Tracking familial transmission of Kaposi's sarcoma-associated herpesvirus using restriction fragment length polymorphism analysis of latent nuclear antigen

Abstract

Intra-familial transmission of Kaposi's sarcoma associated herpesvirus (KSHV) is likely to occur in geographical regions where KSHV infection is highly endemic. Transmission has been studied previously indirectly using serological techniques, however direct documentation of specific transmission routes has yet to be reported. The internal repeat domain (IRD) of the KSHV opening reading frame (ORF) 73 was shown previously to exhibit restriction-fragment length polymorphism (RFLP). Analysis of such polymorphism was undertaken using nested ORF 73 IRD PCR products derived from the blood and mouth rinse samples of individuals in Malawian family groups. The resulting RFLP patterns were unique to an individual and could be compared between family members. In three of eight families studied, identical RFLP patterns were recovered from family members; in the remaining five families, dissimilar RFLP patterns were revealed. Results from RFLP analysis were compared to sequencing data recovered from family members for the first variable region of the hypervariable KSHV ORF K1. Patterns of intra- and extra-familial transmission inferred from ORF K1 sequencing data were corroborated mainly using ORF 73 IRD RFLP analysis.

Full text

Journal of Virological Methods 105 (2002) 297–303
Tracking familial transmission of Kaposi’s
sarcoma-associated herpesvirus using restriction fragment
length polymorphism analysis of latent nuclear antigen
R.D. Cook
a,b,
*, T.A. Hodgson
a
, E.M. Molyneux
c
, E. Borgstein
d
,
S.R. Porter
a
, C.G. Teo
b
a
Department of Oral Medicine,Eastman Dental Institute for Oral Health Care Sciences,Uni6ersity College London,London,UK
b
Central Public Health Laboratory,Virus Reference Di6ision,
61
Colindale A6enue,London NW
95
HT,UK
c
Department of Paediatrics,College of Medicine,Uni6ersity of Blantyre,Blantyre,Malawi
d
Department of Surgery,College of Medicine,Uni6ersity of Blantyre,Blantyre,Malawi
Received 13 February 2002; received in revised form 27 May 2002; accepted 28 May 2002
Abstract
Intra-familial transmission of Kaposi’s sarcoma associated herpesvirus (KSHV) is likely to occur in geographical
regions where KSHV infection is highly endemic. Transmission has been studied previously indirectly using
serological techniques, however direct documentation of specific transmission routes has yet to be reported. The
internal repeat domain (IRD) of the KSHV opening reading frame (ORF) 73 was shown previously to exhibit
restriction-fragment length polymorphism (RFLP). Analysis of such polymorphism was undertaken using nested
ORF 73 IRD PCR products derived from the blood and mouth rinse samples of individuals in Malawian family
groups. The resulting RFLP patterns were unique to an individual and could be compared between family members.
In three of eight families studied, identical RFLP patterns were recovered from family members; in the remaining five
families, dissimilar RFLP patterns were revealed. Results from RFLP analysis were compared to sequencing data
recovered from family members for the first variable region of the hypervariable KSHV ORF K1. Patterns of intra-
and extra-familial transmission inferred from ORF K1 sequencing data were corroborated mainly using ORF 73 IRD
RFLP analysis. © 2002 Elsevier Science B.V. All rights reserved.
Keywords
:
Kaposi’s sarcoma associated herpesvirus; Restriction fragment length polymorphism; Familial transmission; Oral
www.elsevier.com/locate/jviromet
1. Introduction
Kaposi’s sarcoma associated herpesvirus
(KSHV) is linked causally to all epidemiological
forms of Kaposi’s sarcoma (KS) (Boshoff and
Weiss, 2001). The prevalence of KSHV infection,
as measured by serology, is low in North America
* Corresponding author. Tel.: +44-208-200-4400x3234; fax:
+44-208-200-1569
E-mail address
:
rck@phls.org.uk (R.D. Cook).
