Content uploaded by Catherine Hélias
Author content
All content in this area was uploaded by Catherine Hélias on Apr 22, 2014
Content may be subject to copyright.
ORIGINAL ARTICLE
Acute myeloid leukaemia with 8p11 (MYST3) rearrangement: an integrated cytologic,
cytogenetic and molecular study by the groupe francophone de cytoge
´
ne
´
tique
he
´
matologique
C Gervais
1,18
, A Murati
2,18
, C Helias
1
, S Struski
1
, A Eischen
1
, E Lippert
3
, I Tigaud
4
, D Penther
5
, C Bastard
5
, F Mugneret
6
, B Poppe
7
,
F Speleman
7
, P Talmant
8
, J VanDen Akker
9
, L Baranger
10
, C Barin
11
, I Luquet
12
, N Nadal
13
, F Nguyen-Khac
14
, O Maarek
15
,
C Herens
16
, D Sainty
2
, G Flandrin
17
, D Birnbaum
2
, M-J Mozziconacci
2
and M Lessard
1
1
Laboratoire d’He
´
matologie, CHU de Hautepierre, Strasbourg, France;
2
Institut Paoli-Calmettes, Centre de Recherche en
Cance
´
rologie, Marseille, France;
3
Laboratoire d’He
´
matologie, Ho
ˆ
pital Cardiologique- Haut Le
´
ve
ˆ
que, Bordeaux, France;
4
Laboratoire d’He
´
matologie, CHU Lyon Sud, Lyon, France;
5
De
´
partement de Ge
´
ne
´
tique, Centre Henri Becquerel, Rouen, France;
6
Laboratoire de Cytoge
´
ne
´
tique, CHU du Bocage, Dijon, France;
7
Centrum Medische Genetica, Gent, Belgique;
8
Laboratoire
d’He
´
matologie, CHU Ho
ˆ
tel-Dieu, Nantes, France;
9
Laboratoire de Cytoge
´
ne
´
tique, Ho
ˆ
pital Saint-Antoine, Paris, France;
10
Laboratoire de Ge
´
ne
´
tique, CHU, Angers, France;
11
Service de Ge
´
ne
´
tique, Ho
ˆ
pital Bretonneau, Tours, France;
12
Service de
Ge
´
ne
´
tique, Ho
ˆ
pital Maison Blanche, Reims, France;
13
Laboratoire d’He
´
matologie, Ho
ˆ
pital Nord, Saint-E
´
tienne, France;
14
Laboratoire d’He
´
matologie, Ho
ˆ
pital Pitie
´
-Salpe
ˆ
trie
`
re, Paris, France;
15
Laboraoire d’He
´
matologie, Ho
ˆ
pital Saint-Louis, Paris,
France;
16
Service de ge
´
ne
´
tique humaine, CHU Sart Tilman, Lie
`
ge, Belgique and
17
Laboratoire d’He
´
matologie, Ho
ˆ
pital Necker,
Paris, France
Thirty cases of acute myeloid leukaemia (AML) with MYST
histone acetyltransferase 3 (MYST3) rearrangement were col-
lected in a retrospective study from 14 centres in France and
Belgium. The mean age at diagnosis was 59.4 years and 67% of
the patients were females. Most cases (77%) were secondary to
solid cancer (57%), haematological malignancy (35%) or both
(8%), and appeared 25 months after the primary disease.
Clinically, cutaneous localization and disseminated intra-
vascular coagulation were present in 30 and 40% of the cases,
respectively. AMLs were myelomonocytic (7%) or monocytic
(93%), with erythrophagocytosis (75%) and cytoplasmic
vacuoles (75%). Immunophenotype showed no particularity
compared with monocytic leukaemia without MYST3
abnormality. Twenty-eight cases carried t(8;16)(p11;p13) with
MYST3-CREBBP fusion, one case carried a variant
t(8;22)(p11;q13) and one case carried a t(8;19)(p11;q13). Type I
(MYST3 exon 16-CREBBP exon 3) was the most frequent
MYST3-CREBBP fusion transcript (65%). MYST3 rearrangement
was associated with a poor prognosis, as 50% of patients
deceased during the first 10 months. All those particular
clinical, cytologic, cytogenetic, molecular and prognostic
characteristics of AML with MYST3 rearrangement may have
allowed an individualization into the World Health Organization
classification.
Leukemia (2008) 22, 1567–1575; doi:10.1038/leu.2008.128;
published online 5 June 2008
Keywords: AML; MYST3; t(8;16)(p11;p13)
Introduction
The t(8;16)(p11;p13) is a rare translocation (o1% of acute
myeloid leukaemia (AML)) involved in de novo and therapy-
related myelomonocytic and monocytic acute leukaemia
(French-American-British co-operative group (FAB) AML-M4,
-M5a and -M5b).
1,2
This abnormality is described at any age and
in both sexes. Extramedullary involvement, such as skin or
visceral infiltrates, is frequent. Disseminated intravascular
coagulation is classically observed.
3
Cytology is particular with
a noticeable erythrophagocytosis. Phenotypic studies often
show CD34/CD56 þ blasts.
4
The prognosis of the disease
is poor.
The gene involved in 8p11 is MOZ (monocytic leukeamia
zinc finger), currently named MYST3 (MYST histone acetyl-
transferase 3),
5
composed of 17 exons. The MYST3 protein is
localized in the nucleus, has an histone acetyltransferase activity
and acts as a transcriptional regulator.
6
The most frequent
MYST3 partner gene is CREBBP (CREB-binding protein) in
16p13.
5
The CREBBP protein is widely expressed, localized in
the nucleus and plays a transcription regulatory role by
interaction with the DNA-binding protein CREB.
5
Like MYST3,
CREBBP has an histone acetyltransferase activity and is essential
in embryogenesis, cell differentiation, apoptosis and prolifera-
tion.
7
Alternative translocations of the t(8;16)(p11;p13) have
been reported in few cases, all involving MYST3. The
t(8;19)(p11;q13)
8
has no identified MYST3 partner gene;
the t(8;22)(p11;q13)
9
leads to MYST3-EP300 fusion;
10
the inv(8)(p11q13)
11
to MYST3-NCOA2 fusion
12
and the
t(8;20)(p11;q13) to MYST3-NCOA3 fusion.
13
Symptoms and cytology of AML with MYST3 rearrangement
are easily distinguished from the other haematological malig-
nancy associated with 8p abnormality and involving the FGFR1
gene (Fibroblast Growth Factor Receptor 1), which is observed
in myeloproliferative disorders and/or mixed T-lymphoma/
myeloproliferative disorders.
