Morphological and molecular identification of all developmental stages of four whitefly species (Hemiptera: Aleyrodidae) commonly intercepted in quarantine

Abstract

Whiteflies are inadvertently, but commonly, transported in international plant trade. Rapid, accurate identification is the essential first step when such insects are intercepted by quarantine authorities. Whitefly taxonomy, and identification, is almost entirely based on the fourth-larval instar or puparium, but often only the eggs, early larval instars or adults are detected. Morphological descriptions of the egg, first three larval stages and adult are presented for four species commonly detected in trade, Bemisia afer (Priesner & Hosny), B. tabaci (Gennadius), Trialeurodes ricini (Misra) and Trialeurodes vaporariorum (Westwood). Morphological characters are provided that enable most life stage/species combinations in these four species to be distinguished. The structure of the antenna is a reliable and simple character for separating the four larval instars. Phenotypic plasticity, previously only reported in the puparial stage, also occurs in the second and third-larval instars. Where morphological separation of two species is sometimes inconclusive, or impossible, identification can be achieved using four real-time PCR assays, designed and validated to distinguish between the four species. The assays are generic in their set-up and can be multiplexed to form two reactions allowing discrimination of B. afer and B. tabaci in one well, and T. ricini and T. vaporariorum in another.

Full text

Accepted by L. Mound: 5 May 2009; published: 27 May 2009 1
ZOOTAXA
ISSN 1175-5326 (print edition)
ISSN 1175-5334 (online edition)
Copyright © 2009 · Magnolia Press
Zootaxa 2118: 1–29 (2009)
www.mapress.com/zootaxa/Article
Morphological and molecular identification of all developmental stages of four
whitefly species (Hemiptera: Aleyrodidae) commonly intercepted in quarantine
CHRISTOPHER MALUMPHY, KATHERINE WALSH, M. BELEN SUAREZ, DOMINIQUE W. COLLINS
& NIEL BOONHAM
Central Science Laboratory, Sand Hutton, York, YO41 1LZ, England. E-mail: c.malumphy@csl.gov.uk
Abstract
Whiteflies are inadvertently, but commonly, transported in international plant trade. Rapid, accurate identification is the
essential first step when such insects are intercepted by quarantine authorities. Whitefly taxonomy, and identification, is
almost entirely based on the fourth-larval instar or puparium, but often only the eggs, early larval instars or adults are
detected. Morphological descriptions of the egg, first three larval stages and adult are presented for four species
commonly detected in trade, Bemisia afer (Priesner & Hosny), B. tabaci (Gennadius), Trialeurodes ricini (Misra) and
Trialeurodes vaporariorum (Westwood). Morphological characters are provided that enable most life stage/species
combinations in these four species to be distinguished. The structure of the antenna is a reliable and simple character for
separating the four larval instars. Phenotypic plasticity, previously only reported in the puparial stage, also occurs in the
second and third-larval instars. Where morphological separation of two species is sometimes inconclusive, or
impossible, identification can be achieved using four real-time PCR assays, designed and validated to distinguish
between the four species. The assays are generic in their set-up and can be multiplexed to form two reactions allowing
discrimination of B. afer and B. tabaci in one well, and T. ricini and T. vaporariorum in another.
Keywords: Bemisia afer, B. tabaci, Trialeurodes ricini, T. vaporariorum, identification, adults, larval instars, real-time
PCR assay, dichotomous keys
Introduction
Whiteflies are plant sap-sucking insects placed in the family Aleyrodidae in the superfamily Aleyrodoidea
(Martin & Mound, 2007). Many species are important agricultural pests and a small number are vectors of
plant pathogenic viruses, most notably Bemisia tabaci (Gennadius), which is recorded transmitting 111 plant
viruses (Jones, 2003). Unfortunately for the agricultural and horticultural industries, the Aleyrodidae is one of
the most frequently transported arthropod families in international plant trade. This is partly because the eggs
and larval stages are small, sessile, firmly attached to the host plant for most of their development, often
inconspicuous, difficult to detect during phytosanitary inspections, and difficult to control. Bemisia tabaci is
listed in the plant health legislation of the European Union (European Plant Health Directive 2000/29/EC as
amended, Annex designations I/A1 and I/B) and is included in the A2 list of organisms of quarantine concern
for the European and Mediterranean Plant Protection Organisation. It therefore needs to be identified quickly
and accurately when encountered in order for National Plant Protection Organisations (NPPOs) to decide
upon the most appropriate course of action.
The two whitefly species most commonly found moving in trade are the cosmopolitan species B. tabaci
and Trialeurodes vaporariorum (Westwood). For both species, a congeneric species with which it might be
particularly confused is also being increasingly commonly intercepted, Bemisia afer (Priesner & Hosny) and
Trialeurodes ricini (Misra) respectively. Apart from occasional greenhouse infestations of B. tabaci and

MALUMPHY ET AL.2 · Zootaxa 2118 © 2009 Magnolia Press
interceptions of T. ricini on imported plant produce, both are absent from the United Kingdom (UK), whereas
B. afer and T. vaporariorum are established. Trialeurodes vaporariorum is very common and widespread on
indoor plantings and occurs outdoors during the summer, but although B. afer was recently found to be
naturalised in the UK (Malumphy, 2003) it is probably limited to sheltered urban situations. Trialeurodes
ricini occurs widely in the Oriental Region, Middle East, sub-Saharan Africa, Egypt and the Canary Islands; it
is difficult to control and is a serious pest of tomatoes in Egypt (Idriss et al., 1997). B. tabaci, T. vaporariorum
and T. ricini are all recorded as virus vectors, and B. afer has been implicated in virus transmission (Bock,
1994; Jones, 2003). Full details on host range and geographical distribution for these species are provided by
Evans (2007), Malumphy (2003), Martin et al. (2000) and Mound & Halsey (1978); details of the plant
pathogenic viruses that they transmit are provided by Jones (2003).
Bemisia tabaci is currently believed by most whitefly researchers to consist of a suite of highly cryptic
sibling species that cannot be distinguished morphologically. More than 41 distinct populations of B. tabaci
have been characterised using a variety of techniques, 24 of these populations have been given a specific
biotype designation (Perring, 2001). The ‘B biotype’ was described as a separate species, B. argentifolii
Bellows & Perring (Bellows et al., 1994), but this was subsequently synonymised with B. tabaci by De Barro
et al. (2005), who also proposed an infra-specific taxonomic framework based on molecular sequence data.
There is considerable molecular (Frohlich et al., 1999) and biochemical (Brown et al., 2000) data to support
the idea of a species complex. However, for the purposes of this study the name B. tabaci refers to all
described variants in the B. tabaci species complex.
Whitefly taxonomy and identification is almost entirely based on the fourth-larval instar, commonly
known as the puparium (Martin et al., 2000; Martin, 2003). As a result, the early larval instars of these four
species and the adult stage of B. afer and T. ricini have not previously been described adequately. Hill (1969)
described all developmental stages of B. tabaci and T. vaporariorum cultured on tobacco (Nicotiana tabacum
L.) in a laboratory in South Africa. This has been a standard reference used by NPPOs to separate these two
species of whitefly. But the study does not take into account larval phenotypic variation due to environmental
factors such as host plant species, leaf surface topography, population density, geographical origin, climate,
etc. Additionally, some of the characters presented by Hill to separate the adults and early larval instars of
these two species are unreliable. The larval descriptions are limited to the dorsal surface and do not include
important characters such as geminate pores/porettes and the smaller setae. The early instars of T. ricini have
been described by El-Khidir & Khalifa (1962), but the descriptions and illustrations are inadequate to make a
positive identification. The early larval instars of B. afer have not previously been described in detail. Adult B.
tabaci have been described by Bellows et al. (1994) under the name B. argentifolii Bellows & Perring and by
Gupta (1972) under the name B. gossypiperda Misra & Lamba. Adult T. vaporariorum have been described
by Gómez-Menor (1943) under the name T. vaporarium. Mellor & Anderson (1995) described the antennal
sensilla of B. tabaci and T. vaporariorum, and Riemann & Newman (1995) the dorsal abdominal disks on
male T. vaporariorum.
There have been numerous studies demonstrating the effect of leaf surface topography and population
density on the morphology of the puparium, but there has been no research on the effects on the morphology
of earlier larval instars. Neal & Bentz (1999) demonstrated that the development of dorsal structures such as
setae, tubercles and papillae in the puparial stage depends on the tactile experiences of the first instar. The first
instar is the only larval stage with well-developed legs, sensory setae and antennae. Bemisia afer, B. tabaci, T.
ricini and T. vaporariorum are among those species that exhibit the greatest puparial phenotypic plasticity
(Azab et al., 1969; Bethke et al., 1991; David & Ananthakrishnan, 1976; Harakly, 1973; Mohanty & Basu,
1986; Mound, 1963, 1965; Rossell et al., 1997 and Russell, 1948). These species are also biologically plastic,
polyphagous, widely distributed geographically, successful colonisers and economically important plant
pests.
Because the earliest life stages are the least visible to the exporting authorities, it is not uncommon for
only eggs and early larval instars to be detected by the NPPO of the importing country. With an increasing
number of whitefly species being detected moving in trade, and with B. afer and T. ricini, in particular, being

Zootaxa 2118 © 2009 Magnolia Press · 3
IDENTIFICATION OF WHITEFLY PESTS
detected more frequently, the need to rapidly confirm the identity of B. tabaci (in order to initiate eradication
action) or T. vaporariorum at all life stages has become ever more important. Monitoring of outbreak sites
often utilises sticky traps to catch the adults and there is also a need to separate these species at this life stage.
The aim of this study was to facilitate the identification of all four species, at all developmental stages, in the
plant health quarantine diagnostic laboratories of NPPOs.
A dual morphological/molecular approach was adopted. Molecular assays offer tools that might be used
to help alleviate any limitations in morphological analysis. Such assays may potentially be used by non-
specialists, but may also be used to complement morphological examination of insects in specialist diagnostic
laboratories. A plant health quarantine diagnostic laboratory requires robust and rapid assays. Real-time PCR
assays combine PCR amplification of a DNA target with fluorescent detection of the amplified product,
monitored in real-time, in a single instrument. These PCR assays have a closed tube format that negates the
need for post PCR manipulations, for example running agarose gels, resulting in shortened assay times and
significantly reducing the risk of post-PCR contamination. Real-time PCR assays have been used for the
detection of a very wide range of targets and more recently for the identification of quarantine plant pests
including Bactrocera latifrons (Diptera: Tephritidae) designed to the COI sequence (Yu et al., 2004) and
Thrips palmi (Thysanoptera: Thripidae) designed to a SCAR marker (Walsh et al., 2005).
Conserved polymorphisms between closely related species may be very limited; it is therefore important
to fully utilise these differences in order to design a species-specific PCR assay. The effect of mismatches
between a primer and template is dependent on the number, position and nature of the mismatches and the
length of the primer (Christopherson et al., 1997). For greatest specificity, conserved mismatches should be
positioned in the last 8 base pairs at the 3′ end of a primer (Kwok et al., 1990; Zhu & Marshall, 1996).
In this study, real-time PCR assays were designed to the mitochondrial Cytochrome Oxidase I (COI)
genes of B. tabaci, B. afer, T. ricini and T. vaporariorum. The utility of the mitochondrial COI gene to confer
a species designation has been well documented across a broad range of animals and insects (Hebert et al.,
2003; Armstrong & Ball, 2005).
Materials, methods and terminology
Insects
Study material was collected by the Plant Health and Seeds Inspectorate (PHSI) of the Department for
Environment, Food and Rural Affairs (Defra) on imported plant material during phytosanitary inspections in
England and Wales, and by field collecting in Mauritius, Spain (Canary Islands), Tunisia and the UK. Material
was also obtained from Dr M. N. Maruthi of the Natural Resources Institute, UK, and from cultures reared at
CSL under licence.
Specimens were examined under Leitz Diaplan and Zeiss Universal Compound Research microscopes
with phase and interference contrast using magnifications up to ×1250. Eggs and early-larval instars were
mounted directly into Heinz Mountant (Heinze, 1952), puparia were mounted in Canada balsam following the
protocol of Martin (1999). Adults were fixed for five minutes in 70% ethanol at 70ºC, macerated for 20
minutes in 10% potassium hydroxide at 70ºC, transferred to cold 70% ethanol for 10 minutes and then
mounted in Heinz mountant. All larval and puparial specimens were mounted with the dorsal surface
uppermost; adults were mounted laterally with the wings and legs pulled away from the body. All
measurements taken for the morphological descriptions were made in microns and are presented as a mean
figure followed by the range in parentheses. Illustrations were made using a camera lucida mounted onto the
Zeiss microscope, and, where appropriate, follow convention with the dorsal surface of the larvae drawn on
the left-hand side and the ventral surface on the right-hand side (Figs 1–4). The terminology used here,
generally follows Gill (1990), Martin (1999) and Martin et al. (2000); the morphological characters of the
larval stages are illustrated in Figs 1–4. The following abbreviations for the chaetotaxy are used: AMS =
anterior marginal seta; ASS = anterior submarginal seta; CS = caudal seta; CeS = cephalic seta; MS14 =