0166-0934/02/$ - see front matter © 2002 Elsevier Science B.V. All rights reserved.
PII: S0166-0934(02)00123-4

R.D.Cook et al.
/
Journal of Virological Methods
105 (2002) 297–303
298
and Europe, where 0–5% of blood donor groups
are KSHV-antibody positive (Gao et al., 1996;
Simpson et al., 1996). However, in areas of sub-
Saharan Africa, KSHV sero-prevalence levels of
50% or greater have been reported previously
(Gao et al., 1996; Sitas et al., 1999; Rezza et al.,
2000).
Sexual transmission of KSHV is implicated
among homosexual men in North America and
Europe (Martin et al., 1998; Blackbourn et al.,
1999; Dukers et al., 2000), in whom the incidence
of Kaposi’s sarcoma and the prevalence of KSHV
infection is higher (Beral et al., 1990; Gao et al.,
1996; Kedes et al., 1996; Simpson et al., 1996)
than the general population. In Africa, where
KSHV infection in children is common and where
KSHV sero-prevalence increases with age (Olsen
et al., 1998; Gessain et al., 1999; Rezza et al.,
2000) non-sexual transmission of KSHV within
the family is suspected to occur (Bourboulia et al.,
1998; Gessain et al., 1999; Sitas et al., 1999;
Plancoulaine et al., 2000). The vehicle for such
non-sexual transmission is likely to be oral fluids
as KSHV DNA has been detected in both the oral
mucosa (Pauk et al., 2000) and saliva (Koelle et
al., 1997).
Despite multiple serological studies, direct evi-
dence of KSHV transmission has not been
demonstrated. KSHV DNA sequence analysis can
determine viral subtype (Zong et al., 2002), but
the methods involved are time consuming. Re-
cently, a rapid restriction fragment length poly-
morphism analysis of KSHV derived PCR
products (PCR-RFLP) was reported (Zhang et
al., 2000). PCR-RFLP targets the internal repeat
domain (IRD) of KSHV opening reading frame
(ORF) 73, a region of significant polymorphism
which encodes the latent nuclear antigen (Rain-
bow et al., 1997). Numerous point mutations and
deletions concentrated mainly in the second of
three repeat domains in the ORF 73 IRD result in
size and sequence polymorphism. The objective of
this study was to analyse samples from patients
with Kaposi’s sarcoma and their family members
from Malawi to determine whether PCR-RFLP
subtyping could be applied to study familial trans-
mission of KSHV.
2. Materials and methods
2
.
1
.Study group
Twenty-two patients attending the Central Hos-
pital, Blantyre, Malawi with cutaneous or oral
mucosal Kaposi’s sarcoma screened to be sero-
positive for KSHV by an immunofluorescence
assay (IFA) (Advanced Biotechnologies Incorpo-
rated, MD) were selected as the index cases. A
further 67 family members of the index cases
without Kaposi’s sarcoma were invited to join the
study. Following informed consent from each
member of the study group, venous blood and
mouth rinses were obtained.
2
.
2
.DNA extraction
DNA was extracted from the immunomagneti-
cally selected CD45+leukocyte fraction of blood
samples as described previously (Leao et al.,
2000). DNA was extracted from the mouth rinse
samples using a guanidium thiocyanate-silica pro-
cedure (Boom et al., 1990).
2
.
3
.KSHV IRD PCR
PCR amplification of the IRD region of ORF
73 was carried out as described previously (Zhang
et al., 2000) with one minor variation. In each
single round PCR reaction, 2 U of Platinum Taq
DNA polymerase (Invitrogen, Paisley, UK) was
used instead of 1 U to ensure a consistently
positive PCR result.