Translocations involving MYST3 have been described in
several reports, but the study of a consequent series of
patients has not been done because of the rarity of this
abnormality. Here, we describe a multicentric series of
30 cases of MYST3-linked AML. Our objective was to define
the most frequent and relevant characteristics of this AML,
which seems to define a singular entity by its clinical, cytologic,
cytogenetic, molecular and prognostic presentation.
Received 23 January 2008; revised 18 April 2008; accepted 24 April
2008; published online 5 June 2008
Correspondence: Dr C Gervais, Laboratoire d’He
´
matologie, Ho
ˆ
pital
de Hautepierre, Avenue Molie
`
re, Strasbourg 67098, France.
E-mail: carine.gervais@chru-strasbourg.fr and
Dr M-J Mozziconacci, De
´
partements d’Oncologie Mole
´
culaire et de
Biopathologie, Institut Paoli-Calmettes, Centre de Recherche en
Cance
´
rologie de Marseille, 232 Boulevard de Sainte-Marguerite,
Marseille 13009, France.
E-mail: mozziconaccimj@marseille.fnclcc.fr
18
These authors contributed equally to this work.
Leukemia (2008) 22, 1567–1575
& 2008 Macmillan Publishers Limited All rights reserved 0887-6924/08 $30.00
www.nature.com/leu
Materials and methods
Patients
Fourteen centres in France and Belgium participated in the
groupe francophone de cytoge
´
ne
´
tique he
´
matologique (GFCH)
study, which included 30 cases (Table 1), on the basis of an
8p11 abnormality in de novo and therapy-related AML, and
excluding T-lymphoid disease or myeloproliferative disorders
with adenopathy (FGFR1 involvement). Cases 7 and 8 have
been already published.
14
Morphologic, cytochemic and immunophenotypic
analyses
All cases were reviewed by three cytologists (GF, AE and DS) to
give a homogeneous response to analysed criteria. Revision was
done in Strasbourg and Marseille (France) from blood- and bone
marrow-communicated slides and/or teletransmitted images. In
one case, (case 25), bone marrow aspiration was not done at
diagnosis. Diagnosis classification was made according to the
FAB
15
and World Health Organization
16
classifications including
morphologic (acute myelomonocytic leukaemia M4, acute
monoblastic leukaemia M5 with a majority of monoblasts M5a
or promonocytes M5b), cytochemical, immunophenotypic,
genetic and clinical features. We looked for the presence of
cytoplasmic vacuoles and erythrophagocytosis (Table 2). Cyto-
chemical analyses were reviewed (peroxidases and esterases)
and immunophenotypes established the monocytic differentia-
tion of blasts, when necessary.
Conventional cytogenetics
Blood and bone marrow cells were collected at diagnosis,
cultured for 24 and/or 48 h, and synchronized with fluorode-
oxyuridine
17
in most cases. (RHG) reverse heat Giemsa and/or
(GTG) G-banding with trypsin-Giemsa banding techniques were
used, depending on the centre. Karyotype was established
according to the International System for Human Cytogenetic
Nomenclature 2005.
18
All karyotypes were collegially reviewed
by members of the GFCH. Fluorescence in situ hybridization
(FISH) and molecular analyses were done on the retained cases
(Table 3).
Fluorescence in situ hybridization
Fluorescence in situ hybridization was done on the cytogenetic
pellets in all cases except 16 and 17, for which material was not
available. Except for case 8, all analyses were done in one
centre (Strasbourg). Probes used for chromosome band 8p11
exploration (MYST3) were from telomere to centromere,
Table 1 Characteristics of the 30 patients, previous malignancy and evolution
No. Sex/age (years) Previous malignancy (interval/treatment) Clinical DIC AML treatment Evolution (interval
from diagnosis)
1 M/78 CMML (13 m/TI) Fever, asthenia No No Dead (5 d)
2 M/82 CMML (13 m/TI) Splenomegaly No TI Lost of view (3 m)
3 F/45 Breast cancer (B29 m/Al, An, RT) Bone pains No IA, AM, AlloT Dead (10 m)
4 M/56 Lymphoma (14 m/Al, An, TI) Fever, asthenia Yes No Dead (6 d)
5 F/60 Breast cancer (?/RT) Mucosa localization Yes IA, AM Lost of view (1 m)
6 M/77 Prostate cancer (B45 m/RT)
and AML (16 m)
Cutaneous localization Yes IA, AM, An Relapse (17 m)
7 F/55 Breast cancer (27 m/RT) / No IA, AM, AutoT Remission (27 m)
8 M/72 de novo Adenopathy, hepatomegaly,
cutaneous localization,
fever, purpura
Yes IA, AM, An Dead (23 d)
9 F/47 Breast cancer (?/RT) Gingival hypertrophy Yes No Dead (22 d)
10 F/45 Breast cancer (17 m/RT) / No AM Dead (4 m)
11 F/41 de novo Adenopathy No IA, AM, Al Remission (24 m)
12 M/42 Testicle cancer (36 m/Al, TI) Gingival haemorrhage Yes No Dead (6 d)
13 F/46 Breast cancer (10 m/Al, An, RT) Cutaneous localization No IA, AM, IT Remission (48 m)
14 F/61 Breast cancer (B72 m/Al, An, RT) Cutaneous localization No IA, AM, An Remission (12 m)
15 F/63 de novo Cutaneous localization No IA, AM, An Remission (48 m)
16 M/31 de novo Cutaneous localization No AM, An Dead (3 m)
17 F/69 Breast cancer (?) / No Hu Lost of view (10 d)
18 F/65 de novo Cutaneous localization No IA, AM Relapse (3–4 m)
19 F/77 Lymphoma (20 m/Al, An),
breast cancer (20 m)
/ Yes Hu Dead (1 m)
20 F/70 Breast cancer (?/Al, An, RT) Hepatomegaly Yes IA, AM, Al Dead (7 m)
21 M/37 Testicle cancer (?/Al, TI, RT) Bone pains No AM, An, AutoT Remission (5 m)
22 F/64 CMML (24 m) Adenopathy, splenomegaly,
hepatomegaly
Yes AM, An, Hu No remission, still
alive (1.5 m)
23 F/15 ALL (48 m/RT) Bone pains No AM, Al Dead (3 m)
24 F/82 de novo / Yes Hu Lost of view (1 d)
25 F/77 MALT lymphoma (B30 m/Al, TI) Fever, asthenia No No Dead (6 d)
26 F/65 AML (10 m/AM, IA, Al) Splenomegaly, hepatomegaly,
cutaneous localization
Yes AM, Al, An Dead (2.5 m)
27 M/65 CMML (14 m/TI) Splenomegaly, hepatomegaly No AM, Hu Dead (5 m)
28 F/49 Breast cancer (?/Al, An, RT) Cutaneous localization No AM, An Dead (5 m)
29 M/76 de novo / Yes AM, An Remission (8 m)
30 F/69 Breast cancer (9 m/Al, RT) / No IA, AM, Al Remission (20 m)
Abbreviations: Al, alkylating treatment; ALL, acute lymphoid leukaemia; AlloT, allogenic transplantation; AM, antimetabolite; AML, acute myeloid
leukaemia; An, anthracycline; AutoT, autologous transplantation; CMML, chronic myelomonocytic leukaemia; d, day(s); DIC, disseminated
intravascular coagulation; Hu, hydroxyurea; IA, intercalating agent; m, month(s); RT, radiotherapy; TI, Topoisomerase II inhibitor.