MALUMPHY ET AL.4 · Zootaxa 2118 © 2009 Magnolia Press
fourteenth marginal seta; PMS = posterior marginal seta; 1AS = first abdominal seta length; 8AS = eighth
abdominal seta.
FIGURES 1–2. General morphology of a whitefly. 1, first-larval instar; 2, second-larval instar.
FIGURES 3–4. General morphology of a whitefly. 3, third-larval instar; 4, fourth-larval instar (puparium).

Zootaxa 2118 © 2009 Magnolia Press · 5
IDENTIFICATION OF WHITEFLY PESTS
All four species were cultured through several generations in the laboratory: B. afer on Manihot
esculenta: B. tabaci and T. vaporariorum on Euphorbia pulcherrima: and T. ricini on Phaseolus vulgaris
(from a population collected on Ricinus communis). For each species, segregates putatively corresponding to
the different instars were collected on the basis of size difference and these were examined for corresponding
differences in morphological characters that could provide the basis for consistent identification of larval
instar. Adults were also collected representing each species from the cultures. The species identity of early-
larval instars collected from imported plant material was confirmed by their association with puparia on the
same leaf; larvae were not used if there was any suggestion of multiple species presence. Identifications were
made using previously validated reference material, and diagnostic keys and morphological descriptions
provided by Martin (1987) and Martin et al. (2000). All examined slide-mounted specimens have been
deposited in the reference collection at CSL.
Whitefly specimens used in the development of the real-time PCR assays were obtained from a number of
different geographical sources (Table 1). Where possible, a minimum of three individuals per population was
evaluated. Specimens were stored in 70% ethanol at –20 ºC before DNA extraction and TaqMan analysis.
TABLE 1. List of whitefly populations tested for amplification with specific primers and TaqMan probes.
Notes:
a from mixed population of B. tabaci and B.afer
DNA extraction, amplification and sequencing
Each DNA extraction was carried out from a single insect according to the Chelex 100 (BioRad) method
described by Walsh et. al. (1991). An electric mixer was used for homogenisation of the starting material in
50μl of nuclease free water. The resulting DNA was stored at -20°C until use. DNA was amplified from the
mitochondrial Cytochrome Oxidase I using Bio-X-Act Long DNA Polymerase (Bioline) as follows: to 1μl of
Code Genus and species Host plants Geographic origin
BTQ B. tabaci Unknown Unknown
8495 B. tabaci Euphorbia pulcherrima Netherlands
8720 B. tabaci Solidago sp.Israel
8722 B. tabaci Solidago sp.Zimbabwe
8766 B. tabaci Bacopa carolinia Singapore
8871 B. tabaci Helichrysum bracteatum Spain
8946 B. tabaci ?Eustralis stellata Singapore
9382 B. tabaci Manihot sp.Gambia
BTTUNA B. tabaci Lycopersicum esculentum Tunisia
9094 B. tabaci Euphorbia pulcherrima ?Portugal,
6607 B. tabaci Coprosoma repens Morocco
5088 B. afer Manihot esculenta Sierra Leone
BANRI B. afer Manihot esculenta Cultured at NRI, Ex Uganda
5088A Bemisia sp.aManihot esculenta Sierra Leone
TRCID T. ricini Ricinus communis Gran Canaria, Spain
TRegy T. ricini Ricinus communis Egypt
14148 T. ricini Unknown leaves Gambia
20400432 T. ricini Unknown leaves Nigeria
8722B T. vaporariorum Solidago sp.Zimbabwe
TVBLB T. vaporariorum Primula sp.UK
1690A T. vaporariorum Gerbera jamesonii Netherlands
TVCIZ T. vaporariorum Lycopersicum esculentum Gran Canaria, Spain

MALUMPHY ET AL.6 · Zootaxa 2118 © 2009 Magnolia Press
DNA extract was added 5μl 10x Optibuffer (provided with polymerase), 2.5mM MgCl2, 0.2mM dCTP, dATP,
dGTP, and dTTP, 0.2mM forward and reverse primers (Set3f 5′ TTGATTTTTTGGTCATCCAGAAGT and
Set3r 5′ TCCAATGCACTAATCTGCCATATTA (Frohlich et al., 1999)), 2 units Bio-X-Act DNA polymerase
and nuclease free water to 50μl. Cycling conditions were 94°C for 5 min followed by 40 cycles of 1 min at
94°C, 1 min at 50°C and 1 min at 72°C, and a final extension phase of 72°C for 5 minutes. Products were
visualised by gel electrophoresis and purified from unincorporated primers using Wizard
®
SV Gel and PCR
Clean-Up System (Promega) following manufacturers instructions. Products were sequenced (Sequiserve,
Vaterstetten, Germany) using the amplification primers.
TaqMan primers and probes design
Partial sequences of the mitochondrial cytochrome oxidase I gene from B. tabaci (BTQ, 8495, 8722), B.
afer (BANRI), T. ricini (TRCIG, 3576), T. vaporariorum (8722B, TVBLA, 1690A), and sequences from
GeneBank, were aligned using the CLUSTAL method (Higgins and Sharp, 1988) (Fig. 48). Conserved
polymorphisms between species were utilised, and in order to confer greatest specificity, where possible,
primers were positioned with the majority of mismatches at the 3′ end. Assays were designed using Primer
Express
™
2.0 (Applied Biosystems, Foster City, California). Polymorphisms in the T. vaporariorum
sequences meant that two forward primers were required in order to detect all populations. Details of all
primers and probes are given in Table 2.
TABLE 2. Characteristics of primers and TaqMan probes used to identify whitefly species.
Notes:
a F: forward; R: reverse; P: probe.
b Position of primers referred to the sequence of the mitochondrial gene encoding cytochrome oxidase subunit 1 of B.
tabaci (accession number: AJ517768).
Real-time PCR assay
Real-time PCR reactions were set up in 96-well reaction plates using the TaqMan PCR core reagent kit
(Applied Biosystems) following manufacturers protocols. For each reaction, 1l of DNA extract was added,
giving a final volume of 25 μl. The primer concentration for each whitefly species was optimised separately.
The optimal primer concentrations were 300nM for all forward and reverse primers. Final probe
concentrations were 0.1 mM for B. tabaci, T. ricini and T. vaporariourm, and 0.2 mM for B. afer. Reactions
were carried out in duplicate on an ABI Prism 7700 Sequence Detection System (PE-Biosystems) with the
following cycling conditions: 95°C for 10 min, followed by 35 cycles of 60°C for 1 min, 95°C for 15 s, using
Species Primer and probea name Sequence (5’-3’) Location on DNAb
B. tabaci BT-F YTRGGGTTTATTGTTTGRGGWCAYCAT 119–145
BT-R TRGCTGAAGTRAAATAAGCTCGA 197–175
BT-P (VIC-labelled) TATTYACWGTTGGWATAGATG 147–167
B. afer BA-F TTTCTATTCACCATRGGAGGTCTTACC 311–337
BA-R RTAAGTATCATGAAGACARACATCAACG 388–361
BA-P (FAM-labelled) GGATCATYTTGGGYAATT 339–356
T. ri cini TR-F TGCTACTTTRGGTGGATCTTGAA 243–266
TR-R TAAAGAGAAAAAGAAACCCCAAAATT 320–295
TR-P (FAM-labelled) TTTATATTGAGACCTTTATTTCT 269–291
T. vaporariorum TV-FA GCGCGCGTTTGTCATTTA 259–278
TV-FB GGGGGCGCTTGTCATTTA 259–278
TV-R CCACAGAAGAATTACCCAAAATCA 365–342
TV-P (VIC-labelled) CCCTWACTTCTTGGTTTACT 282–300

Zootaxa 2118 © 2009 Magnolia Press · 7
IDENTIFICATION OF WHITEFLY PESTS
real time data collection. The B. tabaci primers and probes were multiplexed with the B. afer assay, and T.
ricini with the T. vaporariorum assay. Primer concentrations were limited for use in multiplex reactions in
order to prevent competition between the assays. Multiplex primer concentrations for testing were: 100 mM
for BT-F, BT-R, BA-F and BT-R; 50 mM for TR-F and TR-R; and 30mM for TV-FA, TV-FB and TV-R. Probe
concentrations were not altered.
Results
Determination of larval instar
For all four species, initial segregation of larval material, based on size, into putative instars was confirmed by
morphological examination. All four larval instars were clearly distinguishable using a very small number of
characters, primarily the shape of the antennae. The first instar (Fig. 1) possesses functional legs, long
antennae and well-developed marginal and caudal setae; the second instar (Fig. 2) is slightly larger with only
three pairs of marginal setae, non-functional legs and short, straight antennae; the third instar (Fig. 3) is larger
again, with the antennae strongly curved to form a ‘U’ shape, broad at the base and apically narrow, and not
overlapping with the front legs; the antennae of the fourth instar (Fig. 4) are straight or gently curved, uniform
in width and overlap with the front legs.
Morphological descriptions of the eggs, larvae and adults
Bemisia afer (Priesner & Hosny)
(Figs 5–14)
B. afer was originally described by Priesner & Hosny (1934) in the genus Dialeurodoides, from specimens
collected on sycamore fig (Ficus sycamorus) and Lawsonia alba in Egypt. It is broadly polyphagous, feeding
on host plants belonging to 46 genera in 22 families (Martin, 1999; Mound & Halsey, 1978). It occurs widely
in the warmer parts of the world and has recently established in the UK (Malumphy, 2003). It is a serious
whitefly pest of field crops in sub-Saharan Africa and China and is implicated in plant-pathogenic virus
transmission.
Specimens measured
GAMBIA: (intercepted in UK), on Manihot esculenta, 7.iii.2001, PHSI, CSL2011121 (3 first, 7 second, 3
third instars and 3 adult females). ITALY: (intercepted in UK) on Laurus nobilis, 17.v.2002, PHSI,
CSL2022987 (1 third instar); (intercepted in UK, plants imported via Belgium), on L. nobilis, 15.x.1999,
PHSI, CSL996362 (7 eggs, 8 first, 1 second and 8 third instars), 15.xi.1999, PHSI, CSL997270 (2 adult
females), 21.i.2000, PHSI, CSL2000326 (9 third instars), 21.iv.2000, PHSI, CSL2003927 (4 adult males and 1
adult female); (intercepted in UK, plants imported via Belgium, cultured at CSL under licence), on L. nobilis,
23.i.2001, CSL2010267 (2 third instars), 28.v.2001 (6 first and 1 second instar), 4.vii.2001 (2 first, 3 second
and 2 third instars), 2001 (2 eggs, 1 second instar, 1 adult male and 2 female adults). UGANDA: Entebbe
(cultured at the Natural Resources Institute (NRI) and CSL under licence), on M. esculenta, 13.xii.2002 (7
first, 2 second and 4 third instars). UNITED KINGDOM: London, Chelsea Physic Gardens, on L. nobilis,
27.vii.2000, PHSI, CSL2004878 (7 eggs, 7 instar and 2 second instars).
OVUM (Fig. 5)
Habitus. Elliptical, broadly rounded at the base and narrow apically. Cream coloured when first laid,
becoming pale yellow and finally golden brown. Red eyes of the first instar clearly visible prior to hatching.