Using the single round PCR described above,
none or too little PCR product was occasionally
generated from our samples. To increase the sen-
sitivity of PCR detection, a nested PCR was
developed, using as outer primers IRD1-F 5%
ACGCCAACCGCCTACATCT 3%and IRD1-R
5%TCATGTGTGCTAACAACAGG 3%and the
original single round primers described by Zhang
et al. (2000) as second round primers. Both
rounds of PCR were carried out in a 25 ml reac-
tion mixture containing 2 ml extracted DNA, 1.25
U Platinum Taq DNA polymerase, 100 mM each
dNTP, 50 pM each primer, 1.5 mM MgCl
2
,50
mM KCl, 20 mM Tris–HCl (pH 8.4) and 2 ×

R.D.Cook et al.
/
Journal of Virological Methods
105 (2002) 297–303
299
PCRx enhancer solution (Invitrogen, UK). Ther-
mocycling conditions were as previously described
(Zhang et al., 2000). All samples negative after
single round PCR were repeated using the nested
PCR procedure.
2
.
4
.Nested IRD PCR optimisation
Initially nested PCR using the same conditions
as described for single round PCR resulted in high
molecular weight smearing instead of the expected
nested product. Various strategies to clarify the
second round product included reduced primer
concentration, 25 vs. 35 rounds of thermocycling
in the second round of PCR, titration of key
reagents and reduction in the amount of Taq
polymerase used. A clear second round product
could be visualised after titration of the PCRx
enhancer solution supplied with Platinum Taq
polymerase. Using this reagent at a 2×concentra-
tion in both rounds of PCR yielded a specific
product of the correct size when applied to a
KSHV infected BC-1 cell line extract.
When nested PCR was applied to patient sam-
ples, a non-specific or smeared second round
product was occasionally observed. Dilution of
the first round product 10- to 20-fold resulted in a
specific second round product in these cases. In
some cases, reducing the number of thermocycling
rounds to 25 improved second round PCR results.
2
.
5
.RFLP
For the RFLP, PCR products generated by
single or nested PCR were digested for 90 min at
37 °C with BanII and MboI restriction enzymes
followed by 30 min at 85 °C to inactivate the
enzymes. RFLP products were visualised with
ethidium bromide using UV transillumination af-
ter electrophoresis through a 1.5% agarose gel.
3. Results and discussion
Based on sequencing data from KSHV infected
BC-1 and PK-1 cell lines, Zhang et al. (2000)
characterised four possible RFLP subtypes; dele-
tions in the IRD resulting in the loss of expected
restriction sites created the different RFLP pat-
terns. Thus, in the KSHV IRD of the BC-1 cell
line, there are five possible BanII restriction sites
resulting in three bands that can be visualised and
one MboI restriction site resulting in two visible
bands. Subtype 1 samples have an IRD with both
BanII and MboI restriction sites, resulting in
bands of 655, 476/457 and 192 bp in length.
Subtype 2 samples have at least two BanII sites
but no MboI site, resulting in three visible bands
at :1121, 457 and 192 bp. There is only one
BanII site in subtype 3 samples, resulting in two
bands at 1131 and 457 bp, while subtype 4 has
one of each restriction site, resulting in three
visible bands with the 192-bp band missing.
Previously, no correlation has been demon-
strated between these four RFLP subtypes and
the previously described KSHV subtypes (A–C)
based on sequencing of the KS330 fragment of
ORF 26 (Zhang et al., 2000). ORF K1 sequencing
revealed that the Malawian KSHV samples be-
long to either the A5 or B1 subtype (Cook et al.,
2002). No correlation was found between these
two ORF K1 subtypes and the RFLP subtypes 2
and 3 recovered in this sample group (Table 1).
Zhang et al. (2000) found that RFLP patterns
from multifocal Kaposi’s sarcoma lesions in a
single patient were invariant. This study of
Malawian individuals identified one patient with
Kaposi’s sarcoma, K
i
, from whom KSHV DNA
could be amplified in both blood and mouth rinse
samples. In this patient, the two samples revealed
an identical RFLP pattern, indicating that the
same KSHV variant is carried in both the blood
and the oral compartments. However, samples
from only one subject were available for this
analysis and the findings should be interpreted
with caution.
