase lesions can cause polymerase errors during DNA replication, leading to heritable mutations and potentially contributing to the development of cancer. Because of their critical role in cancer initiation, DNA adducts represent mechanism-based biomarkers of carcinogen exposure, and their quantitation is particularly useful for cancer risk assessment. DNA adducts are also valuable in mechanistic studies linking tumorigenic effects of environmental and industrial carcinogens to specific electrophilic species generated from their metabolism. While multiple experimental methodologies have been developed for DNA adduct analysis in biological samples, including immunoassay, HPLC, and (32)P-postlabeling, isotope dilution high performance liquid chromatography-electrospray ionization-tandem mass spectrometry (HPLC-ESI-MS/MS) generally has superior selectivity, sensitivity, accuracy, and reproducibility. As typical DNA adduct concentrations in biological samples are between 0.01-10 adducts per 10(8) normal nucleotides, ultrasensitive HPLC-ESI-MS/MS methodologies are required for their analysis. Recent developments in analytical separations and biological mass spectrometry, especially nanoflow HPLC, nanospray ionization MS, chip-MS, and high resolution MS, have pushed the limits of analytical HPLC-ESI-MS/MS methodologies for DNA adducts, allowing researchers to accurately measure their concentrations in biological samples from patients treated with DNA alkylating drugs and in populations exposed to carcinogens from urban air, drinking water, cooked food, alcohol, and cigarette smoke.
... cisplatin-treated rats in vivo [53], as well as data in the recent literature that only report the detection of G-G intrastrand crosslinks [54] and G-G and A-G cross-links [15]. It is possible that in Drosophila the fact that the larvae are continuously consuming cisplatin renders intermediate adducts (monoadducts) more detectable, because the possibility that the adduct formation process is different in this organism seems unlikely. ...
... Nevertheless, comparisons between blood and buccal cells with tumour cells from the same patients exposed to cisplatin showed higher amount of adducts in dividing tumour cells [15]. Furthermore, a very recent publication by Harrington et al. [54], working with human cancer cell lines, revealed more adducts in the cisplatin-sensitive than in the resistant cell line 7 h after treatment, but when the repair time increased, the differences in cisplatin adduct levels between both cell lines disappeared. In our case, in vivo treatments lasted 12 and 24 h. ...
Cisplatin is a chemotherapeutic drug widely used in the treatment of several tumours, but this chemotherapy presents problems in terms of side-effects and patient resistance. The detection and determination of cisplatin-induced adducts and the relationship with the physiological or clinical effects of this drug under different repair conditions could be a good measure to assess patient's response to such chemotherapy. A new methodological approach to detect and quantify cisplatin adducts by use of high-performance liquid chromatography with inductively coupled plasma mass-spectrometric detection (HPLC-ICP-MS) and isotope-dilution analysis (IDA), is evaluated for its application in vivo, under different repair conditions. This analysis is combined with the use of the Comet assay, which detects DNA strand-breaks, and the w/w(+) SMART assay, which monitors induction of somatic mutation and recombination in Drosophila melanogaster in vivo under different conditions of nucleotide-excision repair. Results show that (i) cisplatin induces in Drosophila several adducts not detected in mammals. The two most abundant cisplatin-induced adducts, identified by electrospray-mass spectrometry as G monoadduct and G-G intrastrand cross-links, were quantified individually; (ii) cisplatin induces higher levels of G monoadducts and G-G cross-links in NER-proficient than in NER-deficient cells; (iii) the level of adducts correlates with their biological consequences, both in terms of DNA strand-breaks (tail-moment values), and of somatic mutation and recombination (frequency of mosaic eyes and clones in 10(4) cells), when the repair status is considered. This work demonstrates the validity and potential of the adduct detection and quantification methodology in vivo, and its use to correlate adducts with their genetic consequences.
... This active aquated species are able to form both intra-and inter-strand DNA crosslinks, mainly with the nitrogen in N7 position of guanine nucleobases, causing the distortion of the DNA helix and proteins to signal for apoptosis. [8][9][10][11][12] Both genomic and mitochondrial DNA can be damaged by the action of these drugs. 13 Although widely used, the clinical utility of Pt II drugs is strongly limited by severe side effects and tumor resistance. ...
Octahedral PtIV complexes are considered highly promising candidates for overcoming some shortcomings of clinically approved PtII drugs. PtIV compounds, owing to their inertia, appear to be capable of resisting premature aquation and undesired binding to essential plasma proteins and have shown remarkable potential for both oral administration and for reducing side effects. Additionally, their pharmacological properties can be finely tuned by choosing appropriate axial ligands. The reduction inside the cell by biological reducing agents to the correponding active cytotoxic PtII species, accompanied by the loss of the axial ligands, is considered an essential step of their mechanism and has been extensively studied. However, a detailed understanding of the mechanism by which PtIV prodrugs are activated, which should be highly beneficial for their proper design, is lacking, and many contradictory results continue to be collected. In the hope of contributing to the advancement of knowledge in this field, this perspective focuses on the insights gained from computational studies carried out with the aim of finding answers to the many still open questions concerning the reduction of PtIV complexes in biological environments.
... The slow repair of 1,2-intrastrand cross-links has been observed with analogous ICP-MS [45][46] and immunological assays 47 , although faster, biphasic repair kinetics was observed with early experiments [48][49] . Many transcription factors such as HMG proteins [50][51][52] , Ixr1 53-54 , mtTFA 51 , LEF-1 51 , and hUBF [55][56] , and mismatch repair proteins 57-59 bind to 1,2-intrastrand cross-links. ...
Cisplatin (CP) is a common anti-tumor drug used to treat many solid tumors. The activity of CP is attributed to the formation of DNA-DNA cross-links, which consist of 1,2-intra-, 1,3-intra-, and interstrand cross-links. To better understand how each intrastrand cross-link contributes to the activity of CP, we have developed comprehensive ultraperformance liquid chromatography-selective ion monitoring (UPLC-SIM) assays to quantify 1,2-GG, 1,2-AG, 1,3-GCG, and 1,3-GTG-intrastrand cross-links. The limit of quantitation for the developed assays ranged from 5 - 50 fmol, or as low as 6 cross-links per 108 nucleotides. To demonstrate the utility of the UPLC-SIM assays, we first performed in vitro cross-link formation kinetics experiments. We confirmed 1,2-GG-intrastrand cross-links were the most abundant intrastrand cross-link and formed at a faster rate compared to 1,2-AG- and 1,3-intrastrand cross-links. Furthermore, we investigated the repair kinetics of intrastrand cross-links in CP-treated wild type and nucleotide excision repair (NER)-deficient U2OS cells. We observed slow repair of both 1,2- and 1,3-intrastrand cross-links in wild type cells, and no evidence of repair in the NER-deficient cells. Taken together, we have demonstrated that our assay is capable of accurately quantifying intrastrand cross-links in CP-treated samples and can be utilized to better understand the activity of CP.
... Indirect clues for other contributing factors come from the observation that patients that received platinum-containing treatment prior to removal of the metastatic biopsy showed a significantly higher number of DELs in CFS. Platinum compounds induce crosslinks between two bases, either GG or AG, in DNA [20,21] while interstrand crosslinks potentially block transcription and replication [22]. We argue that in mCRC patients the mechanism that is used to resolve the transcription-dependent double-fork failure may also act on stalled forks caused by platinum crosslinks. ...
Among the structural variants observed in metastatic colorectal cancer (mCRC), deletions (DELs) show a size preference of ~10 kb–1 Mb and are often found in common fragile sites (CFSs). To gain more insight into the biology behind the occurrence of these specific DELs in mCRC, and their possible association with outcome, we here studied them in detail in metastatic lesions of 429 CRC patients using available whole-genome sequencing and corresponding RNA-seq data. Breakpoints of DELs within CFSs are significantly more often located between two consecutive replication origins compared to DELs outside CFSs. DELs are more frequently located at the midpoint of genes inside CFSs with duplications (DUPs) at the flanks of the genes. The median expression of genes inside CFSs was significantly higher than those of similarly-sized genes outside CFSs. Patients with high numbers of these specific DELs showed a shorter progression-free survival time on platinum-containing therapy. Taken together, we propose that the observed DEL/DUP patterns in expressed genes located in CFSs are consistent with a model of transcription-dependent double-fork failure, and, importantly, that the ability to overcome the resulting stalled replication forks decreases sensitivity to platinum-containing treatment, known to induce stalled replication forks as well. Therefore, we propose that our DEL score can be used as predictive biomarker for decreased sensitivity to platinum-containing treatment, which, upon validation, may augment future therapeutic choices.
... Toxic effects of cisplatin include ototoxicity, neurotoxicity, digestive toxicity, myelosuppression, nausea and emesis. However, the most important toxicity associated with organ dysfunction in over 30% of the cases receiving high doses is renal toxicity [2][3]. ...
Head and neck squamous cell carcinoma (HNSCC) is the sixth worldwide cancer, with more than 650,000 new cases diagnosed each year. The current management of this pathology has evolved over time from surgery or radiotherapy as the only treatment method to a therapeutic association of methods with a modern management based on multidisciplinary loco-regional and systemic treatments. Cisplatin-based chemotherapy administered concurrently with radio-therapy is accepted as a therapeutic standard in locally advanced cases of HNSCC (T3, T4 or N +), these stages accounting for 60% of newly diagnosed patients. The use of induction chemotherapy (IC) has been used for over 30 years, the results being controversial. Currently, the association of taxanes with platinum-fluorouracil-based regimens has shown benefit in numerous studies. Gemcitabine also demonstrated radiosensitizing potential for administration as a single agent or associated with platinum salts. The introduction into the therapeutic arsenal of new molecular target agents or of immunotherapy as well as the development of irradiation techniques with toxicities reductions opens new horizons for the sequential administration of IC followed by radiotherapy as a single method or as a concurrent chemoradiation (CCRT).
... Pt-based drugs were shown to interact with the N7 th position of the DNA purine nucleobases, forming intrastrands-and interstrand cross-links through the generation of adducts at N7 positions of either two adjacent guanines or an adjacent adenine and guanine. The most commonly generated cross-links include d(pGpG) (e.g., the 1,2-GG intrastrand cross-link) and d(pApG) (e.g., the 1,2-AG intrastrand cross-link), which represent 60-65% and 23-28% of adducts, respectively (Harrington et al., 2010;Kumar et al., 2020;Scheeff et al., 1999;Xiao et al., 2017). With increasing number of intracellular Pt-DNA adducts, transcription and replication of DNA becomes inhibited, which ultimately leads to cellular apoptosis (Xiao et al., 2017). ...
Pt-based drugs are one of the main active agents in colorectal cancer treatment. However, drug resistance and dose-dependent side effects are the main barriers that restrict their clinical applications. As an alternative approach to these issues, we designed and synthesized a cell penetrating peptide (CPP) octaarginine-oxaliplatin conjugate that quickly and successfully delivered oxaliplatin into colon cancer cells. The CPP octaarginine is a well-studied cationic peptide that can play a role as a drug delivery vector. In this work, an octaarginine CPP (RRRRRRRR) was conjugated with oxaliplatin via a specific heterobifunctional linker. The in vitro studies showed the conjugate had affinity toward mitochondria inside cells and the MTT assay confirmed that conjugate is active in low micromolar range against colon cancer cells, requiring much lower concentrations than the oxaliplatin alone to reach IC50. More importantly, in the in vivo mouse study, the conjugate effectively inhibited tumor growth and showed considerably high antitumor activity, demonstrating the conjugate can perform well in vivo. This strategy may offer a new approach for designing oxaliplatin derivatives or prodrugs with remarkable therapeutic capabilities.