MALUMPHY ET AL.8 · Zootaxa 2118 © 2009 Magnolia Press
Oviposition pattern varies considerably. Eggs are most commonly scattered, or in small groups of up to five,
on the lower surface of the foliage. On smooth leaves, for example L. nobilis, they may be laid in irregular
rows, partial circles or complete circles of approximately 20 eggs. The chorion is smooth and shiny with little
wax evident. Each egg is erect and firmly attached to the leaf surface by a slender peduncle extending from
the base of the egg, inserted into the plant tissue. The egg bends slightly as it matures. After hatching, the egg
remains upright and is a distinctive golden brown colour. Hatched eggs can remain attached to the plant for
many months. Length 220 microns (196–248 microns), width 131 microns (108–150 microns), 1.68
(1.55–1.93) times longer than wide. Peduncle length 24 microns and width is 12 microns (10–12 microns).
FIGURES 5–9. Bemisia afer. 5, ovum on Laurus nobilis from Italy; 6, first instar on L. nobilis from Italy; 7, second
instar on L. nobilis from Italy; 8, third instar on L. nobilis from Italy; 9, fourth instar on Manihot esculenta from
Mauritius.

Zootaxa 2118 © 2009 Magnolia Press · 9
IDENTIFICATION OF WHITEFLY PESTS
FIRST-INSTAR LARVA (Fig. 6)
Habitus. Scale-like, pale translucent yellow, becoming slightly darker as they mature. Reddish eye spots
and two yellow abdominal mycetomes clearly visible. A narrow band of white wax is present around the
margin. The majority of larvae settle to feed within one cm from their eggs.
Margin. Outline ovoid, lozenge-shaped; length 288 microns (204–317 microns) and width 188 microns
(134–212 microns), 1.53 (1.26–1.75) times longer than wide. With 16 pairs of well-developed setae: MS14
pair length 60 microns (38–76 microns); CS length 58 microns (30–72 microns); ratio CS/MS14 = 0.97
(0.71–1.07).
Dorsum. Some slide-mounted specimens are a pale grey in colour. Chaetotaxy comprises paired ASS
length 16 microns (9–22 microns); CeS length 3 microns (1–7 microns); 1AS length 3 microns (1–5 microns);
and 8AS length 2 microns (1–5 microns). Cephalic tubercles usually weakly developed, oval to sub-
rectangular. Vasiform orifice almost quadrate and closed behind, length 30 microns (22–33 microns). Lingula
head spinulose with one or two pairs of stout setae, half-covered by the operculum. Operculum and lingula
pigmented light brown in some specimens.
Ven te r. Legs well developed. Fore coxae with short spine, mid and hind coxae with long setae and short
spines. Tibia-tarsi distinctly spinose. Antennae long and slender, length 76 microns (63–85 microns).
Abdominal setae placed mid vasiform orifice. Cuticle fine, diaphanous.
SECOND-INSTAR LARVA (Fig. 7)
Habitus. Distribution similar to first instars. Scale-like, similar in appearance to first instar but larger and
more transparent.
Margin. Outline ovoid, widest across mesothoracic legs; length 385 microns (328–418 microns), width
274 microns (224–296 microns), 1.41 (1.34–1.48) times longer than wide. AMS pair fine, acute, length 9
microns (3–16 microns); PMS fine, acute, length 15 microns (10–25 microns); CS stout, length 50 microns
(44–72 microns). Ratio CS/PMS = 3.49 (1.92–4.91). Margin evenly, faintly crenulate; slightly indented at
thoracic opening and crenulations may be slightly more conspicuous.
Dorsum. Chaetotaxy comprises paired CeS, length 16 microns (2–60 microns); 1AS, 18 microns (2–62
microns); and 8AS, 8 microns (3–25 microns). The dorsal setae exist in two distinct states: minute (2–8
microns) or well developed (20–62 microns). The setal pairs most frequently well-developed are CeS and
1AS, and to a lesser extent 8AS. There are approximately 13 pairs of geminate pore/porettes aligned sub-
dorsally in two longitudinal rows. Abdominal segmentation rather faintly marked, medially and sub-medially.
Abdominal segment VII reduced medially, pockets marked. Vasiform orifice rectangular or almost triangular,
sides concave, closed behind, length 41 microns (36–44 microns); inset from posterior margin by less than its
own length, half occupied by the operculum with most of the lingula head visible. Lingula head spinulose
with pair of stout setae. Operculum and lingula may be pigmented light brown.
Ven te r. Legs roughly triangular, each with a subcircular apical pad. Antennae small and slender, laterad,
length 25 microns (20–28 microns). Abdominal setae placed mid-vasiform orifice. Cuticle fine, diaphanous.
THIRD-INSTAR LARVA (Fig. 8)
Habitus. Distribution similar to first and second instars. Ovoid, variable in colour from translucent to
yellow and occasionally with four longitudinal dark patches.
Margin. Body elongate-oval, length 618 microns (540–732 microns), width 458 microns (380–552
microns), 1.36 (1.18–1.54) times longer than wide, generally widest across the meso-coxae. Three pairs of
acute, marginal setae: AMS pair fine, length 12 microns (6–24 microns); PMS pair fine, length 18 microns
(10–30 microns); CS pair stout, length 74 microns (64–90 microns); ratio CS/PMS = 4.25 (3.00–6.67).
Margin fine to very finely crenate. Tracheal pore area indented slightly and crenulations often more
pronounced.
Dorsum. Chaetotaxy comprises paired CeS, length 5 microns (3–10 microns); 1AS, length 5 microns
(3–10 microns); and 8AS, length 5 microns (3–8 microns). 8AS usually occurs on the lateral margin of the

MALUMPHY ET AL.10 · Zootaxa 2118 © 2009 Magnolia Press
FIGURES 10–17. Bemisia spp. 10, B. afer, diagrammatic representation of left compound eye of adult female; B. afer,
11, upper and lower compound eyes linked by one ommatidium; B. afer, 12, female antenna; B. afer, 13, aedeagus; B.
afer, 14, female cement gland; 15, B. tabaci, ovum on Euphorbia pulcherrima; 16, B. tabaci, first larval instar on
Solidago from Spain; 17, B. tabaci, second instar on E. pulcherrima.

Zootaxa 2118 © 2009 Magnolia Press · 11
IDENTIFICATION OF WHITEFLY PESTS
vasiform orifice but may be displaced antero-laterad. Minute setae may be present around the sub-marginal,
but they are very difficult to detect. Geminate pore/porettes are aligned in three or four longitudinal groups.
The dorsum may be smooth, without papillae or projections other than setae, or have pronounced longitudinal
mid-dorsal and sub-dorsal rows of tubercles. The vasiform orifice is triangular or occasionally quadrate,
longitudinal sides concave, half covered by the operculum, open behind and inset from margin by
approximately its own length; length 59 microns (52–68 microns). The lingula is spatulate with two pairs of
enlarged setae, the distal portion is spiculate, and it is half-covered by the operculum. Operculum and lingula
may be pigmented light brown.
Ven te r. Cuticle diaphanous and smooth. Derm of thoracic tracheal folds usually with numerous, minute
spinules. Middle and hind coxae each with a fine, hair-like seta, and an adjacent minute spine-like seta.
Antennae length 17 microns (14–20 microns).
FOURTH-INSTAR LARVA (Fig. 9)
Described and illustrated by Bink-Moenen & Gerling (1992), Mound (1965), Martin (1987, 1999) and
Martin et al. (2000).
ADULT (Figs 10–14)
Body yellow, wings hyaline, covered with sparse, powdery wax. Antennae 7-segmented. Antennal
segment II about half as long as antennal segment III; antennal segment III about as long as segments IV–VII
combined; segments V–VII subequal, segment IV shorter. Segment II with long, slender, conical sensorium
(difficult to distinguish from the enlarged setae). Segment III with one sensorium located on the proximal
portion, and three sensoria (a cone and two rhinarial-types) on the distal portion. The cone is approximately a
quarter to a third the segment length away from the apex. Segment IV without a sensorium; segment V with
an distal rhinarial-type sensorium; segment VI with a subapical sensorial cone, and segment VII with both a
sensorial cone and an adjacent rhinarial sensorium, arising near the middle of the segment and the segment
terminating in a narrow conical sensorium. Upper eye composed of about 40–47 ommatidia, each 8.8
(8.0–9.6) microns in diameter; lower compound eye composed of about 32 ommatidia, each 10.9 (9.8–12.3)
microns in diameter, arranged in interconnected groups of 6 pigmented ommatidia surrounding a clear,
smaller ommatidium. Upper and lower eyes connected by a single clear ommatidium. Metatibial combs
consisting of 16–17 setae, all tibial brushes consisting of two or three adjacent setae. Male claspers paired,
with about 10–11 long setae. Aedeagus ventral base smooth; distal portion straight, almost parallel sided with
little or no curve upwards, blunt ended, sometimes terminating with a small fine tip. Male collar and female
gonapophysis and supragenital plate unpigmented. Female cement gland is sinuous, without bands and with a
small head.
Bemisia tabaci (Gennadius)
(Figs 15–24)
B. tabaci was originally described by Gennadius (1889) in the genus Aleurodes, as a pest of tobacco in
Greece. It has numerous synonyms that are listed by Mound & Halsey (1978) and Martin & Mound (2007). It
is broadly polyphagous, feeding on an estimated 600 plant species and is distributed nearly worldwide. It is a
major pest of field and protected agricultural crops and ornamental plants. It is a vector of 111 plant viruses in
the genera Begomovirus, Crinivirus and Carlavirus or Ipomovirus (Jones, 2003).
Specimens measured
CANARY ISLANDS: (intercepted in UK), on Rosa sp., 7.vi.2001, PHSI, CSL20012644 (8 second
instars). DENMARK: (intercepted in UK), on Gerbera sp., 1.vi.2001, PHSI, 20012495 (2 adult males and 3
adult females). ISRAEL: (intercepted in UK), on Mentha sp., 10.x.2000, PHSI, CSL2007131 (2 male and 2