It was possible to compare RFLP patterns be-
tween two or more family members in eight of the
family groups. Five additional samples with no
matching family members were also included in
the RFLP analysis to determine the overall distri-
bution of subtypes present in this population. The
results of the single round or nested PCR to
amplify the IRD region of ORF 73 are shown in
Fig. 1. The previously described KSHV nuclear
antigen typing (KVNA typing) procedure (Gao et

R.D.Cook et al.
/
Journal of Virological Methods
105 (2002) 297–303
300
al., 1999) could be applied directly to these sam-
ples and we detected size polymorphism in the
IRD between samples in families B, G and W.
However, the IRD products for all other families
appeared identical.
RFLP analysis of all samples is represented in
Fig. 2. Distinct RFLP patterns could be differen-
tiated in the samples from Malawian individuals,
allowing us to make comparisons between family
members. In four families (A, E, H, K) identical
RFLP patterns were present suggesting familial
transmission of KSHV had occurred in these fam-
ily groups. In families A and K, identical RFLP
results were found between a mother (A1/K
i
)and
her children, a son (A2/K
1
) and daughter (A
i
).
Identity could also be found between siblings;
brothers E6 and H2 carried the same RFLP pat-
terns as their corresponding sisters, E2 and H1.
In families B, G, E, T and W, non-identical
RFLP patterns were discovered. In two of these
families (T and G), subtypes 2 and 3 existed in
each family, while in families B, E and W, all
samples were of the same subtype but with differ-
ing RFLP band sizes. Studied in family B were
Table 1
Characteristics of the patients with Kaposi’s sarcoma and family members involved in the study
Kaposi’s sarcomaIndividual Relationship PCR-RFLPAge/sex ORF K1
(Yes/No) subtypegenotype
2Yes Daughter 7y/FBA
i
(blood)
2No Mother 34y/FN/A*A1
2N/A*No 10y/MA2 Son
B1 2NoB3 Brother 12y/M
No BrotherB5 7y/MB1 2
No SisterE4 6y/FB1 3
3No Brother 13y/MB1E5
No BrotherE6 10y/MB1 3
E2 No Sister 9y/FN/A* 3
G1 2A532y/MFatherNo
323y/MA5SonNoG2
G
i
(blood) 3Yes Mother 34y/FN/A*
No SisterH1 13y/F3N/A*
N/A* 3BrotherH2 12y/MNo
A5K
i
,K
i
(blood) 30y/FMother 2Yes
SonNoK1 12y/MA5 2
T2 3No Brother 11y/MB1
No Brother 9y/MT3 B1 2
3B120y/MW2 BrotherNo
No Sister 13y/FW4 B1 3
C
i
Yes Son 8y/MB1 3
D1 No Daughter 18/FA5 2
2N/A*30y/MP
i
FatherYes
No 3Father 44y/MX1 B1
No A5Z2 22y/FMother 2
All samples are derived from mouth rinses unless otherwise noted. ORF K1 genotype assignments were determined by sequence
alignment with sequences of known subtype deposited in GenBank and by the presence of characteristic amino acid motifs in the
VR1 and VR2 region of ORF K1 (Zong et al., 1999, 2002). PCR-RFLP subtype assignment was as determined by Zhang et al.
(2000).
* Denotes ORF K1 DNA could not be amplified from these samples (Cook et al., 2002).

R.D.Cook et al.
/
Journal of Virological Methods
105 (2002) 297–303
301
Fig. 1. ORF 73 IRD PCR results from (A) samples A1–H2
and (B) samples K
i
–P
i
. Lanes marked BL correspond to blank
lanes. Samples were amplified using either single round or
nested PCR and were visualised on a 1% agarose gel alongside
a 1 Kb DNA marker.
KSHV DNA could not be amplified (Cook et al.,
2002) it cannot be determined whether or not they
were infected by other family members. However,
a comparison could be made between previously
obtained sequencing data (Cook et al., 2002) from
the first variable region of the hypervariable ORF
K1 and RFLP patterns for six of the eight
families in this study (B, E, G, K, T, W). RFLP
analysis corroborated with ORF K1 sequence
identity found in families E and K and non-iden-
tity found in families B, E, T and W. Previous
evidence of ORF K1 sequence identity was not
confirmed in family G by RFLP (Fig. 2).