Comprehensive study of MYST3-linked AML
C Gervais et al
1568
Leukemia
bacterial artificial chromosome (BAC) RP11-313J18 and RP11-
589C21 (only BAC RP11-313J18 for case 8), labelled with
SpectrumRed (Vysis, Downers Grove, IL, USA). For chromo-
some 16 exploration, BAC RP11-619A23 at 16p13 (CREBBP)
labelled with SpectrumGreen (Vysis) was used. In cases 27 and
29, BACs RP11-350N15 and RP11-513D5 were used to study
FGFR1 (8p11). For EP300 exploration at 22q13, BACs RP11-
12M9 (SpectrumRed), RP11-422A16 (SpectrumGreen) and
RP1-85F18 (SpectrumGreen) were used (case 27). BACs were
provided by the Sanger institute (Cambridge, UK). Multi-FISH
was performed (Metasystems, Altlusheim, Germany) to characterize
case 1 and 27 abnormalities.
Molecular analysis
RNA was obtained for 22 of the 30 patients. For patients 2, 9,
10, 14, 15, 22, 25 and 28, no material was available. Reverse
transcription PCR (RT-PCR) analyses were done on RNA
extracted by the Allprep DNA/RNA isolation kit (Qiagen,
Hilden, Germany) from blood or bone marrow blast cells of
patients and normal lymphocytes as negative control. The
human NMA gene (locus ID: 25805) was used to control
RT-PCR efficiency. Detection of MYST3-CREBBP and/or
CREBBP-MYST3 fusion transcripts was done as described:
14
an
RT-PCR for the detection of types I, II and III, completed by the
search for types IV and V if types I, II and III were absent. PCR
products were visualized on 2% agarose gel with ethidium
bromide. Primers are listed in Table 4.
Detection of type I (MYST3 exon 16-CREBBP exon 3), II
(MYST3 exon 16-CREBBP exon 4) and III (MYST3 exon
17-CREBBP exon 2 or exon 4) MYST3-CREBBP transcripts:
19,20
a nested PCR with primer combinations exon 16 MYST3_3536F/
exon 5 CREBBP_1201R and exon 16 MYST3_3558F/exon 3
CREBBP_404R amplified an B330- or an B1215-bp fragment
in type I and type III, respectively. PCR with primer combination
exon 16 MYST3_3536F/exon 5 CREBBP_1201R amplified an
B410-bp fragment in type II.
Detection of type IV (MYST3 exon 15-CREBBP exon 4) and V
(MYST3 exon 15-CREBBP exon 5) MYST3-CREBBP transcripts:
14
PCR with primer combination exon 15 MYST3_3319F/exon 5
CREBBP_1201R amplified an B350- or an B176-bp fragment
in type IV and type V, respectively.
Detection of the reciprocal CREBBP-MYST3 transcripts:
14,20
the reciprocal CREBBP-MYST3 fusion transcripts for the different
types were detected with nested PCR and primer combinations
exon 2 CREBBP_96F/exon 17 MYST3_3953R and exon 2
CREBBP_174F/exon 17 MYST3_3844R.
Results and discussion
According to the Mitelman database,
21
66 cases of t(8;16)
(p11;p13) have been described in the literature. Although the
largest series contained only five cases, our series includes 30
cases. The t(8;16)(p11;p13) was previously described in o1% in
AML. Female patients represented 67% of our series (20/30
cases), in contrast with previous studies in which both sexes
were equally represented.
6
Children and young adults were a
minority, with a mean age for both sexes of 59.4 years (range
15–82). One patient was 15 years old, nine patients were from
30 to 49 years old, 11 from 50 to 69 years old and nine more
than 70 years old. Three cases of congenital AML with
t(8;16)(p11;p13) have been described,
22,23
but none was
included in our series.
Table 2 Morphological characteristics of the 30 patients
No. Hb (g per 100 ml) Plt (10
9
/l) WBC (10
9
/l) Diagnostic (FAB) Cytoplasmic
vacuoles
Erythrophago-
cytosis
Pox Est
1 12.5 42 63 M4 +++ + 0 ++
2 9.9 29 50.3 M5b +++ +/ 0 +++
3 9.4 102 23.5 M5a + 0 +++ +++
4 8.8 39 10.1 M5 necrosis / / / /
5 8.7 114 85.6 M5a + +/ ND ND
6 13.4 55 112 M5b + 0 ND ND
7 8.8 41 2.9 M5b + ++ ND ND
8 9.8 77 51.3 M5b + ++ ND ND
9 12.1 50 23.5 M5b + ++ ND ND
10 8.8 47 1.5 M5a ++ ++ 0 +++
11 8.3 109 8.45 M5a + +/ ND ND
12 11.9 20.5 4.2 M5a 0 +/ +++ ND
13 12.5 31 3.22 M5b + ++ ND ND
14 10.9 147 3.5 M5a 0 0 +++ +++
15 13.8 338 5.9 M5b 0 0 0 +++
16 6.8 17 12.83 M5a + 0 ND ND
17 11.1 115 6.9 M5a + + ND ND
18 14.5 112 4.4 M5a + + ND ND
19 7.4 48 23.8 M5a 0 + +++ +++
20 8.7 33 16.1 M5a + ++ ND ND
21 13.1 161 3.3 M5a + + ND ND
22 9.2 375 87.1 M4 0 0 ND ND
23 14.2 34 5.6 M5a + + ND ND
24 11.4 77 16 M5b 0 0 ND +
25 7.9 14 7.35 ND ND ND ND ND
26 10.8 34 41 M5a 0 + ND ND
27 10.1 14 13.1 M5a + + 0 +++
28 10.8 53 5.4 M5a ++ +++ ND ND
29 8.6 67 2.5 M5a + ++ ND ND
30 9.4 50 31.8 M5b +++ + ND ND
Abbreviations: Est, esterase activity; Hb, haemoglobin; ND, not done; Plt, platelets; Pox, peroxidase activity; WBC, white blood cell count.