... After the initial ground work of Rosenberg et al., followed by cisplatin's clinical success led to the worldwide use of platinum-based anticancer drugs [226] as a front-line treatment against cancers such as ovarian, testicular, head and neck, bladder, cervical, melanoma and lymphomas [227,228,229] . The drug exerts it anticancer properties by inducing programed cell death after formation of bulky DNA adducts (monofunctional [230] or bifunctional [231] ) with guanine bases in tumor cells [232] . ...
Biosensors based on DNA self-assembled monolayers (SAMs) combined with electrochemical transducers have shown great potential to serve an important role in simple, accurate and inexpensive genetic analyses relevant to many fields. The most popularly adapted method in designing biosensing platforms is the self-assembly of 5’-alkylthiol-modified single stranded or double stranded DNA on gold surfaces followed by a passivation step using a diluent like mercaptohexanol (MCH). Since analytical performance (sensitivity, selectivity and stability) of such sensors is solely related to the probe surface architecture, methods to characterize and measure the surface density has gained a lot of interest among the scientific community.
In this work we describe the use of an electrochemical quartz crystal microbalance (EQCM) to study the structure and interactions of a mixed SAM of single stranded DNA (ssDNA) and MCH immobilized on gold electrodes. In chronoamperometric experiments in a low ionic strength buffer of 10 mM tris(hydroxymethyl)-aminomethane pH 7.5, upon addition of redox indicators, hexaammine ruthenium(III) (RuHex) and hexaammine cobalt(III) (CoHex) the transient frequency response observed was greatly amplified within a millisecond time scale, to an extent where a simple mass change due to an ion exchange alone couldn’t account for the change in frequency. Thus we attributed this frequency shift effect to switching of viscoelasticity of the DNA layers due to difference in interactions of the two redox indicators, where both indicators interact with the negatively charged phosphate backbone and CoHex additionally form hydrogen-bonding interactions with guanine bases.
Furthermore, we report the largest H/D kinetic isotope effect (kH/kD = 2400) at room temperature (25 °C), for CoHex conjugated with ssDNA/MCH mixed SAMs immobilized on gold electrodes observed through cyclic voltammetry (CV) and differential pulse voltammetry (DPV) studies upon switching the buffer media to deuterium oxide. Subsequent investigations revealed both CoHex and small drug molecule daunomycin showed this deuterium isotope effect while Ruhex did not. The same H/D isotope effects were observed with EQCM redox switching as well. This is explained by the difference in electron transfer mechanisms of the indicators as well as the viscoelasticity changes in the DNA monolayers due to deuterium oxide media.
A feasible novel method to detect cisplatin modified ss & dsDNA/MCH mixed SAMs using this EQCM redox switching is described. For the first time, we demonstrated the use of redox marker molecule RuHex to obtain EQCM responses that can differentiate between cisplatin treated & untreated DNA monolayer within a millisecond timescale. A 95-97 % decrease in the observed frequency response indicated a fully cross-linked ss or dsDNA monolayer with cisplatin.
We believe that this work will pave a way to develop a protocol in using DNA SAMs immobilized on EQCM Au electrodes as a platform for quick and reliable screening of potential chemotherapeutic Pt-based drug candidates that enable DNA modification by cross-linking.
A final study of electrochemical detection of thrombin based on covalent modification of accessible tryptophan residues with the chemical probe [OsO4(bpy)] is reported. Here the covalent adduct formed is detected by the adsorptive stripping signal at -1.25 V on a hanging mercury drop electrode (HMDE) as well as by binding to aptamers immobilized as a SAM on gold electrodes. Molecular dynamic simulations were used to mimic the experimental SELEX protocol to introduce a modification to 27-mer thrombin binding aptamer sequence (HD22), to enhance the binding to [OsO4(bpy)]-labeled thrombin. Extensive analysis on the complexation of both thrombin and labeled thrombin with HD22 and the modified aptamer (HD22’) were performed by Electrophoresis Mobility Shift Assay (EMSA) and Isothermal Titration Calorimetry (ITC). Both EMSA & ITC studies revealed weak binding of labeled thrombin to HD22, which agreed with simulation studies. Although the HD22’ aptamer failed to display improved binding with labeled thrombin, further optimization could lead to positive results. This was an attempt to combine experimental and computational work to develop a generalized way of obtaining more strongly and specifically binding aptamers for labeled targets.
... 50 years later Alfred Werner proposed its square planar configuration and distinguished between the cis and trans isomers cisplatin and transplatin in establishing his theory of coordination chemistry [2]. The discovery of the biological activity and anticancer properties of cisplatin by Barnett Rosenberg [3] followed by its clinical success led to the worldwide use of platinum-based anticancer drugs [4] as a front-line treatment against cancers such as ovarian, testicular, head and neck, bladder, cervical, melanoma and lymphomas [5][6][7]. The drug exerts its anticancer properties by formation of bulky DNA adducts (monofunctional [8] or bifunctional [9]) with guanine bases in tumor cells inducing programed cell death [10]. ...
Biosensors based on DNA self-assembled monolayers (DNA-SAMs) combined with electrochemical transducers have shown great potential to serve an important role in simple, accurate and inexpensive genetic analysis relevant to many fields. Recently we have reported on observing a significant change in the viscoelasticity of such DNA layers immobilized on gold electrodes, upon redox switching of certain metal complexes at a millisecond time scale using an electrochemical quartz crystal microbalance (EQCM). In this study we have performed chronoamperometry on single stranded and double stranded DNA/6-mercapto-1-hexanol (MCH) mixed SAMs on gold electrodes in the presence of hexaammineruthenium(III) (RuHex) to monitor the DNA modification with cis-diamminedichloroplatinum(II) (cisplatin). Our EQCM studies confirmed that the redox response of electrostatically bound RuHex is capable of providing quantitative information regarding the extent of DNA cross-linking with cisplatin. We believe that this method can be used in studies to test the interactions of cancer chemotherapeutic medications like cisplatin with ss & dsDNA and ultimately be a new technology for rapid screening of such potential drug candidates that are able to penetrate the blood-brain barrier and interact with DNA in order to inhibit cancer cell growth of brain tumor tissue by forming DNA adducts.
... e antitumour activity of cisplatin derives from its capacity to form bifunctional DNA cross-links. e main adducts formed by cisplatin with DNA are guanine-guanine (GG) or adenine-guanine (AG) intrastrand cross-links via the coordination of Pt to N7 of guanine inhibiting DNA synthesis and mitosis, and activating apoptotic cell death [28]. Cisplatin has been largely used to cure distinct types of cancer such as head and neck [29], lung [30], ovarian [31], leukaemia [32], breast [33], brain [34], kidney [35], testicular [36], and cervical cancer [37]. ...
Interleukin 2 (IL-2) has been used for the treatment of different types of cancer that express the IL-2 receptor (IL-2R). However, the effect of IL-2 on cervical cancer cells is unknown. IL-2R is present in normal cells of the immune system but not in the healthy cervix. We report that IL-2R is expressed in cervical cancer cells. IL-2 decreases cervical cancer cell proliferation via transient arrest of the G1 phase, which does not result in apoptosis or senescence. IL-2 upregulates the expression of p53 and p21 and downregulates cyclin D. In addition, we report the resistance of cervical cancer cells to treatments that induce apoptosis in HeLa and INBL cells. When arrested cells were treated with cisplatin, the cytokine protected cells from apoptosis induced by cisplatin. The effects of IL-2 on the cell cycle do not induce cellular senescence or activate the proapoptotic protein Bax. The cell arrest induced by IL-2 is conferring protection to cells against apoptosis.
... The reactive molecule has been shown to bind proteins as well as cellular DNA. The DNA binding and subsequent adduct formation result in an apoptotic cascade and cancer cell death (Harrington, Le Pla, Jones, Thomas, & Farmer, 2010;Ming et al., 2017). ...
As novel metallodrugs continue to emerge, they are evaluated using models, including zebrafish, that offer unique sublethal endpoints. Testing metal‐based anticancer compounds with high‐throughput zebrafish toxicological assays requires analytical methods with the sensitivity to detect these sublethal tissue doses in very small sample masses (e.g., egg mass 100 μg). A robust bioanalytical model, zebrafish embryos coupled with inductively coupled plasma‐mass spectrometry (ICPMS) for measurement of delivered dose, creates a very effective means for screening metal‐based chemotherapeutic agents. In this study, we used ICPMS quantitation with the zebrafish embryo assays to detect metal equivalents at multiple response endpoints for two compounds, the chemotherapeutic agent cisplatin and ruthenium (Ru)‐based prospective metallodrug, PMC79. We hypothesized that cisplatin and PMC79 have different mechanisms for inducing apoptosis and result in similar lesions but different potencies following water‐borne exposure. An ICPMS method was developed to detect the metal in waterborne solution and tissue (detection limit: 5 parts per trillion for Ru or platinum [Pt]). The Ru‐based compound was more potent (LC50: 7.8 μm) than cisplatin (LC50: 158 μm) and induced disparate lesions. Lethality from cisplatin exposure exhibited a threshold (values >15 mg/L) while no threshold was observed for delayed hatching (lowest observed adverse effect level 3.75 mg/L cisplatin; 8.7 Pt (ng)/organism). The Ru organometallic did not have a threshold for lethality. Cisplatin‐induced delayed hatching was investigated further by larval‐Pt distribution and preferentially distributed to the chorion. We propose that zebrafish embryo‐larval assays coupled with ICPMS serve as a powerful platform to evaluate relative potency and toxic effects of metallodrug candidates.
... The reactive molecule has been shown to bind proteins as well as cellular DNA. The DNA binding and subsequent adduct formation result in an apoptotic cascade and cancer cell death (Harrington, Le Pla, Jones, Thomas, & Farmer, 2010;Ming et al., 2017). ...
Two new ruthenium complexes, [Ru(η⁵-Cp)(PPh3)(2,2’-bipy-4,4’-R)]⁺ with R = -CH2OH (Ru1) or dibiotin ester (Ru2) were synthesized and fully characterized. Both compounds were tested against two types of breast cancer cells (MCF7 and MDA-MB-231), showing better cytotoxicity than cisplatin in the same experimental conditions. Since multidrug resistance (MDR) is one of the main problems in cancer chemotherapy, we have assessed the potential of these compounds to overcome resistance to treatments. Ru2 showed exceptional selectivity as P-gp inhibitor, while Ru1 is possibly a substrate. In vivo studies in zebrafish showed that Ru2 is well tolerated up to 1.17 mg/L, presenting a LC50 of 5.73 mg/L at 5 days post fertilization.
... Cisplatin, a potent antitumor alkylating agent, is widely used for the clinical treatment of many malignancies, such as testicular, ovarian, head and neck, bladder, esophageal, and small cell lung cancers. Cisplatin exerts its anticancer activity by forming 1,2-intrastrand cisplatin-DNA cross-links (Mantri et al., 2007;Yaneva et al., 2007;Harrington et al., 2010). However, a serious limitation in cancer chemotherapy with cisplatin is the development of drug resistance. ...