In all families except family G and W (W2), the
children were 13 years of age or younger, consis-
tent with KSHV acquisition through a non-sexual
route. In Africa, where the predominant mode of
KSHV transmission is non-sexual, saliva is likely
to be an important vehicle. Saliva has been de-
tected at high titre in American homosexual men
with and without Kaposi’s sarcoma (Koelle et al.,
1997) and in mouth rinses from Zimbabwean
women with Kaposi’s sarcoma (Lampinen et al.,
2000). Of the samples included in this study, 23 of
26 were mouth rinses and all but three of these
were derived from family members without Kapo-
si’s sarcoma. The PCR-RFLP assay was able to
reveal size and sequence polymorphism in these
mouth rinse samples from individuals without
Kaposi’s sarcoma. Subtyping through such a
PCR-RFLP approach should enable KSHV trans-
mission in other endemic populations to be simi-
larly studied.
Acknowledgements
We thank S.-J. Gao of the University of Texas,
Health Science Center for helpful comments con-
cerning this study and A.C.W. Waugh for assis-
tance in the collection and processing of clinical
samples. Ethical approval was obtained prior to
commencing this study from Eastman Dental In-
stitute (UK), University College London (UK)
and the University of Malawi. This work was
supported by Grant DE12176-03 from the Na-
tional Institute of Health.
brothers (B3 and B5), in family T, brothers (T2
and T3), in family E, a sister (E4) and her broth-
ers (E2, E5 and E6), and in family G, a father
(G1), a mother (G) and their son (G2). In family
E, RFLP patterns from siblings E4 and E5 dif-
fered not only from each other, but also from
those of their siblings E2 and E6.
The dissimilar RFLP patterns recovered from
each of these family members indicates that they
may not have acquired KSHV from each other.
Nevertheless, as the subjects studied here were
part of a larger immediate family from whom
Fig. 2. PCR-RFLP analysis of the ORF 73 IRD PCR prod-
ucts from (A) samples A1–H2 and (B) samples K
i
–P
i
. PCR-
RFLP subtype assignments are indicated beneath each lane.
Lanes marked BL correspond to blank lanes. Samples were
digested using MboIandBanII restriction enzymes and visu-
alised on a 1.5% agarose gel alongside a 100 bp ladder DNA
marker to estimate fragment size.

R.D.Cook et al.
/
Journal of Virological Methods
105 (2002) 297–303
302
References
Beral, V., Peterman, T.A., Berkelman, R.L., Jaffe, H.W., 1990.
Kaposi’s sarcoma among persons with AIDS: a sexually
transmitted infection? Lancet 335, 123–128.
Blackbourn, D.J., Osmond, D., Levy, J.A., Lennette, E.T.,
1999. Increased human herpesvirus 8 seroprevalence in
young homosexual men who have multiple sex contacts
with different partners. J. Infect. Dis. 179, 237–239.
Boom, R., Sol, C.J., Salimans, M.M., Jansen, C.L., Wertheim-
van Dillen, P.M., van der, N.J., 1990. Rapid and simple
method for purification of nucleic acids. J. Clin. Microbiol.
28, 495–503.
Boshoff, C., Weiss, R.A., 2001. Epidemiology and pathogene-
sis of Kaposi’s sarcoma-associated herpesvirus. Phil.
Trans. R. Soc. Lond. B. Biol. Sci. 356, 517–534.
Bourboulia, D., Whitby, D., Boshoff, C., Newton, R., Beral,
V., Carrara, H., Lane, A., Sitas, F., 1998. Serologic evi-
dence for mother-to-child transmission of Kaposi sarcoma-
associated herpesvirus infection. J. Am. Med. Assoc. 280,
31–32.