Comprehensive study of MYST3-linked AML
C Gervais et al
1569
Leukemia
Clinical features
At the time of AML diagnosis, nine patients had cutaneous
localization (30%), five hepatomegaly, four splenomegaly, three
adenopathy, three bone pains, one mucosa localization and one
gingival hypertrophy. Cutaneous infiltrates are typical but not
specific to this disorder as they are observed in AML-M4 or -M5
without t(8;16). Disseminated intravascular coagulation was
present in 12 patients (40%).
Only seven AML from our series were de novo, and 23
patients (76.7%) had a previous history of solid tumour and/or
haematological malignancy before the appearance of AML: 12
breast cancers, four chronic myelomonocytic leukaemias
(CMMLs), three lymphomas, two AMLs, one acute lymphoid
leukaemia, two testicle cancers and one prostate cancer
(Table 1). Two patients (cases 6 and 19) had two malignant
diseases during the previous years. The mean time between the
Table 3 Karyotype of the 30 cases, FISH results and type of fusion transcripts in the 22 patients tested by RT-PCR
No. Karyotype FISH
patterns
MYST3-CREBBP
transcript
CREBBP-MYST3
transcript
146B47,XY,t(7;18)(?;?),+8,t(8;16)(p11;p13),
der(9)t(8;9)(?;p2?),add(11)(p1?4),del(12)(p1?2),
der(17)t(7;17)(?;p1?1)[cp29]/46,XY[9]
2 Type IV/V No
2 46,XY,t(8;16)(p11;p13)[20]/46,XY[15] 1 ND ND
3 46,XX,t(8;16)(p11;p13)[22] 1 Type I Type I
4 46,XY,dup(6)(q21q2?4),t(8;16)(p11;p13)[2]/46,sl,
add(21)(p1?)[4]/45,sl,del(9)(q13q31), 18[3]/46,XY[14]
1 Type I Type I
5 46,XX,t(8;16)(p11;p13)[4]/47,sl,+8[5]/46,XX[1] 1 Type I Type I
6 48,XY,t(8;16)(p11;p13),+8,+8[7]/49,sl,+18[5]/50,sdl1,+13[4] 2 Type IV No
7 46,XX,t(8;16)(p11;p13),t(11;19)(p12B13;p13 or
q13)[5]/46,sl,del(3)(q21)[11]/47,sdl1,+i(8)(q10)[2]/46,XX[2]
2 Type IV Type IV
8 45,X, Y[7]/45,sl,der(8)t(8;16)(p11;p13),
der(16)t(8;16)(p11;p13)ins(16;8)(p13;q22B23q24.1)[13]
2 Type V No
9 46,XX,t(8;16)(p11;p13)[20]/46,sl,t(11;22)(p10;p10)[2]/46,XX[1] 1 ND ND
10 46,XX,t(8;16)(p11;p13)[19]/46,XX[1] 1 ND ND
11 46,XX,t(8;16)(p11;p13)[10] 1 Type I Type I
12 45,XY,t(8;16)(p11;p13),?del(11)(p13),?add(14)(q24),
i(22)(q10)[8]/46,XY[1]
1 Type I Type I
13 46,XX,t(8;16)(p11;p13)[19]/46,XX[1] 1 Type I Type I
14 46,XX,add(1)(p36),t(8;16)(p11;p13)[22]/46,XX[1] 1 ND ND
15 46,XX,t(8;16)(p11;p13)[2]/46,XX[21] Normal ND ND
16 46,XY,t(8;16)(p11;p13)[25] ND Type I No
17 47,XX,+i(5)(p10),t(8;16)(p11;p13)[20] ND Type I Type I
18 46,XX,t(8;16)(p11;p13)[15]/46,XX[5] 1 Type I Type I
19 46,XX,t(8;16)(p11;p13)[26] 1 Type I Type I
20 46,XX,t(8;16)(p11;p13)[10]/46,XX[4] 1 Type I Type I
21 46,XY,t(8;16)(p11;p13)[19] 1 Type I Type I
22 46,XX,t(8;16)(p11;p13)[17]/46,XX[13] 1 ND ND
23 46,XX,t(8;16)(p11;p13)[17]/46,XX[10] 1 Type I Type I
24 46,XX,del(20)(q12)[1]/46,sl,t(8;16)(p11;p13)[20] 2 Type IV no
25 46,XX,t(8;16)(p11;p13)[13]/46,XX[7] 1 ND ND
26 46,XX,t(8;16)(p11;p13),ider(13)(q10)del(13)(q13q22)[8]/46,XX[44] 2 Type IV Type IV
27 46,XY,add(7)(q22),der(8)(8qter-8q?13H22H8p11-8qter),
der(17)(8qter-8q?13H17p1?2-17qter), der(22)(22pter-22q13H8)[48]
Negative Negative Negative
28 46,XX,t(8;16)(p11;p13),t(12;17)(q24;q11)[3]/46,sl, del(7)(q21q31)[9] 1 ND ND
29 46,XY,t(8;19)(p11;q13.3)[18]/46,XY[2] Negative Negative negative
30 46,XX,t(8;16)(p11;p13)[20] 2 Type IV B500 bp
Abbreviations: FISH, fluorescence in situ hybridization; ND, not done; RT-PCR, reverse transcription PCR.
For FISH patterns 1 and 2, see Figure 1
Table 4 Primers used for RT-PCR
Designation Sequence (5
0
–3
0
) Position
MYST3_3536F CCTTTTGAAGATTCTGACTCCG MYST3 exon 16
CREBBP_1201R GTTGCAATTGCTTGTGTGGGTAC CREBBP exon 5
MYST3_3558F GAGGCCAATGCCAAGATTAGAAC MYST3 exon 16
CREBBP_404R CCTCGTAGAAGCTCCGACAGTT CREBBP exon 3
MYST3_3319F CGCTACAGTGAGGGTGACAGG MYST3 exon 15
CREBBP_96F CGCTCGCTCCTCTCCCTCGCAG CREBBP exon 2
MYST3_3953R TGGAAACGATGGGCTCAATGACGC MYST3 exon 17
CREBBP_174F GGGCTGTTTTCGCGAGCAGGTG CREBBP exon 2
MYST3_3844R GGCTCTTGCCTTTGGGCCATCC MYST3 exon 17
Abbreviations: CREBBP, CREB-binding protein; MYST3, MYST histone acetyltransferase 3; RT-PCR, reverse transcription PCR.