MALUMPHY ET AL.12 · Zootaxa 2118 © 2009 Magnolia Press
female adults), 6.x.2001, PHSI, CSL2015207 (4 first, 2 second and 1 third instar); on Solidago sp.,
18.viii.2000, PHSI, CSL2005312 (3 adult females); on Thymus sp., 15.xi.2001, PHSI, CSL2015882 (1 adult
female). ITALY: (intercepted in UK), on Euphorbia pulcherrima, 14.vi.2001, PHSI, CSL2012838 (7 first
instars, 3 third instars). PORTUGAL: (intercepted in UK), on E. pulcherrima, 19.viii.2003, PHSI,
CSL20309094 (9 eggs). NIGERIA: (intercepted in UK), on Telfaria sp., 26.ii.2002, PHSI, CSL2020953 (4
first, 3 second and 3 third instars). SINGAPORE: (intercepted in UK), on Piper sarmentosum, 11.vi.2003,
PHSI, CSL20305417 (1 third instar). TUNISIA: Tozeur, on Lantana sp., 7.v.2003, C. Malumphy. Cultured at
CSL under licence, on Phaseolus vulgaris, 15.viii.2003, KV85BT14-KV85BT18 (19 eggs, 10 first, 5 second
and 15 third instars). ORIGIN UNKNOWN: from Rothamsted Research, UK, cultured at CSL under licence,
on E. pulcherrima, 2000, KV85BT1 (10 eggs).
OVUM (Fig. 15)
Habitus. Elliptical, broadly rounded at the base and narrow apically. Cream coloured when first laid,
becoming pale yellow and finally golden brown. Red eyes and yellow fat bodies of the first instar clearly
visible prior to hatching. Oviposition pattern varies with leaf topography and population density. Eggs are
scattered, or in small groups, on the under surface of hirsute foliage, such as Euphorbia pulcherrima, or laid in
neat, partial or complete circles on glabrous, smooth foliage, such as Ficus benjamina. The chorion is smooth
and shiny with little wax evident. Each egg is erect and firmly attached to the leaf surface by a slender
peduncle extending from the base of the egg, inserted into the plant tissue. The egg bends slightly as it
matures and a longitudinal groove appears on the concave surface. After hatching, the egg remains upright
and is golden brown in colour. Hatched eggs can remain attached to the plant for many months. Length 201
microns (172–220 microns), width 119 microns (96–156 microns), ratio of length over width is 1.71
(1.31–2.19). Peduncle length 34 microns (28–42 microns) and width is 8 microns (5–12 microns).
FIRST-INSTAR LARVA (Fig. 16)
Habitus. Scale-like, pale translucent yellow, becoming darker as they mature. Reddish eye spots and two
yellow abdominal mycetomes clearly visible. A narrow band of white powdery wax develops around the
margin. They usually settle to feed within 10 mm from their egg.
Margin. Outline ovoid, lozenge-shaped; length 263 microns (228–280 microns) and width 162 microns
(123–194 microns), 1.63 (1.51–2.10) times longer than wide. With 16 pairs of well-developed marginal setae:
MS14 length 42 microns (34–54 microns); CS length 94 microns (84–123 microns). Ratio CS/MS14 = 2.23
(1.84–2.70).
Dorsum. Chaetotaxy comprises paired ASS length 20 microns (16–28 microns); CeS length 3 microns
(2–5 microns); 1AS length 3 microns (2–4 microns); and 8AS length 3 microns (2–4 microns). The latter are
often displaced antero-laterally from the anterior corners of the vasiform orifice. Cephalic tubercles weakly
developed, oval to sub-rectangular. Vasiform orifice almost quadrate and open posteriorly, length 26 microns
(19–30 microns). Lingula head half-covered by the operculum.
Ven te r. Legs well developed. Short spines adjacent to all coxae and mid and hind coxae with long setae.
Antennae long and slender, length 70 microns (58–81 microns). Abdominal setae placed mid vasiform orifice.
Cuticle fine, diaphanous.
SECOND-INSTAR LARVA (Fig. 17)
Habitus. Distribution similar to first instars. Scale-like, similar in appearance to first instar but larger and
more transparent.
Margin. Body ovoid, outline occasionally indented by plant hairs when developing on hirsute leaves;
length 346 microns (306–388 microns) and width 219 microns (180–272 microns), 1.59 (1.43–1.79) times
longer than wide, generally widest across the mesocoxae or just posteriorly. With three pairs of setae: ASS
length 4 microns (2–6), often minute, submarginal and very difficult to detect; PMS 13 microns (8–18
microns); CS length 75 microns (62–88 microns). Ratio CS/PMS = 6.23 (4.44–10.25). Margin generally
smooth or finely crenate, indented slightly at tracheal pore area.

Zootaxa 2118 © 2009 Magnolia Press · 13
IDENTIFICATION OF WHITEFLY PESTS
FIGURES 18–24. B. tabaci. 18, third instar on E. pulcherrima; 19, fourth instar on E. pulcherrima; 20, diagrammatic
representation of left compound eye of adult female; 21, upper and lower compound eyes linked by one ommatidium; 22,
female antenna; 23, aedeagus; 24, female cement gland.

MALUMPHY ET AL.14 · Zootaxa 2118 © 2009 Magnolia Press
Dorsum. Chaetotaxy comprises paired CeS length 37 microns (3–90 microns); 1AS length 36 microns
(3–108 microns); and 8AS length 9 microns (3–40 microns). The dorsal setae exist in two distinct states:
minute (2–10 microns) or well developed (28–108 microns). The setal pairs most frequently well-developed
are CeS and 1AS, and to a lesser extent 8AS. Frequently only one or two of the setal pairs well developed,
these sometimes asymmetrical with one seta well developed and the opposite seta minute. Approximately
eight geminate pore/porettes are aligned sub-dorsally in a longitudinal row. The vasiform orifice is sub oval to
rectangular and closed behind; length 36 microns (22–340 microns). Lingula head half-covered by the
operculum.
Ven te r. Cuticle diaphanous and smooth. Derm of thoracic tracheal folds usually with numerous, minute
spinules. Coxae each with an adjacent minute spine-like seta; mid and hind coxae each with a long fine seta.
Antennae length 19 microns (16–24 microns). Cuticle fine, diaphanous.
THIRD-INSTAR LARVA (Fig. 18)
Habitus. Distribution similar to first and second instars. Ovoid, variable in colour from translucent to deep
yellow.
Margin. Body elongate-oval, outline often indented by plant hairs when developing on hirsute leaves;
length 477 microns (404–568 microns), width 329 microns (268–388 microns), 1.45 times longer than wide
(1.29–1.54), generally widest across the mesocoxae. Three pairs of marginal setae: AMS pair fine, length 5
microns (2–8 microns); PMS pair fine, 13 microns (6–22 microns); CS pair stout, 93 microns (70–116
microns); ratio CS/PMS = 7.68 (4.60–17.33). Margin generally smooth or finely crenulate, indented slightly
at tracheal pore area.
Dorsum. Chaetotaxy comprises paired CeS length 72 microns (5–120 microns); 1AS length 81 microns
(8–142 microns); and 8AS length 15 microns (2–72 microns). The dorsal setae exist in two distinct states:
minute (2–14 microns) or well developed (52–142 microns). The dorsal setae pairs most frequently well-
developed are the CeS, 1AS and 8AS. 8AS usually occur on the lateral margin of the vasiform orifice but may
be displaced antero-laterad, especially when well developed. There may be three other pairs of minute to
small subdorsal setae, which vary enormously in their development, and asymmetrical individuals are
common. There are also usually four pairs of anterior submarginal setae and five pairs of posterior
submarginal setae. The submarginal setae are minute and often very difficult to detect (phase or interference
contrast microscopy is required). Geminate pore/porettes are aligned in four longitudinal groups and are also
difficult to detect in some specimens. The dorsum is generally smooth, without papillae of projections other
than setae. The vasiform orifice is triangular, half-covered by the operculum, and open behind; length 51
microns (40–60 microns). The lingula is spatulate with two terminal setae, the distal portion is covered in
spicules, and it is half-covered by the operculum.
Ven te r. Derm of thoracic tracheal folds usually with numerous, minute spinules which extend around the
mid leg to the mesothoracic spiracle. Coxae each with an adjacent minute spine-like seta; mid and hind coxae
each with a long fine seta. Antennae length 17 microns (14–22 microns). Cuticle diaphanous and smooth.
FOURTH-INSTAR LARVA (Fig. 19)
Described and illustrated by Bellows et al (1994 as B. argentifolii), Bink-Moenen & Gerling (1992),
Martin (1987), Martin et al. (2000) and Mound (1966).
ADULT (Figs 20–24)
Body yellow, wings hyaline, covered with sparse, powdery wax. Antennae 7-segmented. Antennal
segment II about half as long as antennal segment III; antennal segment III about as long as segments IV–VII
combined; segments V–VII subequal, segment IV shorter. Segment II with long, slender, conical sensorium
(difficult to distinguish from the enlarged setae). Segment III with one sensorium located on the proximal
portion, and three sensoria (a cone and two rhinarial-types) on the distal portion. The cone is approximately a
quarter to a third the segment length away from the apex. Segment IV without a sensorium; segment V with

Zootaxa 2118 © 2009 Magnolia Press · 15
IDENTIFICATION OF WHITEFLY PESTS
an distal rhinarial-type sensorial; segment VI with a subapical sensorial cone, and segment VII with both a
sensorial cone and an adjacent rhinorial sensorium, arising near the middle of the segment and the segment
terminating in a narrow conical sensorium. Upper eye composed of 40–45 ommatidia, each 8.0 (6.8–9.5)
microns in diameter; lower compound eye composed of 31–32 ommatidia, each 10.5 (8.9–11.9) microns in
diameter, arranged in interconnected groups of 6 pigmented ommatidia surrounding a clear, smaller
ommatidium. Upper and lower eyes connected by a single clear ommatidium. There are rare examples of the
upper and lower eyes separated by less than a diameter of an ommatidium. Metatibial combs consisting of
16–19 setae, all tibial brushes consisting of two or three adjacent setae. Male claspers paired, with about 12
long setae. Aedeagus ventral base smooth; distal portion gradually tapered, gently sinuous with tip curved
upwards. Male collar and female gonapophysis and supragenital plate unpigmented. Female cement gland
usually strongly sinuous, without bands and with a small head.
Trialeurodes ricini (Misra)
(Figs 25–35)
T. ricini was originally described by Misra (1924) in the genus Aleyrodes, from specimens collected from
Ricinus communis in India. It is broadly polyphagous, feeding on host plants belonging to 22 genera in 13
families (Mound & Halsey, 1978). It occurs widely in Asia, Middle East, sub-Saharan Africa, Egypt and the
Canary Islands. It is a pest of glasshouse and field crops in Egypt and is implicated in plant-pathogenic virus
transmission.
Specimens measured
NIGERIA: (intercepted in UK), on Telfaria sp., 26.ii.2002, PHSI, CSL2020953 (1 second instar and 4
third instars), 23.iv.2002, PHSI, CSL2022136 (1 second and 2 third instars); on unspecified plant, 28.iii.2002,
PHSI, CSL2021569 (2 adult males and 1 adult female). SPAIN: Gran Canaria, Margazan, on Ricinus
communis, 9.i.2003, C. Malumphy, KV85TR1-KV85TR11 (20 eggs, 10 first, 7 second and 10 third instars,
and 7 adult males and 8 adult females). Cultured under licence at CSL, Phaseolus vulgaris, 6.iii.03,
KV85TR28-KV85TR31 (10 eggs, 10 first, 10 second and 1 third instar).
OVUM (Fig. 25)
Habitus. Cream coloured when first laid, becoming pale yellow. Red eyes and yellow fat bodies of the
first instar clearly visible prior to hatching. Scattered, or in small groups, occasionally in small irregular rows,
on the under surface of the foliage. Eggs may be laid at very high densities, particularly on the young,
unexpanded leaves of Ricinus communis. As the leaves rapidly expand the eggs become more widely
distributed before hatching. Elliptical, slightly narrower anteriorly. The chorion is smooth and shiny with little
wax evident although the surrounding leaf may be dusted with powdery wax by the adult female forming a
circular patch. Each egg is firmly attached to the leaf surface by a long, slender peduncle extending from the
base of the egg, inserted into the leaf. The peduncle bends so the eggs usually lie at an acute angle to the leaf
surface. After hatching, the egg completely collapses, is translucent and very difficult to detect. Length 228
microns (184–256 microns), width 129 microns (94–152 microns), 1.78 times longer than wide (1.30–2.17).
Peduncle length 43 microns (37–52 microns), width is 9 microns (8–13 microns).
FIRST-INSTAR LARVA (Fig. 26)
Habitus. Scale-like, pale translucent yellow, becoming darker as they mature. Reddish eye spots, two
yellow abdominal mycetomes and abdominal segmentation visible. A wide, bluish, translucent wax fringe
develops around the margin. They usually settle to feed within a few mms from their eggs.
Margin. Outline ovoid, lozenge-shaped; length 301 microns (272–332 microns) width 169 microns
(144–198 microns), 1.79 (1.65–1.83) times longer than wide. With 17 pairs of well-developed setae: 14MS