Cook, R.D., Hodgson, T.A., Waugh, A.C.W., Molyneux,
E.M., Borgstein, E., Sherry, A., Teo, C.G., Porter, S.R.,
2002. Mixed patterns of transmission of human her-
pesvirus-8 (Kaposi’s sarcoma associated herpesvirus) in
Malawian families. J. Gen. Virol. 83, 1613–1619.
Dukers, N.H., Renwick, N., Prins, M., Geskus, R.B., Schulz,
T.F., Weverling, G.J., Coutinho, R.A., Goudsmit, J., 2000.
Risk factors for human herpesvirus 8 seropositivity and
seroconversion in a cohort of homosexual men. Am. J.
Epidemiol. 151, 213–224.
Gao, S.J., Kingsley, L., Li, M., Zheng, W., Parravicini, C.,
Ziegler, J., Newton, R., Rinaldo, C.R., Saah, A., Phair, J.,
Detels, R., Chang, Y., Moore, P.S., 1996. KSHV antibod-
ies among Americans, Italians and Ugandans with and
without Kaposi’s sarcoma. Nat. Med. 2, 925–928.
Gao, S.J., Zhang, Y.J., Deng, J.H., Rabkin, C.S., Flore, O.,
Jenson, H.B., 1999. Molecular polymorphism of Kaposi’s
sarcoma-associated herpesvirus (Human herpesvirus 8) la-
tent nuclear antigen: evidence for a large repertoire of viral
genotypes and dual infection with different viral genotypes.
J. Infect. Dis. 180, 1466–1476.
Gessain, A., Mauclere, P., van Beveren, M., Plancoulaine, S.,
Ayouba, A., Essame-Oyono, J.L., Martin, P.M., de The,
G., 1999. Human herpesvirus 8 primary infection occurs
during childhood in Cameroon, Central Africa. Int. J.
Cancer 81, 189–192.
Kedes, D.H., Operskalski, E., Busch, M., Kohn, R., Flood, J.,
Ganem, D., 1996. The seroepidemiology of human her-
pesvirus 8 (Kaposi’s sarcoma-associated herpesvirus): dis-
tribution of infection in KS risk groups and evidence for
sexual transmission. Nat. Med. 2, 918–924.
Koelle, D.M., Huang, M.L., Chandran, B., Vieira, J., Piep-
korn, M., Corey, L., 1997. Frequent detection of Kaposi’s
sarcoma-associated herpesvirus (human herpesvirus 8)
DNA in saliva of human immunodeficiency virus-infected
men: clinical and immunologic correlates. J. Infect. Dis.
176, 94–102.
Lampinen, T.M., Kulasingam, S., Min, J., Borok, M.,
Gwanzura, L., Lamb, J., Mahomed, K., Woelk, G.B.,
Strand, K.B., Bosch, M.L., Edelman, D.C., Constantine,
N.T., Katzenstein, D., Williams, M.A., 2000. Detection of
Kaposi’s sarcoma-associated herpesvirus in oral and geni-
tal secretions of Zimbabwean women. J. Infect. Dis. 181,
1785–1790.
Leao, J.C., Kumar, N., McLean, K.A., Porter, S.R., Scully,
C.M., Swan, A.V., Teo, C.G., 2000. Effect of human
immunodeficiency virus-1 protease inhibitors on the clear-
ance of human herpesvirus 8 from blood of human im-
munodeficiency virus-1-infected patients. J. Med. Virol. 62,
416–420.
Martin, J.N., Ganem, D.E., Osmond, D.H., Page-Shafer,
K.A., Macrae, D., Kedes, D.H., 1998. Sexual transmission
and the natural history of human herpesvirus 8 infection.
New Engl. J. Med. 338, 948–954.
Olsen, S.J., Chang, Y., Moore, P.S., Biggar, R.J., Melbye, M.,
1998. Increasing Kaposi’s sarcoma-associated herpesvirus
seroprevalence with age in a highly Kaposi’s sarcoma
endemic region, Zambia in 1985. AIDS 12, 1921–1925.