Comprehensive study of MYST3-linked AML
C Gervais et al
1570
Leukemia
primary disease and AML with 8p11 abnormality was approxi-
mately 25 months for the 17 cases for which the date of the
primary disease was known. Among the 20 female patients, four
had de novo AML and 12 had a history of breast cancer,
representing 75% of t-AML in female subjects. Four patients,
who presented CMML 13–24 months before the diagnosis of
AML, have to be distinguished from other secondary cases as
AML was an evolution of CMML. Two of them were
myelomonocytic AML (M4). Monocytic AML is a common
evolution for CMML, and we show that MYST3 abnormality can
be observed in such cases.
Among the 66 cases of t(8;16) described in the literature,
21
21
cases were therapy-related (32%), which represents a lower rate
than in our series (77%). Among those 21 reported cases, 14
were secondary to solid cancers (eight breast cancers) and seven
to haematological malignancies.
The t(8;16) may be associated with previous treatment with
anthracyclines.
24
In our study, 30% of the secondary cases had a
previous anthracycline treatment (seven cases), 48% had
alkylating agent (11 cases), 30% had topoisomerases II inhibitor
(seven cases) and 57% had radiotherapy (13 cases). In three
cases, therapeutic records were incomplete. Thus, we cannot
confirm the association of t(8;16) with prior anthracycline
therapy.
Haematological features
Peripheral blood examination showed mean haemoglobin level
of 10.5 g per 100 ml (range 6.8–14.5), mean platelet count of
82 10
9
/l (range 14–375) and mean white blood cell count of
24 10
9
/l (range 1.5–112). Bone marrow aspiration was
hypercellular in 16 cases, with a mean blast cell count of
68%. As expected, all acute leukaemias were monocytic.
According to the FAB classification, 17 cases were AML-M5a,
nine cases -M5b, two cases -M4 and one case -M5 unclassifi-
able because of the presence of necrosis (Table 2). No dysplasia
was observed. Among the 28 bone marrow smears of good
quality, the presence of cytoplasmic vacuoles, sometimes
abundant, was noted in 21 cases (75%). Erythrophagocytosis
was present in 21/28 cases (75%) and was major in eight cases.
Cytoplasmic vacuoles and erythrophagocytosis were both
observed in 18/28 cases. Among the nine cases analysed for
esterase, eight had a strong activity and one case had low
activity. Among the nine cases analysed for peroxidase, five had
no peroxidase activity and four had a very strong activity, all
AML-M5a. In 19 cases, cytochemical analyses were not
available.
Immunophenotypic analysis was available for 25 patients (all
except cases 2, 17, 25, 28 and 29) and showed negative CD34
in 21/23 (91%), positive CD4 in 18/19 (95%), positive CD14 in
11/20 (55%), positive CD56 in 13/18 (72%), positive CD33
in 24/25 (96%), positive CD13 in 17/24 (71%), positive CD15 in
18/19 (95%), positive HLA-DR in 19/21 (90%) and positive
CD11b in 8/14 cases (57%) (data not shown). In a study of 54
cases of de novo monocytic AML,
25
the same pattern of antigen
expression was observed. The only difference was the expres-
sion of CD11b (normally expressed in myeloid and NK cells) in
100% of study by Xu
25
but in only 57% of our cases; however,
CD11b was explored here in only 14 cases, which is insufficient
to draw any interpretation. In conclusion, monocytic
leukaemias with or without t(8;16) do not differ by their antigen
expression.
Cytogenetic features
Karyotypes are reported in Table 3. Sixteen cases (53.3%)
showed simple karyotypes with isolated 8p11 translocation.
Seven karyotypes (23.3%) showed the 8p11 translocation with a
single additional abnormality: Y, add(1)(p36), þ i(5)(p10),
þ 8, t(11;12)(p10;p10), ider(13)(q10)del(13)(q13q22) and
del(20)(q12). Seven karyotypes (23.3%) were complex (three
abnormalities or more). Partial or complete trisomy 8 was
present in six cases (20%). Chromosome 7 abnormalities, often
present in therapy-related disorders, were present in three cases,
and chromosome 5 abnormality was present in one case. It has
to be noted that for cases 8 and 24, the t(8;16) appeared as a
secondary event. The primary abnormality was Yor
del(20)(q12). Those two cases were de novo AMLs.
Twenty-eight cases were analysed by FISH. FISH analysis
failed to prove t(8;16) in case 15, despite the analysis of 80
metaphases. Two hybridization patterns were observed (Figure 1).
Considering the position of the probes, this suggested a variation
in the breakpoint in CREBBP, confirmed by molecular analysis
(see Molecular features).
One variant translocation was identified (case 8) with a
‘classical’ der(8)t(8;16) with MYST3-CREBBP fusion transcript
ab
der(8)t(8;16)
der(8)t(8;16)
der(16)t(8;16)
der(16)t(8;16)
8
8
16
16
Figure 1 FISH analysis using BAC RP11-313J18 and BAC RP11-589C21 in 8p11, labelled in SpectrumRed, BAC RP11-619A23 in 16p13, labelled
in SpectrumGreen. (a) Case 2, showing one red signal on normal chromosome 8, a second red signal on der(16)t(8;16), one green signal on normal
chromosome 16 and one fused signal on der(8)t(8;16). Cases 3–5, 9–14, 18–23, 25 and 28 were similar (pattern 1). (b) Case 1, showing one fused
signal on der(16)t(8;16) instead of one red signal. Cases 6, 7, 8, 24, 26 and 30 were similar (pattern 2). BAC, bacterial artificial chromosome; FISH,
fluorescence in situ hybridization.
Comprehensive study of MYST3-linked AML
C Gervais et al
1571
Leukemia
type V and a der(16)t(8;16)(p11;p13)ins(16;8)(p13;q22B23q24.1).
Some 8q material was present between CREBBP and MYST3 on
the der(16). Consequently, FISH signals were not fused and the
CREBBP-MYST3 transcript was absent. Two patients with a
variant t(8;16) have been reported. The first one was
a t(8;18;16)(p11;q21;p13)
26
in a young boy with AML-M5b, and
the second was an inv(8)(p11q24.3) with masked t(8;16)
27
in a 60-
year-old female patient with AML-M5.
Two alternative translocations were identified in our series, in
which 22q13 and 19q13.3 were implicated instead of 16p13
(Table 3). FISH analysis suggested MYST3 involvement without
CREBBP abnormality. FGFR1 involvement was excluded in both
cases. The karyotype of patient 27 (AML-M5 preceded by
CMML) was complex, with der(8)(8qter-48q?13H22H8p11-
8qter) and der(22)(22pter-422q13H8) identified by multicolor
FISH. FISH analysis with specific BAC confirmed the involve-
ment of the MYST3 and EP300 genes (data not shown). A
t(8;22)(p11;q13) has been described in two cases,
9,28
fusing
MYST3 to EP300.