MALUMPHY ET AL.16 · Zootaxa 2118 © 2009 Magnolia Press
length 48 microns (40–53 microns); CS length 109 microns (100–116); ratio CS/14MS = 2.32 (2.08–2.60).
Margin relatively smooth or very finely crenulate in parts, and not differentiated at thoracic and abdominal
tracheal openings.
FIGURES 25–30. Trialeurodes ricini. 25, ovum on Ricinus communis from Gran Canaria; 26, first instar on R.
communis from Gran Canaria; 27, second instar on R. communis from Gran Canaria; 28, third instar on R. communis
from Gran Canaria; 29–30, fourth instar on Telfairia sp. from Nigeria showing variation in submarginal tubercles.
Dorsum. Chaetotaxy comprises paired ASS, length 24 microns (20–28 microns); CeS, 4 microns (2–4
microns); 1AS, 3 microns (2–4 microns); and 8AS, 4 microns (2–5 microns). The 8AS may be close to the
anterior corners of the vasiform orifice or displaced antero-laterad. All of the setae have large bases. Cephalic
tubercles well developed, oval to sub-rectangular. One pair of clear pores present subdorsally on the third

Zootaxa 2118 © 2009 Magnolia Press · 17
IDENTIFICATION OF WHITEFLY PESTS
abdominal segment. Vasiform orifice sub-oval to almost rectangle, closed behind, length 25 microns (24–28
microns). The lingula is spatulate with two terminal setae, the distal portion is spiculate, and it is half-covered
by the operculum. The operculum is quadrate with the posterior margin spiculate.
Venter. Legs well developed. Mid and hind coxae and tibio-tarsi with long spine-like setae. Claw digitules
long. Antennae long and slender, length 85 microns (64–92 microns). Abdominal setae bases correspond
approximately with the anterior margin of vasiform orifice. Cuticle fine, diaphanous.
SECOND-INSTAR LARVA (Fig. 27)
Habitus. Distribution similar to first instars. Scale-like, similar in appearance to first instar but larger and
more transparent.
Margin. Outline ovoid, widest across mesothoracic legs; length 383 microns (344–432 microns), width
229 microns (188–344 microns), 1.79 times longer than wide (1.20–1.84). Marginal setae fine, acute. AMS
minute and often very difficult to detect, length 5 microns (4–5 microns); PMS 13 microns (10–16 microns);
CS length 38 microns (32–46 microns). Ratio CS/PMS = 2.94 (2.25–3.67). Margin evenly crenulated, not
modified at thoracic opening and smooth at abdominal tracheal openings.
Dorsum. Chaetotaxy comprises paired CeS, length 3 microns (2–5 microns); 1AS, length 3 microns (2–4
microns); and 8AS, length 6 microns (3–8 microns). Approximately 4 pairs of close-set geminate pore/
porettes distributed longitudinally from the mesothorax to rear of abdomen as shown in Fig. 27. Abdominal
segmentation rather faintly marked, medially and submedially. Abdominal segment VII reduced medially,
pockets marked. Vasiform orifice sub oval to rectangular, closed behind, length 33 microns (26–36 microns),
inset from posterior margin by less than its own length, just over half occupied by the operculum with only
part of lingula head visible. Lingula head spinulose with pair of stout setae.
Ven te r. Legs roughly triangular, each with a subcircular apical pad. Antennae small and slender, laterad,
length 27 microns (24–32 microns). Abdominal setae placed mid vasiform orifice. Cuticle fine, diaphanous.
THIRD-INSTAR LARVA (Fig. 28)
Habitus. Distribution similar to first instars. Larger and darker yellow than first and second instars.
Margin. Outline ovoid, widest across metathoracic legs; length 525 microns (464–588 microns), width
329 microns (268–380 microns), 1.60 times longer than wide (1.52–1.81). AMS undetectable. PMS fine,
acute length 16 microns (12–22 microns). CS length 49 microns (42–56 microns). Ratio CS/PMS length =
3.25 (2.36–4.67). Margin distinctly and evenly crenulated, not modified at thoracic and abdominal tracheal
openings.
Dorsum. Chaetotaxy comprises paired CeS, length 7 microns (6–10 microns); 1AS setae, length 6 microns
(4–8 microns); and 8AS setae, length 10 microns (8–12 microns). Approximately 8 pairs of close-set
geminate pore/porettes distributed longitudinally from the head to rear of abdomen as shown in Fig. 28.
Abdominal segmentation rather faintly marked, medially and submedially. Abdominal segment VII reduced
medially, pockets distinct. Vasiform orifice cordate to rectangular, closed behind, length 42 microns (40–48
microns), inset from posterior margin by about its own length, just over half occupied by the operculum with
only part of lingula head visible. Lingula head lobed, spinulose with pair of stout setae.
Venter. Legs roughly triangular, each with a subcircular apical pad. Antennae small and slender, mesad but
apex strongly curved back on itself; length 22 microns (18–26 microns). Abdominal setae placed anterior to
vasiform orifice. Cuticle fine, diaphanous.
FOURTH-INSTAR LARVA (Figs 29–30)
Described and illustrated by Martin (1987, 1999) and Martin et al. (2000).
ADULT (Figs 31–35)
Body yellow, wings hyaline, covered with sparse, powdery wax. Antennae 7-segmented. Antennal
segment II about half as long as antennal segment III; antennal segment III about as long as segments IV–VII

MALUMPHY ET AL.18 · Zootaxa 2118 © 2009 Magnolia Press
combined; segments IV–VII subequal. Segment III with one sensorium located on the proximal portion, and
three sensoria (a cone and two rhinarial-types) close together on the distal portion. Segment IV with a
sensorial cone; segment V with a distal rhinarial-type sensorial; segment VI with a subapical sensorial cone,
and segment VII with two sensorial cones and a rhinorial sensorium, and terminating in a narrow conical
sensorium. Upper eye composed of 47 ommatidia, each 7.6 (7.0–8.9) microns in diameter; lower compound
eye composed of about 36 ommatidia, each 11.5 (10.4–12.8) microns in diameter, arranged in interconnected
groups of 6 pigmented ommatidia surrounding a clear, smaller ommatidium. Upper and lower eyes connected
by three, sometimes two, ommatidia. Metatibial combs consisting of 14 setae, all tibial brushes consisting of
2–4 adjacent setae. Male claspers paired, with about 10 long setae. Aedeagus ventral base spiculate; distal
portion parallel sided or slightly tapered, gently curved upwards, terminating in a fine 'nipple-like' tip which
may extend outwards. Male collar and female gonapophysis and supragenital plate pigmented. Female cement
gland not sinuous, without bands and with a large disc shaped-head.
Trialeurodes vaporariorum (Westwood)
(Figs 36–47)
T. vaporariorum was originally described by Westwood (1856) in the genus Aleyrodes, from specimens
collected from Gonolobus sp., Tecoma velutina, Bignonia spp., Aphelandra spp., Solanum spp. and other
similar soft-leaved plants in botanical collections in the UK. It is one of the most polyphagous and
cosmopolitan whitefly species (Mound & Halsey, 1978) and is a serious pest of glasshouse crops and
ornamental plants. It is a vector of plant-pathogenic viruses.
Specimens measured
CHINA: (intercepted in UK), on penjing Ulmus parvifolia, 15.i.2001, PHSI, CSL2010177 (1 third instar);
(intercepted in UK), on penjing U. parvifolia, 6.ii.2001, PHSI, CSL2010478 (2 first and 1 second instar);
(intercepted in UK), on penjing U. parvifolia, 3.xii.1999, PHSI, CSL997451 (1 third instar). GUERNSEY:
(intercepted in UK) on Fuchsia sp., 13.xii.2000, PHSI, CSL2007985 (3 first instars). KENYA: (intercepted in
UK), on Hypericum androsaemum, 7.ii.2001, PHSI, CSL2010493 (2 first, 5 second and 1 third instars).
NETHERLANDS: (intercepted in UK), on Lantana camara, 28.ii.2003, PHSI, CSL201741 (5 eggs and 1
third instar); (intercepted in France, Coquelles), on Aster sp., 12.viii.2003, PHSI, CSL20308761 (10 eggs and
9 first instars). PORTUGAL: (intercepted in UK), on Fuchsia hybrida, 23.xi.2000, PHSI, CSL2007424 (3
first instars and 1 second instar), CSL2007421 (5 first instars), CSL2007425 (2 first instars). TANZANIA:
(intercepted in UK), on Sutera sp., 26.i.2001, PHSI, CSL2010333 (7 second and 1 third instar). UNITED
KINGDOM: Avon, Bristol, botanical garden, on Solanum quitense, 5.xii.2000, PHSI, CSL2007668 (3 adult
females); Berkshire, Windsor, on E. pulcherrima, 25.ix.2001, PHSI, CSL2014873 (2 second and 5 third
instars); Essex, Wickford, on Symphytum officinale, 24.iii.2006, PHSI, CSL 206035536 (2 adult males); North
Yorkshire, Nunnington, on Rhodochiton atrosanguineum, 25.vi.2001, R. Hammon, CSL2011894 (1 first
instar); Cheshire, Macclesfield, on E. pulcherrima, 3.vii.2003, PHSI, CSL20308408 (2 first and 8 second
instars), 25.vi.2004, PHSI, CSL20408585 (5 adult males and 19 females); Merseyside, Wirral, on Fuchsia sp.,
15.viii.2003, PHSI, 20308958 (10 eggs and 8 third instars).
OVUM (Fig. 36)
Habitus. Cream coloured when first laid, becoming yellow and usually a dark smokey colour. Red eyes
and yellow fat bodies of the first instar clearly visible prior to hatching. The eggs are usually laid in partial or
complete circles but may be scattered on hirsute leaves or when populations occur at high densities. Elliptical,
chorion smooth and shiny with little wax evident. The area surrounded the eggs is often lightly dusted with
powdery wax by the adult female but this soon disappears. Each egg is erect and firmly attached to the leaf
surface by a slender peduncle extending from the base of the egg, inserted into the leaf. The egg often

Zootaxa 2118 © 2009 Magnolia Press · 19
IDENTIFICATION OF WHITEFLY PESTS
collapses after hatching and is a distinct, dark smoky or black colour. Length 249 microns (204–288 microns),
width 131 microns (112–144 microns), 1.91 (1.69–2.12) times longer than wide. Peduncle length 34 microns
(28–39 microns), width is 9 microns (8–12 microns).
FIGURES 31–38. Trialeurodes spp. 31, T. ricini, diagrammatic representation of left compound eye of adult female; T.
ricini, 32, upper and lower compound eyes linked by two to four ommatidia; T. ricini, 33, male antenna; T. ricini, 34,
aedeagus; T. r icini, 35, female cement gland; 36, T. vaporariorum, ovum on Euphorbia pulcherrima from Italy; 37, T.
vaporariorum, first instar on E. pulcherrima from the UK; 38, T. vaporariorum, second instar on E. pulcherrima from
Italy.
FIRST-INSTAR LARVA (Fig. 37)
Habitus. Scale-like, pale translucent yellow, becoming darker as they mature. A narrow band of white
powdery wax present around the margin. Reddish eye spots, two yellow abdominal mycetomes and