Pauk, J., Huang, M.L., Brodie, S.J., Wald, A., Koelle, D.M.,
Schacker, T., Celum, C., Selke, S., Corey, L., 2000. Mu-
cosal shedding of human herpesvirus 8 in men. New Engl.
J. Med. 343, 1369–1377.
Plancoulaine, S., Abel, L., van Beveren, M., Tregouet, D.A.,
Joubert, M., Tortevoye, P., de The, G., Gessain, A., 2000.
Human herpesvirus 8 transmission from mother to child
and between siblings in an endemic population. Lancet
356, 1062–1065.
Rainbow, L., Platt, G.M., Simpson, G.R., Sarid, R., Gao,
S.J., Stoiber, H., Herrington, C.S., Moore, P.S., Schulz,
T.F., 1997. The 222- to 234-kilodalton latent nuclear
protein (LNA) of Kaposi’s sarcoma-associated herpesvirus
(human herpesvirus 8) is encoded by orf73 and is a compo-
nent of the latency-associated nuclear antigen. J. Virol. 71,
5915–5921.
Rezza, G., Tchangmena, O.B., Andreoni, M., Bugarini, R.,
Toma, L., Bakary, D.K., Glikoutou, M., Sarmati, L.,
Monini, P., Pezzotti, P., Ensoli, B., 2000. Prevalence and
risk factors for human herpesvirus 8 infection in northern
Cameroon. Sex. Transm. Dis. 27, 159–164.
Simpson, G.R., Schulz, T.F., Whitby, D., Cook, P.M.,
Boshoff, C., Rainbow, L., Howard, M.R., Gao, S.J., Bo-
henzky, R.A., Simmonds, P., Lee, C., de Ruiter, A., Hatza-
kis, A., Tedder, R.S., Weller, I.V., Weiss, R.A., Moore,
P.S., 1996. Prevalence of Kaposi’s sarcoma associated her-
pesvirus infection measured by antibodies to recombinant
capsid protein and latent immunofluorescence antigen.
Lancet 348, 1133–1138.
Sitas, F., Carrara, H., Beral, V., Newton, R., Reeves, G., Bull,
D., Jentsch, U., Pacella-Norman, R., Bourboulia, D.,
Whitby, D., Boshoff, C., Weiss, R., 1999. Antibodies
against human herpesvirus 8 in black South African pa-
tients with cancer. New Engl. J. Med. 340, 1863–1871.
Zhang, Y.J., Deng, J.H., Rabkin, C., Gao, S.J., 2000. Hot-
spot variations of Kaposi’s sarcoma-associated herpesvirus

R.D.Cook et al.
/
Journal of Virological Methods
105 (2002) 297–303
303
latent nuclear antigen and application in genotyping by
PCR-RFLP. J. Gen. Virol. 81, 2049–2058.
Zong, J.C., Ciufo, D.M., Alcendor, D.J., Wan, X., Nicholas,
J., Browning, P.J., Rady, P.L., Tyring, S.K., Orenstein,
J.M., Rabkin, C.S., Su, I.J., Powell, K.F., Croxson, M.,
Foreman, K.E., Nickoloff, B.J., Alkan, S., Hayward, G.S.,
1999. High-level variability in the ORF-K1 membrane
protein gene at the left end of the Kaposi’s sarcoma-associ-
ated herpesvirus genome defines four major virus subtypes
and multiple variants or clades in different human popula-
tions. J. Virol. 73, 4156–4170.
Zong, J., Ciufo, D.M., Viscidi, R., Alagiozoglou, L., Tyring,
S., Rady, P., Orenstein, J., Boto, W., Kalumbuja, H.,
Romano, N., Melbye, M., Kang, G.H., Boshoff, C., Hay-
ward, G.S., 2002. Genotypic analysis at multiple loci
across Kaposi’s sarcoma herpesvirus (KSHV) DNA
molecules: clustering patterns, novel variants and
chimerism. J. Clin. Virol. 23, 119–148.