10
Both cases were AML-M5, de novo in the
first one, from progression of a CMML in the second one. The
breakpoint was in the same exon (exon 3) and involved codon
117, as in the t(8;16). Both fusion transcripts were expressed in
the two cases. Adenoviral E1A-associated protein EP300 is a
homologue of CREBBP and has acetyltransferase activity like
CREBBP. The fusion protein plays an abnormal transcriptional
co-activator role in AML. Patient 29 (de novo AML-M5a) had a
simple karyotype with t(8;19)(p11;q13.3). Two such cases have
been reported. The first one was a male patient with AML-M5a
and additional abnormalities t(8;19),add(1)(q?),add(16)(q?).
8
The
second one was a young female patient with AML-M4
and a simple t(8;19).
29
The gene in 19q13 is unknown.
Neither inv(8)(p11q13) involving TIF2/NCOA2 (nuclear
receptor coactivator 2), described in seven cases,
11,12,30–33
nor
other recurrent alternative translocationsFt(6;8)(q27;p11),
34
t(8;14)(p11;q11.1),
35
t(3;8;17)(q27;p11;q12),
36
t(2;8)(p23;p11)
37
and t(8;20)(p11;q13)
38
Fwere found in our series.
MYST3-CREBBP type I
MYST3-CREBBP type IV and V
CREBBP_1201R
Exon 16
Exon 3Exon 15
MYST3_3536F
MYST3_3558F
Exon 5
Exon 4
CREBBP_404R
MYST3 CREBBP
Exon 15
Exon 5
CREBBP_1201R
MYST3_3319F
Exon 15 Exon 5
CREBBP_1201RMYST3_3319F
Exon 4
Type V
Type IV
MYST3 CREBBP
MYST3 CREBBP
b
a
CREBBP-MYST3
Exon 17
Exon 17
MYST3_3953R
MYST3_3844R
CREBBP_174F
CREBBP_96F
MYST3_3953R
MYST3_3844RCREBBP_174F
CREBBP_96F
MYST3
CREBBP
Exon 16
MYST3CREBBP
Exon 2Exon 1
Type I
Type IV
c
Exon 3
Exon 2Exon 1
H
2
78
O116
G20 21 17 18 11 4 5 3 12 13 19N M23 6 24 26 30
330 bp type I
N8 71G
350 bp type IV
176 bp type V
M
350 bp type IV
H
2
O
N624 GM26 30
229 bp type I
1256 bp type IV
H
2
7
8O1G61
20 21 17 18 11 4 5 3 12 13 19
N M
H
2
O N 26 23 3024 6 G M
229 bp type I
1256 bp type IV
≈ 500 bp type IV
H
2
O
Figure 2 Nested PCR and partial sequences of MYST3-CREBBP and CREBBP-MYST3 fusions. (a) The first set of primer combinations allowed the
detection of type I MYST3-CREBBP fusion transcript. Thirteen out of 20 cases showed a 330-bp fragment, corresponding to type I. Cases 1, 6, 7, 8,
24, 26 and 30 were not amplified. (b) The second set of primer combination allowed the detection of types IV and V MYST3-CREBBP fusion
transcripts. Cases 6, 7, 24, 26 and 30 were positive for type IV. Case 8 was positive for type V. Case 1 was positive for both types IV and V. (c) The
reciprocal transcript CREBBP-MYST3 fusion transcript was observed in 15/20 cases. Twelve out of 20 cases were type I. Cases 7 and 26 were type
IV. Case 30 showed an unusual 500-bp band. Cases 1, 6, 8, 16 and 24 were not amplified. N: normal lymphocytes; G: genomic DNA; M: 100-bp
DNA molecular weight ladder. CREBBP, CREB-binding protein; MYST3, MYST histone acetyltransferase 3.
Comprehensive study of MYST3-linked AML
C Gervais et al
1572
Leukemia
Molecular features
In 13 of 22 cases, a B330-bp fragment was amplified with the
first set of primers, corresponding to a type I MYST3-CREBBP
(Table 3). Cases 1, 6, 7, 8, 24, 26, 27, 29 and 30 were not
amplified (Figure 2a). With the second set of primers, a 350-bp
fragment was found in cases 1, 6, 7, 24, 26 and 30
corresponding to type IV MYST3-CREBBP, and an B176-bp
fragment was found in cases 1 and 8 corresponding to type V
MYST3-CREBBP. Case 1 presented with a strong band of 350 bp
and a weak band of 176 bp (Figure 2b). The reciprocal CREBBP-
MYST3 type I transcript was detected as a 229-bp fragment in
12/13 cases with type I transcript. In cases 7 and 26, a 1256-bp
fragment was amplified corresponding to the reciprocal IV
transcript. In case 30, the reciprocal transcript differed from the
other type IV cases, with a band of B500 bp. In cases 1, 6, 8, 16
and 24, no reciprocal transcript was found (Figure 2c). Cases 27
and 29 were negative for all types of transcripts tested (data not
shown). To date, 16 cases with t(8;16)(p11;p13) have been
characterized by RT-PCR.
5,19,20,24,39–41
Type I transcript is the
most frequent fusion product (13 cases/16); breakpoints map in
MYST3 intron 16. Type II was described in two cases associated
with type I and MYST3 and CREBBP gene fusions result in an
out-of-frame sequence and in a putative truncated protein.
24
In
rare cases (3/16), the breakpoint is in MYST3 exon 17, which is
fused to CREBBP exon 2 or 4
5,19,20
defining type III. Recently, a
fourth and fifth type have been described in two cases, in which
the MYST3-CREBBP fusion has lost MYST3 exon 16, suggesting
that the breakpoint occurs in intron 15.
14
In our study, type I was
the most frequent transcript (13/20 cases). The other cases were
types IV (cases 1, 6, 7, 24, 26 and 30) and V (cases 1 and 8). Two
of these rare cases have been previously described (cases 7 and
8).
14
In some reports, the reciprocal CREBBP-MYST3 transcript
was not amplified
19,40
or was out-of-frame.
5
Therefore, MYST3-
CREBBP, and not CREBBP-MYST3 transcript, is believed to be of
importance in the leukaemogenesis process.
19
We did not find a
reciprocal transcript for five patients. Patient 1 showed both type
IV and type V MYST3-CREBBP transcripts. Although no
quantitative RT-PCR was performed, it was evident from the
intensity of the amplified fragments that type IV was the most
abundant transcript in this sample. Panagopoulos et al.
24
described two patients with both type I and type II CREBBP-
MYST3 transcripts. In patient 30, the B 500-bp fragment
corresponding to the reciprocal transcript was unusual, probably
because of different breakpoints in MYST3 and/or CREBBP
genes. No difference in type was observed between de novo
(three type I, one type IV, one type V and one alternative
translocation) or therapy-related 8p11 AML.