MALUMPHY ET AL.20 · Zootaxa 2118 © 2009 Magnolia Press
abdominal segmentation visible. Clumped distribution, forming distinct feeding groups. The first instars are
usually located within a few mm’s of the hatched eggs.
Margin. Outline ovoid, lozenge-shaped; usually widest across mesothoracic coxae; length 314 microns
(276–364 microns), width 190 microns (164–224 microns), 1.66 (1.54–1.95) times longer than wide. With 17
pairs of well-developed, fine, acute setae: MS14 length 54 microns (44–76 microns); CS length 134 microns
(96–156 microns). Ratio CS/MS14 length = 2.49 (1.84–3.13). Margin relatively smooth, not modified at
thoracic and abdominal tracheal openings.
Dorsum. Chaetotaxy comprises paired ASS, length 25 microns (14–32 microns); CeS length 6 microns
(3–8 microns); 1AS length 6 microns (3–8 microns); and 8AS length 9 microns (4–14 microns). Meso-/
metathoracic and abdominal segmentation faintly marked, becoming less distinct with maturity. Cephalic
tubercles well developed, oval to sub-rectangular. Single pair of geminate pore/porettes on 4th abdominal
subdorsal area. Vasiform orifice sub-oval to almost rectangle, open behind, length 29 microns (26–36
microns), inset from posterior margin by less than its length, half-occupied by the operculum. The operculum
is quadrate with the posterior margin spiculate. The posterior corners may be pronounced forming triangular
points. Lingula spatulate, head exposed and spiculate with 2 pairs of stout setae.
Venter. Legs well developed. Mid and hind coxae and tibio-tarsi with long spine-like setae. Claw digitules
long. Antennae long and slender, length 82 microns (72–92 microns). The solenidia are variable in size and
the antennae may be asymmetrical. Abdominal setae bases correspond approximately with the middle of the
vasiform orifice. Cuticle fine, diaphanous.
SECOND-INSTAR LARVA (Fig. 38)
Habitus. Distribution the same as the first instars. Pale translucent yellow, becoming darker with maturity.
Margin. Outline ovoid, usually widest across mesothoracic coxae; length 407 microns (360–444 microns),
width 265 microns (228–292 microns), 1.55 (1.41–1.64) times longer than wide. Marginal setae, fine, acute.
AMS length 4 microns (1–6 microns), PMS length 16 microns (12–20 microns), CS length 50 microns (46–56
microns), ratio CS/PMS = 3.16 (2.30–4.33). Margin crenulate, not modified at thoracic tracheal openings.
Dorsum. Chaetotaxy comprises paired CeS, length 62 microns (28–76 microns); 1AS length 6 microns
(3–8 microns); and 8AS length 44 microns (10–58 microns). There is a single longitudinal row of
approximately eight pairs of close-set geminate pore/porettes on each side. Meso-/metathoracic and
abdominal segmentation marked. Abdominal segment VII reduced medially, pockets distinct. Vasiform
orifice cordate to rhomboid, length 36 microns (32–41 microns), inset from posterior margin by slightly less
than its length, closed posteriorly, half-occupied by the operculum, lingula head exposed, distinctly lobed,
spiculate with 2 pairs of stout setae. Operculum quadrate to semi-circular with spiculate posterior margin.
Venter. Legs roughly triangular, each with a subcircular apical pad. Antennae short and slender, length 25
microns (20–32 microns). Abdominal setae placed mid vasiform orifice. Cuticle fine, diaphanous.
THIRD-INSTAR LARVA (Fig. 39)
Habitus. Distribution similar to first instars. Larger and darker yellow than first and second instars.
Margin. Outline ovoid, widest across mesothoracic legs; length 528 microns (488–612 microns), width
338 microns (276–406 microns), 1.57 (1.47–1.78) times longer than wide. Marginal setae, fine, acute. AMS
minute and can be difficult to detect, length 5 microns (2–7 microns); PMS length 21 microns (14–28
microns). CS length 65 microns (48–84 microns). Ratio CS/PMS = 3.20 (2.58–4.38). Margin distinctly and
evenly crenulate; not modified at thoracic and abdominal tracheal openings.
Dorsum. Chaetotaxy comprises paired CeS, length 66 microns (2–84 microns); 1AS, length 5 microns
(4–11 microns); and 8AS, length 64 microns (6–78 microns). The CeS and 8AS exist in two states: minute or
well developed. It is possible that 1AS may also be found well developed under the right environmental
conditions but they were not observed in this state during this study. Approximately 12 pairs of close-set
geminate pore/porettes distributed longitudinally from the head to rear of abdomen as shown in Fig. 39.
Abdominal segmentation rather faintly marked, medially and submedially. Abdominal segment VII reduced

Zootaxa 2118 © 2009 Magnolia Press · 21
IDENTIFICATION OF WHITEFLY PESTS
medially, pockets distinct. Vasiform orifice cordate to rectangular, closed behind, length 46 microns (42–52
microns), inset from posterior margin by about its own length, just over half occupied by the operculum with
only part of lingula head visible. Lingula head lobed, spinulose with pair of stout setae.
Venter. Legs roughly triangular, each with a subcircular apical pad. Antennae, mesad but apex strongly
curved back on itself; length 17 microns (12–22 microns). Abdominal setae placed anterior to vasiform
orifice. Cuticle fine, diaphanous.
TABLE 3. Ct values obtained following TaqMan PCR using the primers and probes designed for the identification of B.
tabaci, B. afer, T. rici ni and T. vaporariorum in simplex.
Notes:
a Only one individual available.
b Only two individuals available.
- Indicates a negative result.
Standard deviations are presented for duplicate reactions in the real-time PCR.
FOURTH-INSTAR LARVA (Fig. 40)
Described and illustrated by Bink-Moenen & Gerling (1992), Martin (1987, 1999) and Martin et al.
(2000).
ADULT (Figs 41–47)
Body pale yellow, wings hyaline, covered with sparse, powdery wax. Antennae 7-segmented. Antennal
segment II about half as long as antennal segment III; antennal segment III about as long as segments IV–VII
combined; segments IV–VII subequal, although segment V may be longer. Segment III with one sensorium
located on the proximal portion, and three sensoria (a cone and two rhinarial-types) close together on the
distal portion; segment IV with a sensorial cone; segment V with an distal rhinarial-type sensorial; segment
Species Name Simplex assays
B. tabaci B. afer T. ricini T. vaporarorium
B. tabaci BTQ 19.5± 1.1---
B. tabaci 8495 19.6± 0.9---
B. tabaci 8720 19.7± 0.6---
B. tabaci 8722 20.0± 0.1---
B. tabaci 8766 20.1± 0.5---
B. tabaci 8871 18.2± 0.3---
B. tabaci 8946 27.0± 0.3---
B. tabaci 9382 20.4± 0.7---
B. tabaci BTTUNA 18.5± 1.0---
B. tabaci 9094 20.1± 0.6---
B. tabaci 6607 20.0± 1.3---
B. afer 5088a- 21.0± 0.2 - -
B. afer BANRI - 20.2± 0.0 - -
Bemisia sp. 5088Aa- 21.3± 0.1 - -
T. ricini TRCID - - 17.5± 0.4
T. ricini TRegy - - 18.6± 1.1 -
T. ricini 14148b--20.0± 0.4 -
T. ricini 20400432b--19.8± 1.5 -
T. vaporariorum 8722B - - - 18.3± 0.2
T. vaporariorum TVBLB---16.5± 0.6
T. vaporariorum 1690A - - - 17.3± 0.6
T. vaporariorum TVCIZ---18.1± 0.9

MALUMPHY ET AL.22 · Zootaxa 2118 © 2009 Magnolia Press
VI with a subapical sensorial cone; segment VII with two sensorial cones and a rhinarial sensorium, and
terminating in a narrow conical sensorium. Upper eye composed of 52–55 ommatidia, each 8.7 (8.0–9.5)
microns in diameter; lower compound eye composed of about 30–31 ommatidia, each 12.8 (11.2–13.9)
microns in diameter, arranged in interconnected groups of 6 pigmented ommatidia surrounding a clear,
smaller ommatidium. Upper and lower eyes separate. Metatibial combs consisting of 17 setae, all tibial
brushes consisting of 4–6 adjacent setae. Male claspers paired, with about 10 long setae. Aedeagus thick,
robust, ventral base spiculate; distal portion tapered and strongly curved near tip. Male collar and female
gonapophysis and supragenital plate strongly pigmented. Female cement gland not sinuous, with transverse
bands and with a large disc shaped-head.
Primer and probe design
The alignment of COI sequences revealed many polymorphisms between the whitefly species; Fig. 48
details these differences in the region of the primer and probe sequences. Suitable sites for primer and probe
sequences for B. tabaci had the fewest number of mismatches with other species, between 0–7 in the forward
primer (with a maximum of 2 in the last 8 bases at the 3′ end) and between 3 and 5 mismatches in the reverse
primer (with a maximum of 3 in the last 8 bases at the 3 ′ end). When compared with T. vaporariorum the B.
tabaci sequences had the least mismatches overall, 5 in total. The T. ricini assay had the greatest number of
mismatches, between 16 and 19 mismatches in the forward and reverse primers.
TABLE 4. Ct values obtained following TaqMan PCR using the primers and probes designed for the identification of B.
tabaci, B. afer, T. ricini and T. vaporariorum performed in two multiplex reactions for the Bemisa species and the
Trialeurodes species.
Notes:
a Only one individual available.
b Only two individuals available.
- Indicates a negative result.
Standard deviations are presented for duplicate reactions in the real-time PCR
Real-time PCR assay
DNA extracts from B. tabaci individuals produced Ct values of between 18.2–27.0 when tested with the
B. tabaci-specific TaqMan assay; individuals of B. afer, T. ricini and T. vaporariorum tested with the
appropriate assays produced Ct values of 20.2–21.3, 17.5–20.0 and 16.5–18.3 respectively (Table 3). Where
an assay was used to test non-matching DNA no amplification was seen in 35 cycles. In addition, individuals
of T. lauri from Turkey, a species very closely related to T. ricini (Malumphy et al., 2007) were tested
producing no amplification (data not shown). Three populations each of B. tabaci, T. ricini and T.
Species Sample
Name Bemisia multiplex assay Trialeurodes multiplex assay
B. tabaci B. afer T. ricini T. vaporariorum
B. tabaci BTQ 22.3± 0.0 -nt nt
B. tabaci 8495 21.5± 0.1 -nt nt
B. tabaci 8720 22.2± 0.0 -nt nt
B. afer BANRI -23.1± 0.4 nt nt
Bemisia sp. 5088Aa-28.8± 0.6 nt nt
T. ricini TRCID nt nt 19.1± 0.0 -
T. ricini 14148bnt nt 22.2± 0.4 -
T. ricini 20400432bnt nt 23.6± 0.1 -
T. vaporariorum 8722Cbnt nt -20.2 0.3
T. vaporariorum TVBLB nt nt -19.0± 0.3
T. vaporariorum 1690A nt nt -20.2± 0.0

Zootaxa 2118 © 2009 Magnolia Press · 23
IDENTIFICATION OF WHITEFLY PESTS
vaporariorum, as well as two of B. afer and one mixed population of both B. afer and B. tabaci, were tested
with the TaqMan assays in multiplex (Table 4). Testing in multiplex produced comparable results with the
simplex assays.
FIGURES 39–47. Trialeurodes vaporariorum. 39, third instar on E. pulcherrima from Italy; 40, fourth instar on E.
pulcherrima from Italy; 41, diagrammatic representation of left compound eye of adult female; 42, upper and lower
compound eyes separate; 43, mesotibia combs; 44, male abdomen with dorsal discoidal pores; 45, female antenna; 46,
aedeagus; 47, female cement gland.