It has been reported that Ethaselen shows inhibitory effects on thioredoxin reductase (TrxR) activity and human tumor cell growth. In order to find an efficient way to reverse cisplatin resistance, we investigated the reversal effects of Ethaselen on cisplatin resistance in K562/cisplatin (CDDP) cells that were established by pulse-inducing human erythrocyte leukemic cell line K562, which are fivefold more resistant to cisplatin compared to K562 cells. The morphology and growth showed that the adhesion of K562/CDDP further decreased while the cell volume increased. The proliferation of K562/CDDP is strengthened. The antitumor activities in vitro were assessed by MTT (3-(4,5- dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay and combination index (CI), showing the significant synergic effects of cisplatin and Ethaselen. Focusing on apoptosis, a series of comparisons was made between K562 and K562/CDDP. Cisplatin induced higher reactive oxygen species (ROS) generation in K562 and subsequently induced the formation of mitochondrial permeability transition pores (PTPs). In addition, cisplatin increased the ratio of Bax to Bcl-2 in K562, which can influence the mitochondrial membrane permeability. PTP formation and mitochondrial membrane permeabilization eventually resulted in the release of cytochrome c and activation of the Caspase pathway. However, these effects were not clearly seen in K562/CDDP, which may be the reason for the acquired CDDP resistance. However, Ethaselen can induce a high level of ROS in K562/CDDP by TrxR activity inhibition and increased ratio of Bax to Bcl-2 in K562/CDDP by nuclear factor κB (NF-κB) suppression, which subsequently induces the release of cytochrome c in K562/CDDP. This response is partly responsible for the reversal of the cisplatin resistance in K562/CDDP cells. © 2017, Zhejiang University and Springer-Verlag Berlin Heidelberg.
... The chromatographic separation conditions used were based on those developed in our laboratory for the analysis of cisplatin-DNA intrastrand cross-link adducts by HPLC-ICP-MS [20]. The hyphenated HPLC-ICP-MS system used to determine the Pt-DNA adducts is shown consisted of a quaternary pump (Waters Alliance 2690 separation module) comprising an autosampler and an injector Total concentration of cisplatin GG adduct in cell-lines of differing sensitivity to cisplatin, exposed to 10 and 100 with a variable injection loop (20 L was used throughout the study). ...
... By using HPLC coupled with tandem mass spectrometry (LC-MS/MS), Courdavault et al. 20 studied the repair of three types of bipyrimidine photoproducts in keratinocytes, where they observed a rapid elimination of TT-(6-4) photoproduct from cellular DNA 72 hr post-irradiation. With the use of inductively coupled plasma mass spectrometry (ICP-MS), Harrington et al. 21 discovered a faster removal of cisplatin 1,2intrastrand guanine-guanine adducts (1,2-GG) in cisplatin-resistant human lung tumor cells relative to drug-sensitive cells. LC-MS/MS/MS with the isotope-dilution technique has also been employed to examine the role of NER in repairing endogenously induced intrastrand crosslink d(G[8-5m]T), 8,5′-cyclo-2′-deoxyadenosine, and 8,5′-cyclo-2′-deoxyguanosine in mammalian tissues. ...
Interstrand crosslinks (ICLs) are highly toxic DNA lesions that block transcription and replication by preventing strand separation. ICL-inducing agents were among the earliest, and are still the most widely used, forms of chemotherapeutic drugs. Owing to the repair of DNA ICLs, the therapeutic efficacy of the DNA crosslinking agents is often set back by the development of chemoresistance in patients. Thus, it is very important to understand how various DNA ICLs are repaired. Such studies are currently hampered by the lack of an analytical method for monitoring directly the repair of DNA ICLs in cells. Here we report an HPLC coupled with tandem mass spectrometry (LC-MS/MS) method, together with the isotope dilution technique, for assessing the repair of 8-methoxypsoralen (8-MOP)-induced DNA ICL, as well as monoadducts (MAs), in cultured mammalian cells. We found that, while there were substantial decreases in the levels of ICL and MAs in repair-competent cells at 24 hr after 8-MOP/UVA treatment, there were little repair of 8-MOP-ICL and MAs in XPA-deficient human skin fibroblasts and ERCC1-deficient Chinese hamster ovary (CHO) cells over a 24-hr period. This result provided unequivocal evidence to support that the 8-MOP photoadducts are substrates for nucleotide excision repair (NER) in mammalian cells. This is one of the first few reports about the application of LC-MS/MS for assessing the repair of DNA ICLs. The analytical method developed here, when combined with genetic manipulation, will also facilitate the assessment about the roles of other DNA repair pathways in removing these DNA lesions, and the method can also be generally applicable for investigating the repair of other types of DNA ICLs in mammalian cells.
... 14 Hence, how much cisplatin is bound to DNA will, to a great extent, be determined by kinetics. 15 Nowadays, despite intensive research on the drug's mode of action, there is an ongoing debate on the intracellular fate of cisplatin and how possible interactions with cellular targets could impact on activity and resistance. 16 This can partially be explained by the fact that most of the knowledge is inferred from solution chemistry (under cell-free conditions). ...
To date, preclinical studies have addressed drug accumulation and intracellular distribution of cisplatin by determination of the total Pt content. In this work, the use of liquid chromatography in combination with inductively coupled plasma mass spectrometry (LC-ICP-MS) enabled accurate intact cisplatin quantification in cell model experiments. Hence, for the first time, intracellular drug degradation, drug accumulation and drug efflux were studied by actually quantifying the intact drug, along with the total Pt content of the cell nucleus, the cytosol and the low molecular weight fraction of the cytosol. The latter fraction was obtained by centrifugal filtration (cut-off filter of 10 kDa). Flow injection (FI)-ICP-MS was implemented for platinum quantification. In a first step, kinetics of intracellular cisplatin degradation was addressed by incubating cell extracts with sub-μM drug concentration levels. A half-life of 2 hours was observed in cell extracts of two different cancer cell lines (colon carcinoma and human mesothelioma), which was significantly shorter than that observed in sodium chloride. Hence, it was suggested that intact and nonaquated cisplatin was reacting with cellular components. Due to the large excess of potential binding partners pseudo first order kinetics were observed. The drug accumulation experiments revealed rapid uptake of the drug into the cytosol and the nucleus. Moreover, a significant fraction of Pt was bound to intracellular high molecular weight biomolecules after one hour of exposure. With ongoing time, the intracellular Pt concentration was increasing. However, the cisplatin concentration remained constant during 5 hours of continuous exposure. Assuming a cell volume of 10(-12) L, an intracellular concentration corresponding to the cisplatin concentration in the cell culture medium (5 μM) was estimated. At any time of investigation, intact cisplatin was the predominant species in the low molecular weight fraction of the cytosol. These findings support the hypothesis of passive diffusion as an uptake mechanism. Finally, a model experiment was designed resembling the situation of limited drug exposure time. Human mesothelioma cells were incubated with 5 μM cisplatin for 3 hours. Then the culture medium was replaced and the drug efflux was studied. The observed efflux was biphasic, with the intact cisplatin being removed within the first hour of investigation, while the Pt-protein adduct fraction was removed only partially (30% were still found in the cytosol after 24 hours). No net transfer of Pt from the cytosol to the nucleus fraction was observed after medium replacement.
... Crosslink between C8 and C2 of guanine with C5 of uracil formed due to deamination of cytosine has also been detected (scheme 6e and f) (Crean et al. 2008); one-electron oxidation of both guanine and uracil lead to the formation of this crosslink (Churchill et al. 2011). Binding of the anticancer drug cisplatin (Pt-(NH 3 ) 2 ) to guanine has also been detected to promote G[N7-N7]G (scheme 6g) and G[N7-N3]A (scheme 6h) intra-strand crosslinks (Liu et al. 2002b; Hegmans et al. 2004; Harrington et al. 2010 ). Apart from the base–base crosslinks, covalent bond formation between a base and a sugar in the same or the opposite strands of DNA results in inter-or intra-strand base–sugar crosslinks (Sonntag 1987; Balasubramanian et al. 1998; Burrows and Muller 1998; Cooke et al. 2003; Sczepanski et al. 2008; Geacintov and Broyde 2010; ). ...
DNA is continuously attacked by reactive species that can affect its structure and function severely. Structural modifications to DNA mainly arise from modifications in its bases that primarily occur due to their exposure to different reactive species. Apart from this, DNA strand break, inter- and intra-strand crosslinks and DNA-protein crosslinks can also affect the structure of DNA significantly. These structural modifications are involved in mutation, cancer and many other diseases. As it has the least oxidation potential among all the DNA bases, guanine is frequently attacked by reactive species, producing a plethora of lethal lesions. Fortunately, living cells are evolved with intelligent enzymes that continuously protect DNA from such damages. This review provides an overview of different guanine lesions formed due to reactions of guanine with different reactive species. Involvement of these lesions in inter- and intra-strand crosslinks, DNA-protein crosslinks and mutagenesis are discussed. How certain enzymes recognize and repair different guanine lesions in DNA are also presented.
... Although the amount and the oxidation state of released Pt were determined by ICP-OES and by XPS, respectively, the two methods cannot provide further information about its ligands. To solve this problem, an HPLC-ICP-MS method [29][30][31], which had been successfully used to differentiate a series of Pt species and detect individual species at concentrations down to ng ml À1 , was adopted to analyze the dialysate of MPEG-b-P(LA-co-MCC/Pt) micelles. Considering that the extracellular chloride concentration ($100-150 mM, such as that in blood) is greatly higher than the intracellular values ($3-12 mM) [32]. ...
A biodegradable and amphiphilic copolymer, MPEG-b-P(LA-co-MCC), which contains pendant carboxyl groups was chosen as a drug carrier for active anticancer part (DACH-Pt) of oxaliplatin to form an MPEG-b-P(LA-co-MCC/Pt) complex. It could self-assemble into micelles with a mean diameter of 30−40 nm, and a surface potential near −10 mV. The typical platinum content was 10 wt%. The micelles showed acid responsive drug release kinetics which is beneficial to the drug release under the intracellular environment. The Pt(II) species were released mainly in the form of DACH-Pt-Cl2 in 150 mM NaCl solution and DACH-Pt2+-(H2O)2 in pure water according to the results obtained by HPLC-ICP-MS and XPS. In vitro evaluation showed that the micelles displayed the same or higher cytotoxicities against SKOV-3, HeLa, and EC-109 cancer cells compared with oxaliplatin. The enhanced cytotoxicity against SKOV-3 cells is attributed to effective internalization of the micelles by the cells via endocytosis mechanism and the sensitivity of SKOV-3 cells to platinum drugs. This novel biodegradable and amphiphilic copolymer based platinum drugs will have great potential application in clinic.
In recent studies of cancer therapies, chemodrugs have attracted interest, acting not only as traditional chemotherapeutic agents but also as anticancer immune-activating agents. Specific types of chemodrugs have been demonstrated to exhibit superior anticancer efficacy to others through directly exerting toxic effects on cancer cells and indirectly by inducing immunogenic cell death (ICD) to recruit immune cells to kill them. However, chemodrug-based ICD has not yet achieved satisfactory therapeutic outcomes because of various limitations, including the poor tumor delivery efficiency of chemodrugs, the strong resistance of tumor tissues to chemodrugs, and the immunosuppressive tumor microenvironment.
This review briefly introduces ICD-inducing chemodrugs and their properties, and then explains the advantages of nanomedicine in ICD-inducing chemodrug delivery. Further, studies on chemodrug-loaded nanomedicine-based combined immunotherapy are discussed, with a focus on the cooperative effect of ICD induction with other co-administered immunotherapeutic modalities.