There was a relation between the hybridization pattern
observed by FISH analysis and the type of fusion transcript.
Cases 2, 3–5, 9–14, 18–23, 25 and 28 showed no split signal of
the CREBBP probe (all the probe moved on der(8)t(8;16))
(pattern 1) and type I fusion transcript. Cases 1, 6, 7, 8, 24, 26
and 30 showed one split signal of this probe (pattern 2) and type
IV and/or V fusion transcript, as the 16p13 breakpoint was more
telomeric in those cases. Variation of MYST3 breakpoint was not
visible by FISH, with the selected probes.
Prognostic features
Eight patients (27%) of this study were in remission at the time of
collection of the data (5 months to 4 years after the diagnosis)
(Table 1). Two patients relapsed 17 months and 3–4 months
after diagnosis. No remission was achieved for patient 22 with a
recession of 1.5 months. Half of the patients deceased during the
first 10 months after diagnosis: four during the first week after
diagnosis, six between 1 week and 3 months and five between 3
and 10 months. Four patients were lost to follow-up rapidly after
diagnosis (3 months maximum). The t(8;16)(p11;p13) has been
described in two cases with complete spontaneous remission,
during acute monoblastic leukaemia
42
and congenital myelo-
sarcoma.
43
A t(8;16)(q11;p13), probably involving CREBBP, has
also been reported in a congenital AML-M4 with spontaneous
regression.
44
In contrast to these three regressive cases, the
prognosis of AML with t(8;16) is overall poor. Indeed, although
patients of our series were often old and therapies were
different, our data confirm the poor prognosis of MYST3-linked
AML.
Conclusion
We have reported a series of 30 AML with MYST3 abnormality.
Patients were mostly women and the mean age was B60 years.
The majority of cases were secondary AML to solid cancer,
haematological malignancy or both. Disseminated intravascular
coagulation was present in 40% of cases. AMLs were monocytic
(rarely myelomonocytic), with erythrophagocytosis and cyto-
plasmic vacuoles. Immunophenotype showed negative CD34
and positive CD56 as generally found in monocytic leukaemia.
Twenty-eight cases were t(8;16)(p11;p13) with MYST3-CREBBP
fusion, one case showed a variant of the t(8;22)(p11;q13) and
one case showed a t(8;19)(p11;q13), suggesting that
t(8;16)(p11;p13) is the main translocation and that other
abnormalities are variant, complex or alternative translocations.
Molecular study showed that type I was the most frequent
MYST3-CREBBP fusion transcript. MYST3 abnormality was
associated with poor prognosis. All these features suggest that
AML with MYST3 abnormality is a specific entity that might be
individualized in the World Health Organization classification.
Subsequent studies are necessary to identify new translocations
involving MYST3 and new partner genes (such as the one in
19q13) and to explain the involvement of the abnormal MYST3
protein in leukaemogenesis.
Acknowledgements
We thank cytologists and the members of the Groupe Franc¸ais
d’He
´
matologie Cellulaire: Jean-Philippe VIAL, Estelle GUERIN,
Marguerite MICHEAU (Bordeaux), Danielle TREILLE-RITOUET
(Lyon Sud), Marie-Paule CALLAT, Ge
´
rard BUCHONNET (Rouen),
Bernardine FAVRE-AUDRY, Marc MAYNADIE (Dijon), Bruno
VERHASSELT, Jan PHILIPPE, Lucien NOENS (Gent), Richard
GARAND (Nantes), Christine ARNOULET (Marseille), Franck
GENEVIEVE, Jacques GARDAIS (Angers), Jean-Franc¸ois CLAISSE
(Amiens), Andre
´
PETIT, Claire LESPANEL (Tours), Sylvie DALI-
PHARD (Reims), Christian VASSELON (Saint Etienne), Catherine
SETTEGRANA (Pitie
´
-Salpe
ˆ
trie
`
re, Paris).
References
1 Heim S, Avanzi GC, Billstrom R, Kristoffersson U, Mandahl N,
Bekassy AN et al. A new specific chromosomal rearrangement,
t(8;16) (p11;p13), in acute monocytic leukaemia. Br J Haematol
1987; 66: 323–326.
2 Lai JL, Zandecki M, Jouet JP, Savary JB, Lambiliotte A, Bauters F
et al. Three cases of translocation (8;16)(p11;p13) observed in
acute myelomonocytic leukemia: a new specific subgroup? Cancer
Genet Cytogenet 1987; 27: 101–109.
Comprehensive study of MYST3-linked AML
C Gervais et al
1573
Leukemia
3 Huret J, Pe
´
rot C. t(8;16)(p11;p13). In: Atlas Genet Cytogenet Oncol
Haematol 1998. URL: http://AtlasGeneticsOncology.org/Anoma-
lies/t0816.html.
4 Vizmanos JL, Larrayoz MJ, Vazquez I, Odero MD, Hernandez R,
Lahortiga I et al. Remission of acute monocytic leukemia,
secondary to treatment with epipodophyllotoxins, in a patient
with t(8;16)(p11;p13) and MYST3-CREBBP fusion. Cancer Genet
Cytogenet 2004; 152: 177–178.
5 Borrow J, Stanton Jr VP, Andresen JM, Becher R, Behm FG,
Chaganti RS et al. The translocation t(8;16)(p11;p13) of acute
myeloid leukaemia fuses a putative acetyltransferase to the CREB-
binding protein. Nat Genet 1996; 14: 33–41.
6 Huret J, Senon S. MYST3 (MYST histone acetyltransferase
(monocytic leukemia) 3. In: Atlas Genet Cytogenet Oncol
Haematol 2005. URL: http://AtlasGeneticsOncology.org/Genes/
MYST3ID25ch8p11.html.
7 Huret J. CREBBP (CREB binding protein (Rubinstein-Taybi
syndrome)). In: Atlas Genet Cytogenet Oncol Haematol 2000.
URL: http://AtlasGeneticsOncology.org/Genes/CBPID42.html.
8 Tanzer J, Brizard A, Guilhot F, Benz-Lemoine E, Dreyfus B, Lessard
M et al. [Acute leukemia with translocation (8;16)]. Nouv Rev Fr
Hematol 1988; 30: 83–87.
9 Lai JL, Zandecki M, Fenaux P, Preudhomme C, Facon T,
Deminatti M. Acute monocytic leukemia with (8;22)(p11;q13)
translocation. Involvement of 8p11 as in classical t(8;16)(p11;p13).
Cancer Genet Cytogenet 1992; 60: 180–182.
10 Chaffanet M, Gressin L, Preudhomme C, Soenen-Cornu V,
Birnbaum D, Pebusque MJ. MOZ is fused to p300 in an acute
monocytic leukemia with t(8;22). Genes Chromosomes Cancer
2000; 28: 138–144.