MALUMPHY ET AL.24 · Zootaxa 2118 © 2009 Magnolia Press
FIGURE 48. CO1 sequence alignments showing sequence polymorphisms between species in the annealing sites of
primers and probes. Mismatches are shown in bold, forward primer, probe and reverse primer annealing sites are boxed,
left to right respectively.
Discussion
All developmental stages of B. afer, B. tabaci, T. ricini and T. vaporariorum can be identified, for the first
time, using a combination of morphological characters and targeted molecular assays. Morphological
characters have been identified that enable most life stage/species combinations in the four species to be
distinguished; dichotomous identification keys to all the life stages of the four species are presented below.
However, the characters used to separate the early larval instars are often subtle and in some cases rely on
dorsal setal lengths, which can be variable. As a result, the first- and third-larval instars of the Trialeurodes
species proved particularly difficult or, for some individuals, impossible to separate. In all cases, but
particularly with the early-larval instars of the two Trialeurodes species, several specimens should be
examined and mean values or character states used. In addition, the eggs and the adult females of the two
Bemisia species could not be separated morphologically. All developmental stages of the two Bemisia species,
however, can be separated morphologically from those of the two Trialeurodes species.
Clear, simple but gross, differences in the structure of the antenna correlating to the different larval instars
were identified; these proved consistent for all four species studied here but the wider applicability of this
character for distinguishing larval instars was not investigated and may not apply to all Aleyrodinae.
This study demonstrated that the phenotypic plasticity exhibited by the puparial stage of these Bemisia
and Trialeurodes species also occurs in the second and third larval instars, most notably, in the degree of
development of the dorsal setae. For example, the dorsal setae of second instar B. afer existed in two distinct
states: minute (2–8 microns) or well developed (20–62 microns). This was predicted as the variation reported
in the fourth-larval instar is determined by the tactile experience of the first instar (Neal & Bentz, 1999).
Dorsal structures, such as setae, tubercles and papillae, are better developed in individuals that experienced a
lot of tactile encounters as a first instar. The number of tactile encounters depends on leaf surface topography
and population density.
Four real-time PCR assays were designed and validated to distinguish between the four target species, B.
tabaci, B. afer, T. ricini and T. vaporariorum. The assays were screened against 11 B. tabaci populations (from
8–10 countries), two B. afer populations (2 countries), four T. ricini populations (4 countries) and four T.
vaporariorum populations (4 countries). Individuals from a population of T. lauri were also used in the
screening process. The assays are generic in their set-up and can be multiplexed to form two reactions

Zootaxa 2118 © 2009 Magnolia Press · 25
IDENTIFICATION OF WHITEFLY PESTS
allowing discrimination of B. afer and B. tabaci in one well, and T. ricini and T. vaporariorum in another,
reducing reagent costs and simplifying the procedure. The assays are simple to set up, rapid and robust. They
have proved sensitive enough to confirm the identity of B. tabaci from single eggs. The very quick, simple
DNA extraction method, which uses Chelex 100 resin and involves very few steps, not only reduces the
overall time taken to complete the assay, but also minimises the risk of errors occurring at this stage, reducing
the risk of false-negatives.
Direct slide-mounting of early-instar material into Heinz Mountant allows very rapid morphological
screening of imported sample material. Slide-mounting of fourth-instar larvae in Canada balsam is also
relatively quick. However, the real-time PCR assays may be used strategically as part of a combined
morphological/molecular identification protocol; thus, a positive result for B. tabaci using the real-time assays
increases the level of confidence with which eradication action may be taken, particularly if morphological
analysis has (for whatever reason) proven inconclusive. Molecular analysis may also be used to resolve the
identity of the early instars of the two Trialeurodes species where morphological separation is not always
possible. In addition, the assays are ideal for use by non-specialist staff. Furthermore, by using rapid cycling,
portable, instruments such as the Cepheid Smartcycler II, a positive result could be obtained in under an hour
and the assay conducted on-site, away from the laboratory, as required, for example where perishable
imported goods are being held at a port-of-entry.
Keys to distinguish all life stages of Bemisia afer, B. tabaci, Trialeurodes ricini and T. vaporariorum
Mature and hatched eggs
The following key will only work with mature (older than 24 hours) and hatched eggs. It will not work
with newly laid eggs, which are cream in all four species. The oviposition pattern is highly variable in all four
species, although T. vaporariorum lays eggs in a partial circle more frequently than the other species.
1. Eggs golden brown; remain erect after hatching ...................................................................................... Bemisia spp.
- Eggs dark grey or yellow; usually collapse after hatching ..........................................................................................2
2. Eggs dark grey; peduncle length 28–39 microns ............................................................... Trialeurodes vaporariorum
- Eggs lie horizontally, yellow, translucent when hatched; peduncle length 37-52 microns ............. Trialeurodes ricini
Larval instars
The morphological separation of early larval instar T. ricini from those of T. vaporariorum is difficult,
particularly for the first and third instars. It is therefore essential to examine several specimens from a
population and to use mean values for the character states in the following key. The hatched eggs, however,
are often found in association with the early instars (within 10 mm) and can be used to help with the
separation of the Trialeurodes species.
1. Well developed functional legs, antennae and more than 3 pairs of marginal setae ...............................(first instar) 2
-. Non functional legs, antennae reduced, 3 or less pairs of marginal setae ...................................................................5
2. 16 pairs of marginal setae; geminate pores/porettes absent from abdomen; cephalic tubercles usually weakly devel-
oped, oval ................................................................................................................................................... (Bemisia) 3
-. 17 pairs of marginal setae; 1 pair of geminate pores/porettes present on abdomen; cephalic tubercles usually well
developed, oval to sub-rectangular.......................................................................................................(Trialeurodes) 4
3. CS subequal to 14AS; tibio-tarsi distinctly spinose ................................................................................. Bemisia afer
-. CS twice or more the length of 14AS; tibio-tarsi with few spines ....................................................... Bemisia tabaci
4. Operculum clear; vasiform orifice often appears closed behind or with slight opening, posterior flap on orifice floor
small, semi-circular; lingula head flattish and usually fully exposed Trialeurodes ricini
-. Operculum usually pigmented light grey; vasiform orifice clearly open behind, posterior flap on orifice floor con-
spicuous, rectangular; lingula head rounded and often only partially exposed Trialeurodes vaporariorum
5. Antennae short, straight, tapered and not overlapping front legs ...................................................... (second instar) 6
-. Antennae strongly curved or overlapping front legs ......................................................................................................

MALUMPHY ET AL.26 · Zootaxa 2118 © 2009 Magnolia Press
6. Margin faintly crenulate to smooth; vasiform orifice sub-triangular ..........................................................(Bemisia) 7
-. Margin distinctly and evenly crenulate; vasiform orifice sub-oval......................................................(Trialeurodes) 8
7. CS/14AS between 1.92 and 4.91 .............................................................................................................. Bemisia afer
-. CS/14AS between 4.88 and 10.25 ......................................................................................................... Bemisia tabaci
8. Cephalic seta 2–5 microns; eighth abdominal seta 4–8 microns; caudal seta 40–46 microns ....... Trialeurodes ricini
-. Cephalic seta 28–80 microns; eighth abdominal seta 10–58 microns; caudal seta 46–56 microns ..............................
........................................................................................................................................... Trialeurodes vaporariorum
9. Antennae strongly curved forming a ‘U’ shape, broad at the base and apically narrow, not overlapping front legs ....
.............................................................................................................................................................. (third instar) 10
-. Antennae straight or gently curved, uniform in width, overlapping front legs ................................. (fourth instar) 13
10. Lingula spatulate, without distal lobes; vasiform orifice subcordate, closed posteriorly; marginal crenulations irregu-
lar ..............................................................................................................................................................(Bemisia) 11
-. Lingula lobed distally; vasiform orifice sub-oval, open posteriorly; marginal crenulations uniform ...........................
........................................................................................................................................................... (Trialeurodes) 12
11. Vasiform orifice inset from margin by approximately its own length; CS/PMS 3.00–6.67; cephalic seta, eighth
abdominal seta and caudal seta minute ..................................................................................................... Bemisia afer
-. Vasiform orifice inset from margin by less than its own length; CS/PMS 4.60–17.33; cephalic seta, eighth abdominal
seta and caudal seta minute or well developed ..................................................................................... Bemisia tabaci
12. Lingula head short, widening beyond the operculum margin; cephalic seta 6–10 microns; eighth abdominal seta
8–12 microns; caudal seta 42–56 microns Trialeurodes ricini
-. Lingula head long, widening from the operculum margin; cephalic seta 2–84 microns; eighth abdominal seta 6–78
microns; caudal seta 48–84 microns ..................................................................................Trialeurodes vaporariorum
13. Submarginal tubercles absent; lingula spatulate ...................................................................................... (Bemisia) 14
-. Submarginal tubercles present; lingula lobed ................................................................................... (Trialeurodes) 15
14. Caudal setae usually less than half the length of vasiform orifice and often minute; vasiform orifice longer than
length of caudal furrow with straight sides; distinct dorsal stippling absent; usually two geminate pore/porette pairs
between median line and first abdominal setae ........................................................................................ Bemisia afer
-. Caudal setae stout, usually as long or longer than vasiform orifice; vasiform orifice shorter than length of caudal fur-
row with concave sides; distinct dorsal stippling present; single geminate pore/porette pair between median line and
first abdominal setae ............................................................................................................................. Bemisia tabaci
15. Middle and hind legs each with a pair of stout spines; papillae acute, those in submarginal row almost contiguous or
very irregular.................................................................................................................................... Trialeurodes ricini
-. Middle and hind legs with only minute setae; papillae more truncate, often rounded apically, not contiguous ...........
........................................................................................................................................... Trialeurodes vaporariorum
Adults
It is currently not possible to separate the adult females of B. afer and B. tabaci.
1. Upper and lower compound eyes linked by a single ommatidium (occasionally there is a small gap but this is always
less than the diameter of the ommatidium); third antennal segment with a sensorial cone about 1/3 segment length
from apex; fourth antennal segment without a sensorial cone; seventh antennal segment with a single sensorial cone;
male collar clear and aedeagus smooth on ventral base; female gonapophysis and supragenital plate clear and
cement gland sinuous .................................................................................................................................................. 2
-. Upper and lower compound eyes either separated by a distance equal to or greater than the diameter of a single
ommatidium or linked by 2–4 ommatidia; third antennal segment with a sensorial cone close to the apex; fourth
antennal segment with a sensorial cone; seventh antennal segment with two sensorial cones; male collar pigmented
and aedeagus spiculate on ventral base; female gonapophysis and supragenital plate pigmented and cement gland
not sinuous .................................................................................................................................................................. 3
2. Aedeagus parallel-sided, apex blunt with little or no curve upwards ....................................................... Bemisia afer
-. Male aedeagus gradually tapered, apex curved upwards ...................................................................... Bemisia tabaci
3. Upper and lower compound eyes separate; male aedeagus relatively thick, robust, with apex curved upwards but no
fine extension at tip; male abdomen with discoidal pores dorsally; female cement gland with transverse bands (may
be difficult to see) ........................................................................................................... Trialeurodes vaporariorum
-. Upper and lower compound eyes linked by 2–4 ommatidia; male aedeagus relatively slender, apex curved up with
fine ‘nipple-like’ tip which may extend outwards; male abdomen without discoidal pores; female cement gland
without transverse bands ................................................................................................................. Trialeurodes ricini