It is possible to obtain better pharmacokinetic properties and tumor accumulation efficiency when using chemodrug-loaded nanomedicines compared with free chemodrugs, resulting in stronger ICD-inducing effects. The tumor-targeting efficiency of nanomedicines can be further improved by their modification with active targeting or tumor stimuli-responsive moieties while diminishing their undesirable biodistribution. Nanomedicines also facilitate the simultaneous delivery of ICD-inducing chemodrugs and other immunotherapeutic agents; these act synergistically to enhance the efficacy of ICD-based combined immunotherapy, even against highly drug-resistant and immunosuppressive tumors. Nanomedicine is expected to provide a promising approach to overcoming the challenges of ICD-inducing chemodrug-based combination cancer immunotherapy.
Cisplatin (CP) is a common antitumor drug that is used to treat many solid tumors. The activity of CP is attributed to the formation of DNA-DNA cross-links, which consist of 1,2-intra-, 1,3-intra-, and interstrand cross-links. To better understand how each intrastrand cross-link contributes to the activity of CP, we have developed comprehensive ultraperformance liquid chromatography-selective ion monitoring (UPLC-SIM) assays to quantify 1,2-GG-, 1,2-AG-, 1,3-GCG-, and 1,3-GTG-intrastrand cross-links. The limit of quantitation for the developed assays ranged from 5 to 50 fmol or as low as 6 cross-links per 108 nucleotides. To demonstrate the utility of the UPLC-SIM assays, we first performed in vitro cross-link formation kinetics experiments. We confirmed that the 1,2-GG-intrastrand cross-links were the most abundant intrastrand cross-link and formed at a faster rate compared to 1,2-AG- and 1,3-intrastrand cross-links. Furthermore, we investigated the repair kinetics of intrastrand cross-links in CP-treated wild-type and nucleotide excision repair (NER)-deficient U2OS cells. We observed a slow decrease of both 1,2- and 1,3-intrastrand cross-links in wild-type cells and no evidence of direct repair in the NER-deficient cells. Taken together, we have demonstrated that our assays are capable of accurately quantifying intrastrand cross-links in CP-treated samples and can be utilized to better understand the activity of CP.
Herein, we have synthesized a series of three-photon fluorescent Pt(II) complexes targeting a tumor-associated biothiol, cysteine (Cys), which allows it to be detected without any interference from other intracellular proteins. We focused on how to significantly improve the fluorescence response of Cys via regulating the recognition units in probes. The reaction of K2PtCl4 with L-CH3 or L-COOEt in DMSO solution gave Lyso-Pt-CH3 and Lyso-Pt-COOEt, respectively, which present four-coordinated square-planar geometries in mononuclear structures. Lyso-Pt-CH3 consists of a Cys aptamer labeled with typical aggregation-induced emission (AIE) characteristics, which shows strong three-photon absorption cross section (3PA) only in the presence of Cys. It was found that Lyso-Pt-CH3 displayed a perfect signal-to-noise ratio for imaging lysosomes and for rapid detection of Cys. Using Lyso-Pt-CH3, Cys-related cellular mechanisms were proposed. We confirm that cystine (Cyss) could be absorbed in cells through cystine/glutamate antiporters (system xc-) and is then converted to Cys under the effect of enzymes. All of these suggest that Lyso-Pt-CH3 might be a potential candidate as a simple and straightforward biomarker of lysosome-related Cys in vitro. Lyso-Pt-CH3 can effectively identify tumor tissues with excessive levels of Cys. Lyso-Pt-CH3 also showed excellent antitumor activity than cisplatin. This work provides a novel strategy for the rational design of controllably activated and Cys-targeted Pt(II) anticancer prodrugs for clinical diagnosis and treatment.
The monofunctional Pt(II) drug phenanthriplatin is a leading preclinical anticancer drug, whose main characteristic is the presence of the extended aromatic system of the phenanthridine ligand, which allows intercalation. Intercalation, in turn, induces DNA unwinding and facilitates DNA binding. Aiming at verifying to what extent the peculiar cytotoxic activity of phenanthriplatin depends on the specific size of the aromatic system, two phenanthriplatin derivatives have been designed increasing the number of the rings in the N-heterocyclic ligand, and their reactivity has been computationally investigated. Both quantum mechanical DFT computations and molecular dynamics (MD) simulations have been employed to investigate some of the aspects that are considered important for the activity of Pt(II) monofunctional complexes. In particular, the substitution of the chlorido ligand with water, subsequent interaction of the aquated complexes with guanine as a model, eventual deactivation by the model N-acetyl methionine as well as intercalation into, binding to and distortion of DNA have been examined. The outcomes of such analysis have been compared with the analogous ones for the phenanthriplatin complex in order to highlight how the addition of one more ring to the phenanthridine ligand and, eventually, its identity influence the reactivity and, consequently, the cytotoxic profile of the complexes.
In the effort to overcome issues of toxicity and resistance inherent to treatment by the approved platinum anticancer agents, a large number of cisplatin variants continues today to be prepared and tested. One of the applied strategies is to use monofunctional platinum complexes that, unlike traditional bifunctional compounds, are able to form only a single covalent bond with nuclear DNA. Chirality, aquation reaction, interaction with guanine and N‐acetyl methionine as well as, intercalation into, binding to and distortion of DNA have been investigated by using both quantum mechanical DFT and molecular dynamics computations aiming at contributing to the elucidation of the molecular mechanism underlying the significantly enhanced spectrum of activity of the monofunctional PtII drug phenanthriplatin. Analogous calculations have been performed in parallel for other two less potent monofunctional PtII drugs, pyriplatin and enpyriplatin, which show very different cytotoxic effects.
Cisplatin (CDDP) is used in the treatment of non-small cell lung cancer (NSCLC), but due to the development of resistance, the benefit has been limited. Toosendanin (TSN) has shown therapeutic effects on NSCLC; however, the role of TSN on CDDP sensitization in NSCLC remains unknown. The antitumor effects of TSN and CDDP sensitization mediated by TSN were explored. TSN was added in various amounts to measure dose- and time-dependent cytotoxicity. Intracellular CDDP was detected by high-performance liquid chromatography. The protein levels of ATP7A, ATP7B, hCTR1, MRP-2, P-gp and Annexin A4 (Anxa4) were analyzed. The tests were conducted using normal NSCLC (A549 cell line) and CDDP-resistant cells (A549/DDP cell line). Anxa4 promotes CDDP resistance by regulating ATP7A, so Anxa4 was overexpressed and silenced and also transfected with pcMV6 or siRNA/ATP7A, respectively. Mechanistic investigations revealed that TSN decreased relative viability in NSCLC cells. Remarkably, TSN significantly enhanced CDDPsensitization in invalid doses. TSN downregulated Anxa4 expression, enhanced intracellular CDDP, and had no effect on MRP-2, P-gp, ATP7A, ATP7B or hCTR1. Subsequently, overexpression of Anxa4 led to a significant decrease in intracellular CDDP concentration. The adjustment of CDDP concentration regulated by TSN disappeared in Anxa4 or ATP7A-silenced cells. TSN also enhanced CDDP sensitization in single ATP7A-overexpressing cells, but had no effect on cells with simultaneous ATP7A overexpression and Anxa4 silencing. The present study suggests that TSN can mediate CDDP sensitization in NSCLC through downregulation of Anxa4.
We report the first electrochemical cisplatin sensor fabricated with a thiolated and methylene blue (MB)-modified oligo-adenine(A)-guanine(G) DNA probe. Depending on the probe coverage, the sensor can behave as a “signal-off” or “signal-on” sensor. For the high-coverage sensor, formation of intrastrand Pt(II)-AG adducts rigidifies the oligo-AG probe, resulting in a concentration-dependent decrease in the MB signal. For the low-coverage sensor, the increase in probe-to-probe spacing enables binding of cisplatin via the intrastrand GNG motif (N = A), generating a bend in the probe which results in an increase in the MB current. Although both high-coverage “signal-off” and low-coverage “signal-on” sensors are capable of detecting cisplatin, the “signal-on” sensing mechanism is better suited for real time analysis of cisplatin. The low-coverage sensor has a lower limit of detection, wider optimal AC frequency range, and faster response time. It has high specificity for cisplatin and potentially other Pt(II) drugs, and does not cross-react with satraplatin, a Pt(IV) prodrug. It is also selective enough to be employed directly in 50% saliva and 50% urine. This detection strategy may offer a new approach for sensitive and real time analysis of cisplatin in clinical samples.
Platinum-DNA adducts, and in particular Pt-GG, has been identified as the major cytotoxic species during chemotherapy treatment with platinum containing drugs. This paper reports for the first time a strategy based on the use of double species-specific isotope dilution analysis (IDA) for the quantification of carboplatin-GG adducts formed by exposing lung cells to carboplatin. The main challenge posed by the use of carboplatin in this pre-clinical application, in comparison with most previously reported work using cisplatin, include the relatively low reactivity of this drug, thus demanding for improved limits of detection to be achieved in order to perform accurate quantification of the adducts at low ng Pt/mg DNA levels with relatively small uncertainty in micro-volumes of the biological sample. This was alleviated by developing micro-flow HPLC reversed phased methodology coupled to sector field ICP-MS (R=300), showing a limit of detection of 0.2 ng Pt/ mg DNA. To perform IDA, carboplatin-GG calibrants and spikes (194Pt-enriched GG adducts) were synthesized in house and characterised for Pt mass fraction, Pt distribution and structural composition. In order to assess the accuracy of the developed procedure, in the absence of certified reference materials, a reference sample prepared by incubation of calf thymus DNA with carboplatin and characterised in house (e.g. for its total P and Pt contents and Pt-GG concentration) was analysed in parallel. The use of this sample as a quality control of the cleavage of DNA and recovery of Pt adducts from real samples makes the described strategy particularly novel. Moreover, spike recovery experiments on the cell samples with the reference carboplatin-DNA sample were undertaken. The validated methodology was applied to cultured human lung cells exposed to carboplatin; Pt-GG adducts were found at a level of 5.54ng Pt/ mg DNA with a relative expanded combined uncertainty (k=2) of approximately 20%. The major contributing factors to the overall measurement uncertainty were the mass fraction of Pt in the natural carboplatin-GG standard, the measured isotope ratio precision of sample and calibration blends and the blend to blend variation. The SI traceable methodology presented here will be invaluable for the provision of reference values to clinical measurements and and cancer clinical trials.
Biomarker-driven drug selection plays a central role in cancer chemotherapy in drug discovery and development, and in diagnostic strategies to improve the use of traditional drugs. DNA-modifying anticancer drugs are still used as first line medication, but drawbacks such as resistance and side effects remain an issue. Monitoring the formation and level of DNA modifications induced by anticancer drugs is a potential strategy for stratifying patients and predicting drug efficacy. In this review, preclinical (where available) and clinical data concerning the relationship between drug-induced DNA adducts and biological response for platinum drugs and combination therapies, nitrogen mustards and half-mustards, hypoxia-activated drugs, reductase-activated drugs, and minor groove binding agents are presented and discussed. Aspects of measurement strategies, identification of adducts, and biological factors that influence the predictive relationship between DNA modification and biological response are addressed. A positive correlation between DNA adduct levels and response was observed for the majority of the studies, demonstrating the high potential of using DNA adducts from anticancer drugs as mechanism-based biomarkers of susceptibility as bioanalysis approaches with higher sensitivity and throughput emerge.
We report progress on predicting tumor response to platinum-based chemotherapy with a novel mass spectrometry approach. Fourteen bladder cancer patients were administered one diagnostic microdose each of [14C]carboplatin (1% of the therapeutic dose). Carboplatin-DNA adducts were quantified by accelerator mass spectrometry (AMS) in blood and tumor samples collected within 24 hours, and compared to subsequent chemotherapy response. Patients with the highest adduct levels were responders, but not all responders had high adduct levels. Four patient-derived bladder cancer xenograft mouse models were used to test the possibility that another drug in the regimen could cause a response. The mice were dosed with [14C]carboplatin or [14C]gemcitabine and the resulting drug-DNA adduct levels were compared to tumor response to chemotherapy. At least one of the drugs had to induce high drug-DNA adduct levels or create a synergistic increase in overall adducts to prompt a corresponding therapeutic response, demonstrating proof-of-principle for drug-DNA adducts as predictive biomarkers.