Zootaxa 2118 © 2009 Magnolia Press · 27
IDENTIFICATION OF WHITEFLY PESTS
Acknowledgements
Dr. M. N. Maruthi of the Natural Resources Institute, Chatham, UK, generously supplied specimens of
Bemisia afer on several occasions. Many members of the PHSI were involved in the interception of traded
plant material infested with whitefly that was later used in this study. Jon Martin of the Natural History
Museum identified some of the whitefly and provided valuable information. Mark Delaney, Christine Tuppen
and Dan Pye helped maintain the cultures (licence PHL 251/4422) and mounted the specimens at CSL. This
research was funded by the Plant Health Division of Defra.
References
Armstrong, K.F. & Ball, S.L. (2005) DNA barcodes for biosecurity: invasive species identification. Philosophical
transactions of the Royal Society of London, Biological Sciences, 360(1462), 1813–1823.
Azab, A.K., Megahed, M.M. & El-Mirsawi, H.D. (1969) (publ. 1970) Effect of degree of pubescence of host-plant on the
number and distribution of dorsal spines in pupa of Bemisia tabaci (Genn.)(Hemiptera-Homoptera: Aleyrodidae).
Bulletin de la Société Entomologique d'Egypte, 53, 353–357.
Bellows, T.S., Perring, T.M., Gill, R.J. & Headrick, D.H. (1994) Description of a species of Bemisia (Homoptera:
Aleyrodidae). Annals of the Entomological Society of America, 87, 195–206.
Bethke, J.A., Paine, T.D. & Nuessly, G.S. (1991) Comparative biology, morphometrics, and development of two
populations of Bemisia tabaci (Homoptera: Aleyrodidae) on cotton and poinsettia. Annals of the Entomological
Society of America, 84, 407–411.
Bink-Moenen, R.M. & Gerling, D. (1992) Aleyrodidae of Israel. Bolletino del Laboratorio di Entomologia Agraria
“Filippo Silvestri”, 47, 3–49.
Bock, K.R. (1994) Studies on cassava brown streak virus disease in Kenya. Tropical Science, 34, 134–145.
Brown, J.K., Perring, T.M., Cooper, A.D., Bedford, I.D. & Markham, P.G. (2000) Genetic analysis of Bemisia
(Homoptera: Aleyrodidae) populations by isoelectric focusing electrophoresis. Biochemical Genetics, 38, 13–25.
Christopherson, C., Sninsky, J. & Kwok, S. (1997) The effects of internal primer-template mismatches on RT-PCR: HIV-
1 model studies. Nucleic Acids Research, 25(3), 654–658.
David, B.V. & Ananthakrishnan, T.N. (1976) Host correlated variation in Trialeurodes rara Singh and Bemisia tabaci
(Gennadius) (Aleyrodidae: Homoptera: Insecta). Current Science, 45, 223–225.
De Barro, P.J., Trueman, J.W.H. & Frohlich, D.R. (2005) Bemisia argentifolii is a race of B. tabaci (Hemiptera:
Aleyrodidiae): the molecular genetic differentiation of B. tabaci populations around the world. Bulletin of
Entomological Research, 95, 193–203.
El-Khidir, E. & Khalifa, A. (1962) A new aleyrodid from the Sudan. Proceedings of the Royal Entomological Society of
London (B), 31, 47–51.
Evans, G.A. (2007) The whiteflies (Hemiptera: Aleyrodidae) of the World and their host plants and natural enemies.
http://www.sel.barc.usda.gov:591/1WF/whitefly_catalog.htm. Version 070606, 11 June 2007.
Frohlich, D.R., Torres-Jerez, I., Bedford, I.D., Markham, P.G. & Brown, J.K. (1999) A phylogenetic analysis of the
Bemisia tabaci species complex based on mitochondrial DNA markers. Molecular Ecology, 8, 1683–1691.
Gill, R.J. (1990) The Morphology of Whiteflies. In Dan Gerling (Ed.) Whiteflies: their Bionomics, Pest Status and
Management. pp.13–46.
Gómez-Menor, J. 1943. Contribuión al conocimiento de los Aleyródidos de España (Hem. Homop.) 1.a Nota. EOS, 14,
173–209
Gupta, P.C. (1972) External morphology of Bemisia gossypiperda (M. & L.) a vector of plant virus diseases (Homoptera:
Aleurodidae). Zoologische Beitrage, 18, 1–23.
Harakly, F. A. (1973)(publ. 1974) Variation in pupae of Bemisia tabaci (Gennadius) bred on different hosts (Homoptera:
Aleyrodidae). Bulletin de la Société Entomologique d'Egypte, 57, 407–412.
Hebert, P.D.N., Cywinska, A., Ball, S.L. & De Waard J.R. (2003) Biological identifications through barcodes.
Proceedings of the Royal Society of London, Biological Sciences, 270 (1512), 313–321.
Heinze, K. (1952) Polyvinylakohol-Lactophenol-Gemisch als Einbettungsmittel für Blattläuse. Naturwissenschaften, 39,
285–286.
Higgins, D.G. & Sharp, P.M. (1988) CLUSTAL: a package for performing multiple sequence alignment on a
microcomputer. Gene, 73, 237–244.
Hill, B.G. (1969) A morphological comparison between two species of whitefly, Trialeurodes vaporariorum (Wetw.) and
Bemisia tabaci (Genn.) (Homoptera: Aleyrodidae) which occur on tobacco in the Transvaal. Phytophylactica, 1,

MALUMPHY ET AL.28 · Zootaxa 2118 © 2009 Magnolia Press
127–146.
Idriss, M., Abdallah, N., Aref, N., Haridy, G. & Madkour, M.A. (1997) Biotypes of the castor bean whitefly Trialeurodes
ricini (Misra) (Hom., Aleyrodidiae) in Egypt: biochemical charaterzation and efficiency of geminivirus
transmission. Journal of Applied Entomology, 121, 501–509.
Jones, D. (2003) Plant viruses transmitted by whiteflies. European Journal of Plant Pathology, 109, 197–221.
Kwok, S., Kellogg, D.E., McKinney, N., Spasic, D., Goda, L., Levenson, C. & Sninsky, J.J. (1990) Effects of primer-
template mismatches on the polymerase chain reaction: Human immunodeficiency virus type 1 model studies.
Nucleic Acids Research, 18, 999–1005.
Malumphy, C. (2003) The status of Bemisia afer (Priesner & Hosny) in Britain (Homoptera: Aleyrodidae).
Entomologist’s Gazette, 54, 191–196.
Malumphy, C., Suarez, M.B., Glover, R., Boonham, N. & Collins D.W. (2007) Morphological and molecular evidence
supporting the validity of Trialeurodes lauri and T. ricini (Hemiptera: Sternorrhyncha: Aleyrodidiae). European
Journal of Entomology, 104 (2), 295–301.
Martin, J.H. (1987) An identification guide to common whitefly pest species of the world (Homoptera, Aleyrodidae).
Tropical Pest Management, 33, 298–322.
Martin, J.H. (1999) The whitefly fauna of Australia (Strenorrhyncha: Aleyrodidae) A taxonomic account and
identification guide. CSIRO Entomology Technical Paper No. 38. 197 pp.
Martin, J. (2003) Whiteflies (hemiptera: Aleyrodidae) – their systematic history and resulting problems of conventional
taxonomy, with special reference to descriptions of Aleyrodes proletella (Linnaeus, 1758) and Bemisia tabaci
(Gennadius, 1899). Entomologist’s Gazette, 54, 125–136.
Martin, J.H., Mifsud, D. & Rapisarda, C. (2000) The whiteflies (Hemiptera: Aleyrodidae) of Europe and the
Mediterranean Basin. Bulletin of Entomological Research, 90, 407–448.
Martin, J.H. & Mound, L.A. (2007) An annotated checklist of the world’s whiteflies (Insecta: Hemiptera: Aleyrodidae).
Zootaxa, 1497, 1–84.
Mellor, H.E. & M. Anderson. (1995) Antennal sensilla of whiteflies: Trialeurodes vaporariorum (Westwood), the
glasshouse whitefly, Aleyrodes proletella (Linnaeus), the cabbage whitefly, and Bemisia tabaci (Gennadius), the
tobacco whitefly (Homoptera: Aleyrodidae). 1: External Morphology. International Journal of Insect Morphology
and Embryology, 24, 133–143.
Mohanty, A.K. & Basu, A.N. (1986) Effect of host plants and seasonal factors on intraspecific variations in pupal
morphology of the whitefly vector, Bemisia tabaci (Genn.)(Homoptera: Aleyrodidae). Journal of Entomological
Research, 10, 19–26.
Mound, L.A. (1963) Host-correlated variation in Bemisia tabaci (Gennadius) (Homoptera: Aleyrodidae). Proceedings of
the Royal Entomological Society London (A), 38, 171–180.
Mound, L.A. (1965) An Introduction to the Aleyrodidae of Western Africa (Homoptera). Bulletin of the British Museum
(Natural History) Entomology, 17, 115–160.
Mound, L.A. (1966) A Revision of the British Aleyrodidae (Hemiptera: Homoptera). Bulletin of the British Museum
(Natural History) Entomology, 17, 399–427.
Mound, L.A. (1967) A new species of whitefly (Homoptera: Aleyrodidae) from ferns in British glasshouses.
Proceedings of the Royal Entomological Society of London, 36, 30–32.
Mound, L.A. & Halsey, S.H. (1978) Whiteflies of the world, a systematic catalogue of the Aleyrodidae (Homoptera) with
host plant and natural enemy data. British Museum (Natural History), London, UK. 340 pp.
Neal, J.W. & Bentz, J. (1999) Evidence for the stage inducing phenotypic plasticity in pupae of the polyphagous
whiteflies Trialeurodes vaporariorum and Bemisia argentifolii (Homoptera: Aleyrodidae) and the raison d'etre.
Annals of the Entomological Society of America, 92, 754–787.
Perring, T.M. (2001) The Bemisia tabaci species complex. Crop Protection, 20, 725–737.
Priesner, H. & Hosny, M. (1934) Contribution to a knowledge of the whiteflies (Aleurodidae) of Egypt (III). Ministry of
Agriculture, Egypt. Technical and Scientific Service Bulletin, 145, 1–11.
Rossell, R.C., Bedford, I.D., Frochlich, D.R., Gill, R.J., Markham, P.G., & Brown, J.K. (1997) Analyses of
morphological variation in distinct populations of Bemisia tabaci. Annals of the Entomological Society of America,
90, 575–589.
Riemann, J. G. & Newman, S. M. (1995) Dorsal disks of adult male greenhouse whitefly [Trialeurodes vaporariorum]
(Homoptera: Aleyrodidae). Annals of the Entomological Society of America, 88, 512–518.
Russell, L.M. (1948) The North American species of whiteflies of the genus Trialeurodes. Miscellaneous Publications
US Department of Agriculture, 635, 1–85.
Walsh, K., Boonham, N., Barker, I. & Collins, D.W. (2005) Development of a sequence-specific Real-Time PCR to the
melon thrips Thrips palmi (Thysanoptera: Thripidae). Journal of Applied Entomology, 129 (5), 272–279.
Walsh, P.S., Metzger, D.A., Higuchi, R. (1991) Chelex 100 as a medium for simple extraction of DNA for PCR-based
typing form forensic material. Biotechniques, 10 (4), 506–513.
Yu, D.J., Zhang, G.M., Chen, Z.L., Zhang, R.J. & Yin, W.Y. (2004) Rapid identification of Bactrocera latifrons (Dipt.,

Zootaxa 2118 © 2009 Magnolia Press · 29
IDENTIFICATION OF WHITEFLY PESTS
Tephritidae) by real-time PCR using SYBR Green chemistry. Journal of Applied Entomology, 128, 670–676.
Zhu, K.Y. & Marshall, J. (1996) Addition of a competitive primer can dramatically improve the specificity of PCR
amplification of specific alleles. BioTechniques, 21, 586–590.