Improving efficacy and lowering resistance of drugs can be addressed by consideration of the coordination complex speciation and key reactions important to vanadium drugs and platinum drugs under biological conditions. The methods of analyses vary depending on the specific metal ion chemistry. The vanadium compounds interconvert readily, whereas the reactions of the platinum compounds are much slower and thus much easier to study. However, the vanadium species are readily differentiated because of different colors. For both vanadium and platinum systems the importance of understanding the processes as the compounds enter cells is needed to better combat the disease. There are many nucleophiles present in the cytoplasm, which are critical for these drugs because the processing is important to the efficacy of the drugs. Examples of two formulations of platinum compounds illustrate how changing the chemistry of the platinum will result in less toxic and better tolerated drugs. The consequence of the much lower toxicity of the drug, can be readily realized because cisplatin administration requires hospital stay where as Lipoplatin can be done in an outpatient manner. Similarly, the properties of Satraplatin allow for development of an oral drug. These forms of platinum demonstrate that the direct consequence of more selective speciation is lower side effects and cheaper administration of the anticancer agent. Therefore we urge that as the community goes forward in development of new drugs, control of speciation chemistry will be considered as one of the key strategies in the future development of anticancer drugs.
Toxicity bioassays are important tools to determine biological effects of chemical agents on species. The questions remained on, what effects have been imposed on each of the different molecular site of cells by chemical exposure and how to find a pattern for chemical toxicity.
To address the questions, HepG2 cell lines were exposed to the different concentrations of cisplatin for 24 hours to result cell mortality in the range of one to one hundred percent. Fourier Transform Infrared spectroscopy (FTIR) has been used in this study to analyze the chemical alterations on HepG2 cell line by cisplatin. Partial least square regression (PLS) analysis was then applied to the FTIR spectrum results to search for a biomarker peak and present the desire cellular effects of cisplatin. The comparison of cellular FTIR spectra after exposure to different concentrations of cisplatin confirmed the binding of cisplatin to DNA through direct interaction of platinum to guanine and thymine bases of DNA. Biochemical Index Spectra (BIS) were defined based on the differences between of normal and cisplatin exposed cells. Information from the BIS was subjected to PLS analysis to trigger any particular relationship between the toxicity spectral response and cisplatin concentration. This approach was capable of predicting the concentration of cisplatin for any particular effects observed in the cellular FTIR spectrum (R² = 0.968 ± 0.037).
Our work supports the promises that, FTIR can demonstrate the trace of toxicity before the cells dies. Finally, PLS of FTIR data directly predicts the effective concentration of chemicals in particular cellular components.
This chapter describes strategies and methods for speciation investigations using mainly hyphenated techniques of liquid chromatography with element-specific detection. Complete speciation schemes are discussed, starting with the sources of error and problem solutions for sampling and ending with more dimensional, orthogonally chosen coupled-speciation techniques for quality controlled results. The focus in each section is directed to the specific problems being faced with respect to speciation analysis: species stability during sample storage and processing, the choice of the most suitable speciation approaches (direct methods or hyphenated techniques), species separation techniques ranging from ultrafiltration to various forms of liquid chromatography, and capillary electrophoresis, discussing their advantageous as well as their (undesired) potential of changing species. Further, problems in interfacing to element-specific detectors, mainly plasma-based detectors like ICP OES and ICP MS are reported. The chapter concludes with aspects of quality control, including sources of errors and strategies to overcome such problems, such as orthogonal speciation concepts.
We report the design and fabrication of a reagentless and reusable electrochemical sensor for detection of satraplatin (SAT), a platinum (IV) prodrug. The detection strategy is based on the electrocatalytic reaction between the Pt(IV) center of SAT and the surface-immobilized methylene blue. We systematically evaluated the effect of passivating diluent chain length on the overall sensor performance. Our results show that the use of a shorter diluent like 2-mercaptoethanol is more advantageous than using a longer and more passivating diluent such as 6-mercapto-1-hexanol. Independent of the use of cyclic voltammetry or chronoamperometry as the sensor interrogation technique, all three sensors, each passivated with a different alkanethiol diluent, have demonstrated to be sensitive, with a limit of detection in the range of 1 - 10 µM. They are also highly specific and do not respond to Pt(II) drugs such as cisplatin and carboplatin. More importantly, they are selective enough to be employed directly in 50% serum. This sensing strategy has potential applications in clinical pharmacokinetics studies.
The determination of trace elements has assumed a place of prominence in the life sciences. Elements present at even minimal concentrations in biological and environmental matrices can have a significant influence on vital functions, depending on the amount present. The study of, for example, pathophysiological processes in the human body requires the determination of elements at concentrations measured in μgL−1, ngg−1, and even pgg−1. The higher concomitant amounts of organic and inorganic components make it difficult to determine the presence of trace elements. Moreover, it is a complex process that progresses from an initial trace element analysis to the final statement of biological implications, one that requires close collaboration between the analytical chemist and life scientist. Furthermore, it should be kept in mind that the concept of zero tolerance for potentially toxic elements has been replaced by the more scientific notions of safe ranges of exposure and range of safe intake.
Platinum (Pt)-based pharmaceutical drugs are among the most active agents utilized for the therapy of cancer. Carboplatin, cisplatin and oxaliplatin are three members of the platinum anticancer drug family approved by Food and Drug Administration (FDA). Despite gaining enormous success, the extensive application and efficacy of these drugs are often impeded by toxic side effects, their susceptibility to acquired drug resistance, and limited activity against many human cancers. These compounds are known to induce the apoptosis of tumor cells by binding to nuclear DNA, forming a variety of structural adducts to trigger cellular responses. To better understand the anticancer treatment with Pt-based chemotherapeutics, pharmaceutical formulations in perfect quality are required and the behavior of the drugs must be studied at therapeutically relevant levels by separation and detection of the intact drug and its individual biotransformation species in clinical samples. In this review, Pt-based drugs are introduced and the detection methods of Ptbased adduct with DNA and protein have been discussed.
Drug discovery and development is a long, expensive, and multiplex process, most of the steps (if not all of them) are unfeasible without use of different analytical techniques. In the case of metal-based drugs, their preclinical development and clinical testing increasingly rely on ICP-MS, having no-match analytical features in this seemingly 'killer' application. Applied with the standalone or combined (hyphenated) setup, the method allows robust, sensitive, and precise determinations of drug-comprising metals as well as specific and often multielemental detection of the biomolecular metabolic forms. This analytical information is invaluable for the assessment of drug-like properties, metabolite fingerprinting and profiling, monitoring the drug-biomolecule interactions, cellular uptake and pharmacokinetic studies, etc. but above all, for a better understanding of a drug's mechanisms of delivery and action. This review is mainly focused on the emerging role and current challenges of ICP-MS-based methodology in the field. Consistently with the title matter, special emphasis is placed on investigational metal-containing compounds that not only exhibit certain pharmacological or diagnostic properties but also hold promise of being advanced to (or already entered) clinical studies. It also provides a brief outlook of how the potential of ICP-MS is to be exploited in the future so as to accelerate the metallodrug development and reduce the enormous accompanying costs.
This is the fifth Atomic Spectrometry Update (ASU) to focus specifically on developments in elemental speciation and covers a period of approximately 12 months from January 2012. The International Union for Pure and Applied Chemistry (IUPAC) have evaluated speciation and provided a definition as follows: "speciation analysis is the analytical activity of identifying and/or measuring the quantities of one or more individual chemical species in a sample; the chemical species are specific forms of an element defined as to isotopic composition, electronic or oxidation state, and/or complex or molecular structure; the speciation of an element is the distribution of an element amongst defined chemical species in a system". This review therefore deals with all aspects of the analytical speciation methods developed for: the determination of oxidation states; organometallic compounds; coordination compounds; metal and heteroatom-containing biomolecules, including metalloproteins, proteins, peptides and amino acids; and the use of metal-tagging to facilitate detection via atomic spectrometry. As with all ASU reviews(1-5) the coverage of the topic is confined to those methods that incorporate atomic spectrometry as the measurement technique. However, in the spirit of meeting the needs of the subject, material is incorporated that is not strictly "atomic spectrometry". For the most part, such procedures are those in which some form of molecular MS is used for speciation measurements, often in parallel with an elemental detector. As the content of this Update shows, the field is now maturing as evidenced by the extent to which the speciation of particular elements or technique combinations have been the subject of review articles. However, it is becoming increasingly difficult to ascertain the analytical details of the methodologies applied in speciation analysis, particularly where the paper is published in an 'application' based journal.
Anticancer metallodrug development has for a long time been characterised by the similarity of new drug candidates to cisplatin and DNA as the primary target. Recent advances in bioanalytical techniques with high sensitivity and selectivity have revealed that metal-based drugs can undergo a wide range of biomolecular interactions beyond DNA and have generated interest in proteins as possible targets for metallodrugs. In fact, implementation of metallomics approaches that are able to reveal the fate of the compounds in biological systems can help to move drug development towards more targeted and rational design of novel metallodrugs. Additionally, proteomic screening and gene expression analysis can provide insight into physiological response to drug treatment and identify the reasons for drug resistance. Herein, we review selected applications which led to a better understanding of the mode of action of clinically established metal-based anticancer agents and novel metallodrug candidates.
In this work we present a methodology to measure the complex adduct spectrum caused by the interaction of Cisplatin with DNA. By using an optimized DNA digestion procedure we were able to show that the adduct spectrum in in vivo duplex DNA is much more complex than described so far. For the first time a high abundance of interstrand adducts has been detected by using HPLC/ESI-MS. These adducts could play a key role in the DNA repair mechanisms and the development of cellular resistance to Cisplatin. By species-unspecific isotope dilution analysis HPLC/ICP-MS measurements, we were able to study the kinetics of adduct formation. With these experiments we proved that after the initial formation of adducts a rearrangement occurs on the DNA-strands leading to significant changes in adduct patterns over time. Furthermore, the parameters of the species-unspecific isotope dilution analysis were optimized to allow measurements of specific adducts in the DNA of Cisplatin exposed cells.
Method development and applications of hyphenated techniques as tools for speciation analysis of metal-based pharmaceuticals are summarized within this review. Advantages and limitations of the separation modes-high-performance liquid chromatography (HPLC), capillary electrophoresis (CE), and gas chromatography (GC)-as well as the detection modes-inductively coupled plasma-mass spectrometry (ICP-MS) and electrospray ionization-mass spectrometry (ESI-MS)-are discussed. ICP-MS detection is found to be advantageous for the quantification of drugs containing metals and other heteroatoms. The species-independent sensitivity and multielement capabilities of ICP-MS allow it to be used for quantification even when species-specific standards are not available, as well as to determine the stoichiometry in metallodrug-biomolecule interactions. Molecular information that is totally destroyed when ICP is applied as ionization source and is therefore not obtainable via ICP-MS detection can be accessed by the complementary technique of ESI-MS. Speciation analysis combining both elemental and molecular information is therefore a powerful tool for the analysis of metal-based pharmaceuticals and their metabolites in body fluids and other relevant matrices.
Despite an increasing understanding of the molecular mechanisms by which platinum drug DNA adducts interact with cellular processes, the relationship between adduct formation in tumours and clinical response remains unclear. We have determined carboplatin-DNA adduct levels in biopsies removed from ovarian cancer patients following treatment. Reliability of DNA adduct measurements in tissues samples were assessed using experimental animals. Platinum-DNA adduct levels were measured using inductively coupled plasma mass spectrometry (ICP-MS) and plasma drug concentrations determined by atomic absorption spectrometry (AAS). Adduct levels in tissues and plasma pharmacokinetics were determined in Balb/c mice exposed to platinum drugs. Comparisons of adduct levels in tumour and normal tissue were made in nu/nu mice carrying human neuroblastoma xenografts. At 30 min post-cisplatin administration, adduct levels in DNA from kidney and liver were approximately 10- and 6-fold higher than spleen or tumour. By 60 min, levels in liver and kidney, but not spleen or tumour, had fallen considerably. Carboplatin showed high adduct levels only in kidney. Adduct levels in tumour xenografts were comparable to those induced in vitro with similar drug exposures. In clinical samples removed 6h after drug administration, adduct levels ranged from 1.9 to 4.3 and 0.2 to 3.6 nmol Pt/g DNA for tumour biopsies and peripheral blood mononuclear cells, respectively. No correlation was apparent between these two data sets. The present results demonstrate that reliable measurements of adducts in clinical tumours are feasible. Future results should provide insight into drug resistance.
As the cis-platinum (cis-Pt) antitumoral effect in mammals seems to be related to its binding to DNA components, experiments with in vitro incubation of the individual DNA nucleotides with cis-Pt and analysis of the products by electrospray mass spectrometry (ESI-Q-TOF) are described here. The only detectable complex of such binding has been the one formed by a cis-Pt molecule bound to two adjacent guanines (m/z 921), as confirmed by collisional induced dissociation. The separation of the cis-Pt adducts from the unreacted nucleotides has been conducted by highperformance liquid chromatography coupled on-line with inductively coupled plasma mass spectrometry (HPLC-ICP-MS), monitoring 31P and 195Pt. Two different chromatographic columns have been evaluated for this purpose: a RP-amide-C16 and a narrow-bore C8. Best separation characteristics for the four nucleotides of DNA (coming from adenine, thymine, cytosine and guanine nucleobases) and the formed cis-Pt adduct were obtained for the C8 column using a mobile phase containing 60 mM ammonium acetate (pH = 5.8) and 7.5% MeOH. This HPLC-ICP-MS method allowed an easy separation and detection of free nucleotides (by monitoring P) from the synthesized adduct (containing P and Pt in the same molecule). Quantitative capabilities of the proposed hybrid method, by monitoring 31P and 195Pt, have been compared by analysing the cis-Pt adduct formed by the oligonucleotide of sequence 5’-TCCGGTCC-3’ after incubation with cis-Pt and enzymatic hydrolysis. Final application of this methodology to commercially available calf thymus DNA samples has been also satisfactorily accomplished.
Measurement of the different physicochemical forms of metals and metalloids is a necessary pre-requisite for the detailed understanding of an element's interaction with environmental and biological systems. Such chemical speciation data is important in a range of areas, including toxicology, ecotoxicology, biogeochemistry, food safety and nutrition. This chapter considers developments in the speciation analysis of organometallic compounds (OMCs), focusing on those of As, Hg, Se and Sn. Typically, organometallic analysis requires a chromatographic separation prior to analyte detection and gas chromatography (GC), high performance liquid chromatography (HPLC) or capillary electrophoresis (CE) can serve this purpose. Following separation, detection is achieved using element specific detectors (ESDs) such as inductively coupled plasma mass spectrometry (ICP-MS), inductively coupled plasma optical emission spectroscopy (ICP-OES), atomic fluorescence spectrometry (AFS), atomic absorption spectrometry (AAS) or atmospheric pressure ionization mass spectrometry (API-MS). Techniques employing a vapor generation (VG) stage prior to detection are also discussed. Complementary structural and quantitative data may be acquired through the combination of elemental and molecular mass spectrometry. The advantages and disadvantages of the various analytical systems are discussed, together with issues related to quantification and quality management.
Platinum chemotherapeutic agents have been widely used in the treatment of cancer. Cisplatin was the first of the platinum-based chemotherapeutic agents and therefore has been extensively studied as an antitumor agent since the late 1960s. Because this agent forms several DNA adducts, a highly sensitive and specific quantitative assay is needed to correlate the molecular dose of individual adducts with the effects of treatment. An ultraperformance liquid chromatography tandem mass spectrometry (UPLC-MS/MS) assay for quantification of 1,2 guanine-guanine intrastrand cisplatin adducts [CP-d(GpG)], using (15)N(10) CP-d(GpG) as an internal standard, was developed. The internal standard was characterized by MS/MS, and its concentration was validated by inductively coupled plasma mass spectrometry. Samples containing CP-d(GpG) in DNA were purified by enzyme hydrolysis, centrifugal filtration, and HPLC with fraction collection prior to quantification by UPLC-MS/MS in the selective reaction monitoring mode [m/z 412.5-->248.1 for CP-d(GpG); m/z 417.5-->253.1 for [(15)N(10)] CP-d(GpG)]. The recovery of standards was >90%, and quantification was unaffected by increasing concentrations of calf thymus DNA. This method utilizes 25 mug of DNA per injection. The limit of quantification was 3 fmol or 3.7 adducts per 10(8) nucleotides, which approaches the sensitivity of the (32)P postlabeling method for this adduct. These data suggested that this method is suitable for in vitro and in vivo assessment of CP-d(GpG) adducts formed by cisplatin and carboplatin. Subsequently, the method was applied to studies using ovarian carcinoma cell lines and C57/BL6 mice to illustrate that this method is capable of quantifying CP-d(GpG) adducts using biologically relevant systems and doses. The development of biomarkers to determine tissue-specific molecular dosimetry during treatment will lead to a more complete understanding of both therapeutic and adverse effects of cisplatin and carboplatin. This will support the refinement of therapeutic regimes and appropriate individualized treatment protocols.
For the improvement of chemotherapy with platinum (Pt)-containing drugs a sensitive assay to detect the induced Pt-DNA adducts is needed. Therefore, the 32P-postlabelling assay, described by Blommaert and Saris (Nucleic Acids Res., 1995, 23, 1300-1306), to detect the major adducts Pt-GG and Pt-AG has substantially been improved and compared with ELISA and AAS. For the quantification of the adducts, TpT was added as an internal standard immediately after isolation of the Pt-adducts from digested DNA samples. It was found that 32P-labelling of both GpG and ApG, the dinucleotides obtained after deplatination of the adducts, was equally efficient as that of TpT. To isolate the Pt-adducts on basis of a positive charge, the pH of DNA digests was adjusted to approximately 3 prior to separation by strong cation-exchange chromatography. For the subsequent deplatination a volume of only 12 microl of 0.2 M NaCN was used, which did not interfere with the following labelling step. The quantification of the 32P-labelled dinucleotides was performed by phosphorimaging of spots after separation on TLC as well as by 32P-counting of fractions collected after separation by HPLC. The method was used to determine adduct levels in in vitro cisplatin-treated DNA and in DNA isolated from cisplatin-treated cultured cells, tumor xenografts from cisplatin-treated mice, and from white blood cells and (tumor) tissues from cisplatin-treated patients. The results show a significant correlation with the adduct levels as determined with atomic absorption spectroscopy (high levels) or with specific antibodies (low levels). This assay appears to be useful for the determination of low levels of Pt-adducts in small DNA samples as present in clinical specimens such as blood and tumor tissue, but also in buccal mucosal cells and fine needle aspirates.
Platinum-DNA adducts can be assayed in peripheral blood leukocytes by means of atomic absorption spectroscopy and ELISA, and high adduct levels have been correlated previously with favorable clinical response to platinum-based chemotherapy. Our purpose was to study adduct formation in peripheral blood leukocytes by means of a new method, inductively coupled plasma mass spectroscopy (ICP-MS), and to correlate adduct formation with clinical response and toxicity. Platinum (Pt)-DNA adducts were measured by means of ICP-MS in leukocytes of 66 patients receiving a cisplatin- or carboplatin-based chemotherapy, collected either before the beginning of treatment and incubated in vitro with cisplatin or 1 and 24 h after the administration of drug to the patient. The Pt-DNA adduct level in leukocytes from patients exposed to drug in vitro was 14.33 +/- 14.71 fmol/microgram DNA (mean +/- SD), which was not significantly different from the value of 23.4 +/- 19.53 fmol/microgram DNA observed in leukocytes from nine healthy volunteers. In samples collected after the administration of chemotherapy, Pt-DNA adducts ranged from 1.91 +/- 3.59 fmol/microgram DNA (mean +/- SD) at the 1-h time point to 2.61 +/- 3.35 fmol/microgram DNA at 24 h (P > 0.05). Adduct levels in leukocytes exposed in vitro did not correlate with adduct levels from patients treated with cisplatin-based chemotherapy (r = 0.085 and 0.011 at 1 and 24 h, respectively). At 24 h, adduct levels in patients receiving cisplatin (3.15 +/- 3.64 fmol/microgram DNA, mean +/- SD) were significantly higher (P = 0.02) than those observed in patients treated with standard dose carboplatin (0.57 +/- 0.73 fmol/microgram DNA) and also higher than those in patients receiving high-dose carboplatin (1.18 +/- 1.06 fmol/microgram DNA), although the latter difference did not reach statistical significance (P = 0.071). No differences in adduct levels (mean +/- SD) were evident between patients responsive (3.23 +/- 3.51 fmol/microgram DNA) and nonresponsive (2.34 +/- 3.01 fmol/microgram DNA) to chemotherapy. In the homogeneous group of patients treated with combination of cisplatin and 5FU, received dose intensity, hemoglobin decrease, and posttreatment creatinine could not be linked with the extent of leukocyte adduct formation. The data presented here demonstrate that ICP-MS allows the detection of adducts in patients treated with cisplatin or carboplatin and suggest that adduct formation in leukocytes is not a major determinant of response or toxicity.
The antitumoral effect of cisplatin [cis-diamminodichloroplatinum(II)] in mammals is related to its binding to DNA components. However, there is a lack of specific chemical methods to selectively detect those adducts formed in vivo at low concentrations. In this work, a new sensitive and selective method of determining cisplatin–DNA adducts based on the use of element-selective mass spectrometry is proposed, and the method is then applied to detect cisplatin adducts induced in vivo in somatic cells of Drosophila melanogaster. The bioanalytical strategy proposed here allows the determination of the most important DNA adduct formed between adjacent guanine units of the same DNA strand with cisplatin, and it is based on the coupling of capillary liquid chromatography (cap-LC) to inductively coupled plasma mass spectrometry (ICP-MS). This set-up allows the simultaneous monitoring of the Pt (from the drug) and P (from the DNA components) present in these adducts, once they have been cleaved by enzymatic hydrolysis of the DNA samples. Using this instrumental set-up, the adducts of cisplatin formed in vivo when D. melanogaster flies are exposed to different cisplatin concentrations can be detected and their concentration determined. The results obtained show a direct correlation between the concentration of cisplatin adducts, the induced genotoxic damage (measured as DNA strand breaks using the Comet assay) and the cisplatin concentration.
Figure
The work illustrates the complementary use of bioanalytical and biological information to study cisplatin interactions with DNA is vivo at biologically relevant concentrations of the drug
Cisplatin is an extremely effective cancer chemotherapeutic agent, but its use is often accompanied by toxicity. Second generation drugs such as carboplatin are becoming more widely used because of reduced toxicity. Since biotransformation products have been implicated in the toxic responses, we have begun to investigate the reactions of cisplatin and carboplatin with potential biological ligands. Reaction products were characterized using HPLC with inductively
coupled plasma - mass spectrometry (HPLC-ICP-MS), 1H and 13C NMR and fast atom bombardment - mass spectrometry (FAB-MS). Three Pt-creatinine complexes, cis-[Pt(NH3)2Cl(Creat)]+, cis-[Pt(NH3)2(H2O)(Creat)]2+ and cis-[Pt(NH3)2(Creat)2]2+, were synthesized and the platinum was shown to coordinate to the ring nitrogen, N(3). Human urine samples from patients on cisplatin chemotherapy were shown to contain cisplatin, its hydrolysis product and biotransformation products containing Pt-creatinine, Pt-urea and Pt-uric acid complexes. Urine from carboplatin patients shows fewer biotransformation products. Studies with control and diabetic (protected against cisplatin toxicity) rats showed systematic differences in the biotransformation products formed on administration of cisplatin.
Salmon sperm DNA, treated with the antitumor agent cis-diamminedichloroplatinum(II) (cis-DDP), was enzymatically degraded to (oligo)nucleotides. Four Pt-containing products were identified by 1H NMR after preparative chromatography on a diethylaminoethyl-Sephacel column at pH 8.8. In all identified adducts, comprising approximately 90% of the total Pt in the DNA, Pt was linked to the N7 atoms of the nucleobases guanine and adenine. The two major adducts were cis-Pt(NH3)2d(pGpG) and cis-Pt-(NH3)2d(pApG), both derived from intrastrand cross-links of cis-DDP on neighboring nucleobases. Only the d(pApG) but not the d(pGpA) adduct could be detected. Two minor adducts were Pt(NH3)3dGMP, resulting from monofunctionally bound cis-DDP to guanine, and cis-Pt(NH3)2d(GMP)2, originating from interstrand cross-links on two guanines as well as from intrastrand cross-links on two guanines separated by one or more bases. For analytical purposes we developed an improved method to determine cis-DDP adducts. Routinely, 40-micrograms samples of enzymatically degraded cis-DDP-treated DNA are now analyzed by separation of the mononucleotides and Pt-containing (oligo)nucleotides on the anion-exchange column Mono Q (FPLC) at pH 8.8 (completed within 14 min) and subsequent determination of the Pt content in the collected fractions by atomic absorption spectroscopy. The method was used to optimize the digestion conditions for cis-DDP-treated DNA. In kinetic studies on the formation of the various adducts, a clear preference of the Pt compound to react with guanines occurring in the base sequence d(pGpG) was established.
Cisplatin, mono- and diaquacisplatin were measured in aquatic samples and in diluted urine of a cancer patient by HPLC-ICP-MS. On-line IDMS was applied for accurate, species unspecific quantification. Limits of detection of 0.74, 0.69 and 0.65 mug L-1 (3 s criterion) were calculated for cisplatin, monoaqua- and diaquacisplatin, respectively. Degradation kinetics of 6x10(-6) M cisplatin were determined over a period of 48 h in solutions containing 100, 50 and 0 mg L-1 chloride, showing the suitability of the HPLC-ICP-MS method for kinetic model studies. The first order rate constants k(1) of cisplatin aquation for the three chloride concentrations were 1.79x10(-5), 1.68x10(-5) and 2.06x10(-5) s(-1). For cisplatin anatation (second order reverse reaction), rate constants of k(-1)=6.5x10(-3), 5.8x10(-3) and 4.1x10(-3) M-1 s(-1) could be assessed. At low chloride levels, no equilibrium was established between cisplatin and its degradation products. It was found that the intermediately formed mono- and diaquacisplatin-products started to decay after several hours. Diluted urine of a cancer patient contained the parent drug cisplatin and a considerable fraction of highly active monoaquacisplatin, as well as several unknown platinum species.
Antibodies elicited against the haptens cis-Pt(NH3)2dGuodGMP and its ribo-analog, both covalently coupled to bovine serum albumin, recognize adducts of cis-diamminedichloroplatinum(II) (cis-DDP) in DNA. Antibody-binding to cis-DDP-DNA strongly depends on the accessibility of the adducts to the antibodies. In double-stranded cis-DDP-DNA with low Pt: nucleotide ratios (rb's), this accessibility is enhanced by unwinding of the cis-DDP-DNA, e.g. by heat-denaturation. An unwinding effect is also induced by the cis-DDP treatment itself. A260nm readings of cis-DDP-DNA samples indicate an increased denaturation of the DNA at increasing Pt-contents. The data obtained after heat-denaturation of the same samples show a growing capability to renaturation when the rb-values increase from 0 to 0.04; at 0.04 less than rb less than 0.18 the renaturation effect gradually disappears. In the competitive enzyme-linked immunosorbent assay (ELISA), the cis-DDP-adducts in heat-denatured DNA are detected in the pmol range; in DNA-digests, however, they are recognized in fmol amounts. For the individual Pt-containing (oligo)nucleotides the amounts causing 50% inhibition in the ELISA were established for the two anti-sera; they were 13.3 +/- 3.8 (fmol +/- S.D.) and 5.4 +/- 1.8 for cis-Pt(NH3)2d(GMP)2; 15.5 +/- 5.4 and 4.0 +/- 1.5 for cis-Pt(NH3)2d(pGpG); (2.6 +/- 1.1) X 10(3) and (2.0 +/- 1.0) X 10(3) for cis-Pt(NH3)2d(pApG); (5.6 +/- 1.9) X 10(3) and (2.9 +/- 0.4) X 10(3) for Pt(NH3)3dGMP. Pt-adducts in a trans-DDP-DNA digest are recognized in pmol amounts and dGMP in nmol quantitatives. Finally, the usefulness of these antibodies for the detection and quantitation of individual cis-DDP-adducts in cis-DDP-DNA digests was demonstrated.
Two interesting representatives of a new generation of platinum-based cytostatic drugs that are currently being tested in clinical trials are lobaplatin [1,2-diaminomethylcyclobutane platinum(II) lactate] and oxaliplatin [1,2-diaminocyclohexane platinum (II) oxalate]. Since little is known about the DNA adduct formation of these compounds, we studied their formation in DNA in vitro in calf thymus DNA and in cells. The major adducts formed in vitro were the Pt-GG and Pt-AG intrastrand crosslinks. The latter adducts could be detected using a recently developed 32P-postlabelling method. Using both this assay and atomic absorption spectroscopy, it was shown that there is a substantially higher rate of the in vitro adduct formation by cisplatin, compared with lobaplatin and oxaliplatin. Platinum concentrations required to obtain 90% cell kill during a 2 h incubation of A2780 cells were 15 microM for cisplatin and oxaliplatin and 22 microM for lobaplatin. Using an antiserum originally raised against cisplatin-treated DNA, we were also able to detect platinum-DNA adducts induced by lobaplatin and oxaliplatin. Maximal nuclear staining for all three compounds was observed after a 4 h post-incubation period. The nuclear staining level induced by cisplatin was about 10-fold higher than after lobaplatin and oxaliplatin treatment. GG and AG adducts, measured by 32P-postlabelling, also showed maximum levels at about 4 h after treatment. Relative GG peak levels were 4:1:3 for cisplatin, lobaplatin and oxaliplatin, respectively. The ratios of GG over AG intrastrand crosslinks in the A2780 cells were not significantly different for the various compounds. In conclusion, the 32P-postlabelling technique has been shown to be appropriate for adduct analysis, not only for the classical Pt compounds cisplatin and carboplatin but also for novel platinum compounds like lobaplatin and oxaliplatin. Results indicated large differences in reactivity of the latter compounds to DNA in vitro, compared with cisplatin. This difference was smaller in cells, suggesting enhancement of adduct formation by certain cellular mechanisms and/or compounds. From these studies, no conclusions can be drawn with respect to the cytotoxicity of the different Pt-GG and Pt-AG intrastrand crosslinks formed by these compounds.
Although human lung tumor-derived cell lines play an important role in the investigation of lung cancer biology and genetics, there is no comprehensive study comparing the genotypic and phenotypic properties of lung cancer cell lines with those of the individual tumors from which they were derived. We compared a variety of properties of 12 human non-small cell lung carcinoma (NSCLC) cell lines (cultured for a median period of 39 months; range, 12-69) and their corresponding archival tumor tissues. There was, in general, an excellent concordance between the lung tumor cell lines and their corresponding tumor tissues for morphology (100%), the presence of aneuploidy (100%), immunohistochemical expression of HER2/neu (100%) and p53 proteins (100%), loss of heterozygosity at 13 chromosomal regions analyzed (97%) using 37 microsatellite markers, microsatellite alterations (MAs, 75%), TP53 (67%), and K-ras (100%) gene mutations. In addition, there was 100% concordance for the parental allele lost in all 115 comparisons of allelic losses. Some discrepancies were found; more aneuploid subpopulations of cells were detected in the cell lines as well as higher incidences of TP53 mutations (4 of 10 mutations not found in the tumors) and microsatellite alterations (two cell lines with MAs not detected in the tumors). Similar loss of heterozygosity frequencies by chromosomal regions and mean fractional allelic loss index were detected between successfully cultured and 40 uncultured lung tumors (0.45 and 0.49, respectively), indicating that both groups were similar. Our findings indicate that the NSCLC cell lines in the large majority of instances retain the properties of their parental tumors for lengthy culture periods. NSCLC cell lines appear very representative of the lung cancer tumor from which they were derived and thus provide suitable model systems for biomedical studies of this important neoplasm.
To allow more sensitive, selective, and routine analyses of platinum(Pt)-GG and -AG intrastrand cross-links we have significantly improved our quantitative (32)P-postlabeling assay (M. J. P. Welters et al. Carcinogenesis 18, 1767-1774, 1997). Instead of off-line scintillation counting we introduced an on-line flow radioisotope detector into the HPLC system. Furthermore, the isolation protocol for the adducts was significantly modified and optimized to reduce interfering background peaks that prevented quantification of low levels of the cisplatin-DNA adducts in white blood cells obtained from patients. Reduction of background signals was obtained by boiling the samples, followed by phenol/chloroform/isoamylethanol extraction after the DNA digestion step. The labeling efficiency for the adducts was increased by 40% by using Na-formate instead of NH(4)-formate for elution of the adducts from the strong cation-exchange columns. Finally, a calibration curve and quality controls were implemented. The labeling efficiencies were not different between the dinucleotides. The between- and within-run precision for the Pt-GG and Pt-AG adducts measured at the lower limit of quantification of 87 and 53 amol/microg DNA, respectively, was less than 20% CV. The adducts were stable in DNA stored for a 2-month time period at -80 degrees C. The assay is now routinely used for high-precision analyses of patient and cell line samples containing very low adduct levels.
The detection and fragmentation behaviour of adducts of the chemotherapeutic cis-diamminedichloroplatinum(II) (cisplatin) with the dinucleosidemonophosphates d(ApG), d(GpG) and d(TpC) as model compounds for DNA adducts in an ion trap with electrospray ionization were studied. Mainly the monofunctional adduct, the bifunctional adduct and the bifunctional adduct with platinum bridging two dinucleosidemonophosphates were detected. In addition, several more complex adducts were seen resulting from reactions among these species. Adduct formation was low in the case of d(TpC). Fragmentation could be controlled strongly by varying the temperature of the transfer capillary; furthermore, tandem mass spectrometric (MS/MS) experiments on both the monofunctional and the bifunctional adducts were performed. For the adducts of d(ApG) and d(GpG) losses of NH(3) and HCl were the most dominant reactions, followed by the losses of one, then another two units of 98 amu from the sugar-phosphate backbone, whereas d(TpC)-Pt predominantly forms the dinucleosidemonophosphate. In the gas phase, the conversion of the monofunctional into the bifunctional adducts through binding to another site in the dinucleotide accompanied by loss of NH(3) or HCl could also be observed. The removal of a ligand from the coordination sphere of the square-planar platinum complexes appeared to be the crucial step for the induction of further fragmentation of the dinucleotide ligand. MS(n) experiments of the bifunctional adducts of d(ApG) and d(GpG) revealed different fragmentation pathways involving the loss of phosphoric acid, metaphosphoric acid, deoxyribose units (intact or dehydrated) and the nucleobases in different orders, leaving characteristic binding site-determining fragments. Fragmentation of these ions was also performed, mainly resulting in fragmentation of the bases. The study confirmed the remarkable stability of the platinum-guanine bond compared with other nucleobases.
The use of high performance liquid chromatography coupled with inductively coupled plasma mass spectrometry (HPLC-ICPMS) as means for the quantitative determination of ZD0473, a platinum anticancer drug, and its related biologically active "aqua" compounds in biofluid samples is described. The performance of the resulting HPLC-ICPMS method was compared with that of a conventional HPLC-triple quadrupole mass spectrometer-based (HPLC-MS/MS) system for properties such as limit of detection, linearity, and reproducibility using spiked samples. The methods were then applied to the determination of plasma ultrafitrate concentrations of ZD0473 in dog plasma samples obtained following intravenous and oral administration at 0.5 and 6 mg/kg, respectively. These experiments showed that both methods were capable of providing accurate and precise results but that the HPLC-ICPMS method had advantages of extended linear range and superior sensitivity, providing a limit of quantification of 0.1 ng/mL for ZD0473, as compared to 5 ng/mL using the current HPLC-MS/MS method. In addition, by using a single combined HPLC-ICPMS/MS/MS system, it was possible to determine the relative MS/MS response of the aqua compounds for the first time.
The two main cisplatin-induced DNA lesions, G--G and A--G, have been measured in cells exposed to the drug. (G--G and A--G denote the intrastrand bifunctional adducts formed between adjacent purine bases.) It has proven feasible, using liquid chromatography-tandem mass spectrometry (LC-MS/MS), observe the G--G and A--G lesions in mouse fibroblast cells exposed for 1 h to a 120 microM concentration of cisplatin. After extraction of the DNA from the cells, the lesions were enzymatically isolated from the DNA in the form of modified dinucleoside monophosphates with the phosphodiester bond intact. MS/MS detection of the modified dinucleoside monophosphates in the negative ion mode manifests two transitions; from the negative ion to the loss of one NH(3) group and from the ion less one NH(3) group to the loss of both NH(3) groups. The multiple reaction monitoring capability of LC-MS/MS was used to measure the three most abundant isotopes of the two main lesions for both transitions of each lesion (i.e., 12 MS/MS values in toto). Ion currents could be detected for all 12 pairs of MS/MS values in the DNA from exposed cells. Although this protocol results in some overlap of MS/MS values between the two lesions, a slight difference in elution times clearly distinguishes between them.
Numerous clinical or experimental studies have employed monoclonal antibody CP9/19 for quantification of cisplatin DNA adducts. The nature of adducts recognised by CP9/19 on polymeric DNA were defined using synthetic deoxynucleotides reacted with cisplatin. Total adduct levels were determined by atomic absorption spectrometry. The nature of adducts formed were confirmed by analysis of enzymatic hydrolysates using an established ion-exchange chromatography method combined with inductively coupled plasma mass spectrometry. Of the Pt bound to oligonucleotide A (TTTTTGGTTTTTGGTTTTTGGTTTTTGGTTTTT), 77% was recovered in a product consistent with the expected 1,2 intra-strand cross-link between GG. For oligonucleotide B (TTTTTAGTTTTTAGTTTTTAGTTTTTAGTTTTT), 62% of the bound Pt was recovered in a product consistent with the 1,2 intra-strand cross-link between AG. Of Pt bound to oligothymydylic acid, 65% was recovered in a product not previously described, small quantities of which were also formed on oligonucleotides A and B. The concentrations of adducts required to cause 50% reduction of signal in a competitive enzyme-linked immunosorbant assay (ELISA) (K-values) were determined. Adducts on sequences containing no guanine or only non-adjacent guanine residues, including sequences containing adenines adjacent to guanines, exhibited low or undetectable immunoreactivities (K-values = from 1 to >100 pmoles Pt per assay well). Adducts formed on oligodeoxynucleotides containing guanine doublets interspersed amongst thymine residues were the most immunoreactive (K-values: 2-7 fmoles adduct per assay well), comparable to adducts on calf-thymus DNA. The only cisplatin-DNA adducts recognised with high sensitivity by antibody CP9/19 were those involving adjacent guanine residues but immunorecognition of these was influenced by the surrounding DNA sequence.
The accidental discovery of the anticancer properties of cisplatin and its clinical introduction in the 1970s represent a major landmark in the history of successful anticancer drugs. Although carboplatin--a second-generation analogue that is safer but shows a similar spectrum of activity to cisplatin--was introduced in the 1980s, the pace of further improvements slowed for many years. However, in the past several years interest in platinum drugs has increased. Key developments include the elucidation of mechanisms of tumour resistance to these drugs, the introduction of new platinum-based agents (oxaliplatin, satraplatin and picoplatin), and clinical combination studies using platinum drugs with resistance modulators or new molecularly targeted drugs.
Cellular resistance, both intrinsic and acquired, poses a problem in the effectiveness of platinum-based chemotherapy. The cytotoxic activity of Pt-based chemotherapeutic agents is derived from their ability to react with cellular DNA. Oxaliplatin binds to the N7 position of the purine DNA bases, forming mainly intrastrand cross-links between either two adjacent guanines (GG), an adjacent adenine and guanine (AG), or two guanines separated by an unmodified nucleotide (GNG). We report the development of a liquid chromatography-electrospray ionization tandem mass spectrometry (LC-ESI-MS/MS) method for measuring GG and AG intrastrand cross-links formed by oxaliplatin. The limits of detection for GG-oxPt and AG-oxPt were 23 and 19 adducts per 10 (8) nucleotides, respectively. We compare the formation and persistence of intrastrand cross-links between wild-type and glutathione transferase P null mice (GSTP null) treated with oxaliplatin. No significant difference was observed in the level of intrastrand cross-links formed by oxaliplatin between the mouse strains in liver, kidney, and lung DNA. Adduct levels were greatest in liver and lowest in lung tissue.
Metal-based anticancer agents are frequently used in the treatment of a wide variety of cancer types. The monitoring of these anticancer agents in biological samples is important to understand their pharmacokinetics, pharmacodynamics, and metabolism. In addition, determination of metals originating from anticancer agents is relevant to assess occupational exposure of health care personnel working with these drugs. The high sensitivity of inductively coupled plasma mass spectrometry (ICP-MS) has resulted in an increased popularity of this technique for the analysis of metal-based anticancer drugs. In addition to the quantitative analysis of the metal of interest in a sample, ICP-MS can be used as an ultrasensitive metal selective detector in combination with speciation techniques such as liquid chromatography. In the current review we provide a systematic survey of publications describing the analysis of platinum- and ruthenium-containing anticancer agents using ICP-MS, focused on the determination of total metal concentrations and on the speciation of metal compounds in biological fluids, DNA- and protein-adducts, and environmental samples. We conclude that ICP-MS is a powerful tool for the quantitative analysis of metal-based anticancer agents from multiple sample sources.
We present a highly sensitive method for the determination of platinum (Pt) in DNA extracts of peripheral blood mononuclear cells (PBMCs) and tissue samples from patients treated with cisplatin. The method is based on the measurement of Pt by inductively coupled plasma mass spectrometry (ICP-MS) and allows quantification of Pt-DNA adducts in PBMCs isolated from 10 mL blood and 1 mg tissue. The lower limit of quantification is 0.75 pg Pt or 7.5 fg Pt μg(-1) DNA when using 100 μg DNA. The method proved to be accurate and precise. The results obtained using the ICP-MS method were in good agreement with results from the alternative (32)P-postlabelling assay. The ICP-MS method was, however, more sensitive and proved to be less laborious. The advantages of the presented ICP-MS technique were demonstrated by the analysis of PBMCs, normal gastric tissue, and gastric tumour tissue of patients treated with cisplatin.
How does cisplatin kill cells? In Platinum-Based Drugs in Cancer Therapy
- D Fink
- S B Howell
Fink, D., and Howell, S. B. (2000) How does cisplatin kill cells? In Platinum-Based Drugs in Cancer Therapy (Kelland, L. R., and Farrell, N. P., Eds.) Humana Press, Totowa, NJ.
Platinum analogues Eds.) pp 357-378, Lippincott-Raven Pub., Philadelphia. (22) Wistuba, I Comparison of features of human lung cancer cell lines and their corresponding tumours
- E Reed
- M Dabholkar
- B A I Chabner
- D Bryant
- C Behrens
- S Milchgrub
- A K Virmani
- R Ashfaq
- J D Minna
- A F Gazdar
Reed, E., Dabholkar, M., and Chabner, B. A. (1996) Platinum analogues. In Cancer Chemotherapy and Biotherapy, 2nd ed. (Chabner, B. A., and Longo, D. L., Eds.) pp 357-378, Lippincott-Raven Pub., Philadelphia. (22) Wistuba, I. I., Bryant, D., Behrens, C., Milchgrub, S., Virmani, A. K., Ashfaq, R., Minna, J. D., and Gazdar, A. F. (1999) Comparison of features of human lung cancer cell lines and their corresponding tumours. Clin. Cancer Res. 5, 991–1000.
Organo-metallics in Environment and Toxicology
- C F Harrington
- D S Vidler
- R O Jenkins
- A Sigel
- H Sigel
- R K Sigel
- I M Baskerville-Abraham
- G Boysen
- J M Troutman
- E Mutlu
- L Collins
- K E Krafft
- W Lin
- C King
- S G Chaney
- Swenberg
Harrington, C. F., Vidler, D. S., and Jenkins, R. O. (2010) Organo-metallics in Environment and Toxicology. In Metal Ions in Life Science (Sigel, A., Sigel, H., and Sigel, R. K. O., Eds.) Vol. 7, Royal Society of Chemistry, Cambridge, United Kingdom. (9) Baskerville-Abraham, I. M., Boysen, G., Troutman, J. M., Mutlu, E., Collins, L., de Krafft, K. E., Lin, W., King, C., Chaney, S. G., and Swenberg, J. A. (2009) Development of an ultraperformance liquid chromatography/mass spectrometry method to quantify cisplatin 1,2 intrastrand guanine-guanine adducts. Chem. Res. Toxicol. 22, 905– 912.
Adducts of the antitumour drug cis-diamminedichloroplatinum(II) with DNAsFormation, iden-tification and quantitation
- Fichtinger
- A J Schepman
- Van
- J L Veer
- J H J Hartog
- P H M Lohman
Fichtinger-Schepman, A. J., van der Veer, J. L., den Hartog, J. H. J., Lohman, P. H. M., and Reedijk. (1985) Adducts of the antitumour drug cis-diamminedichloroplatinum(II) with DNAsFormation, iden-tification and quantitation. Biochemistry 24, 707–713.