11 Coulthard S, Chase A, Orchard K, Watmore A, Vora A, Goldman
JM et al. Two cases of inv(8)(p11q13) in AML with erythrophago-
cytosis: a new cytogenetic variant. Br J Haematol 1998; 100:
561–563.
12 Liang J, Prouty L, Williams BJ, Dayton MA, Blanchard KL.
Acute mixed lineage leukemia with an inv(8)(p11q13) resulting
in fusion of the genes for MOZ and TIF2. Blood 1998; 92:
2118–2122.
13 Esteyries S, Perot C, Adelaide J, Imbert M, Lagarde A, Pautas C
et al. NCOA3, a new fusion partner for MOZ/MYST3 in M5 acute
myeloid leukemia. Leukemia 2008; 22: 663–665.
14 Murati A, Adelaide J, Quilichini B, Remy V, Sainty D, Stoppa AM
et al. New types of MYST3-CBP and CBP-MYST3 fusion transcripts
in t(8;16)(p11;p13) acute myeloid leukemias. Haematologica
2007; 92: 262–263.
15 Bennett JM, Catovsky D, Daniel MT, Flandrin G, Galton DA,
Gralnick HR et al. Proposals for the classification of the acute
leukaemias. French–American–British (FAB) co-operative group.
Br J Haematol 1976; 33: 451–458.
16 Jaffe ES, Harris NL, Stein H, Vardiman JW (eds). World Health
Organization Classification of Tumours. Pathology and Genetics of
Tumours of Haematopoietic and Lymphoid Tissues. IARC Press
Lyon, 2001.
17 Weber L, Garson O. Fluorodeoxyuridine synchronization
of bone marrow cultures. Cancer Genet Cytogenet 1983; 8:
123–132.
18 Lisa G, Shaffer NT. ISCN 2005, An International System for Human
Cytogenetic Nomenclature. Karger 2005.
19 Panagopoulos I, Fioretos T, Isaksson M, Mitelman F, Johansson B,
Theorin N et al. RT-PCR analysis of acute myeloid leukemia with
t(8;16)(p11;p13): identification of a novel MOZ/CBP transcript and
absence of CBP/MOZ expression. Genes Chromosomes Cancer
2002; 35: 372–374.
20 Schmidt HH, Strehl S, Thaler D, Strunk D, Sill H, Linkesch W et al.
RT-PCR and FISH analysis of acute myeloid leukemia with
t(8;16)(p11;p13) and chimeric MOZ and CBP transcripts: break-
point cluster region and clinical implications. Leukemia 2004; 18:
1115–1121.
21 Mitelman F, Johansson B, Mertens F (eds). Mitelman Database of
Chromosome Aberrations in Cancer. Available at http://cgap.nci.-
nih.gov/Chromosomes/Mitelman. Accessed on 16 July 2007.
22 Bernstein R, Pinto MR, Spector I, Macdougall LG. A unique
8;16 translocation in two infants with poorly differentiated
monoblastic leukemia. Cancer Genet Cytogenet 1987; 24:
213–220.
23 Hanada T, Ono I, Minosaki Y, Moriyama N, Nakahara S, Ohtsu A.
Translocation t(8;16)(p11;p13) in neonatal acute monocytic
leukaemia. Eur J Pediatr 1991; 150: 323–324.
24 Panagopoulos I, Isaksson M, Lindvall C, Bjorkholm M, Ahlgren T,
Fioretos T et al. RT-PCR analysis of the MOZ-CBP and CBP-MOZ
chimeric transcripts in acute myeloid leukemias with
t(8;16)(p11;p13). Genes Chromosomes Cancer 2000; 28:
415–424.
25 Xu Y, McKenna RW, Wilson KS, Karandikar NJ, Schultz RA,
Kroft SH. Immunophenotypic identification of acute myeloid
leukemia with monocytic differentiation. Leukemia 2006; 20:
1321–1324.
26 Mo J, Lampkin B, Perentesis J, Poole L, Bao L. Translocation
(8;18;16)(p11;q21;p13). A new variant of t(8;16)(p11;p13) in acute
monoblastic leukemia: case report and review of the literature.
Cancer Genet Cytogenet 2006; 165: 75–78.
27 Chaffanet M, Mozziconacci MJ, Fernandez F, Sainty D,
Lafage-Pochitaloff M, Birnbaum D et al. A case of inv(8)(p11q24)
associated with acute myeloid leukemia involves the MOZ and CBP
genes in a masked t(8;16). Genes Chromosomes Cancer 1999; 26:
161–165.
28 Soenen V, Chaffanet M, Preudhomme C, Dib A, Lai JL, Fletcher JA
et al. Identification of a YAC spanning the translocation breakpoint
t(8;22) associated with acute monocytic leukemia. Genes
Chromosomes Cancer 1996; 15: 191–194.
29 Stark B, Resnitzky P, Jeison M, Luria D, Blau O, Avigad S et al. A
distinct subtype of M4/M5 acute myeloblastic leukemia (AML)
associated with t(8:16)(p11:p13), in a patient with the variant
t(8:19)(p11:q13)Fcase report and review of the literature. Leuk
Res 1995; 19: 367–379.
30 Billio A, Steer EJ, Pianezze G, Svaldi M, Casin M, Amato B et al. A
further case of acute myeloid leukaemia with inv(8)(p11q13) and
MOZ-TIF2 fusion. Haematologica 2002; 87: ECR15.
31 Murati A, Adelaide J, Popovici C, Mozziconacci MJ, Arnoulet C,
Lafage-Pochitaloff M et al. A further case of acute myelomonocytic
leukemia with inv(8) chromosomal rearrangement and
MOZ-NCOA2 gene fusion. Int J Mol Med 2003; 12: 423–428.
32 Panagopoulos I, Teixeira MR, Micci F, Hammerstrom J, Isaksson
M, Johansson B et al. Acute myeloid leukemia with
inv(8)(p11q13). Leuk Lymphoma 2000; 39: 651–656.
33 Strehl S, Konig M, Mann G, Haas OA. Multiplex reverse
transcriptase-polymerase chain reaction screening in childhood
acute myeloblastic leukemia. Blood 2001; 97: 805–808.
34 Brizard A, Guilhot F, Huret JL, Benz-Lemoine E, Tanzer J. The
8p11 anomaly in ‘monoblastic’ leukaemia. Leuk Res 1988; 12:
693–697.
35 Slovak ML, Nemana L, Traweek ST, Stroh JA. Acute monoblastic
leukemia (FAB-M5b) with t(8;14)(p11;q11.1). Cancer Genet
Cytogenet 1991; 56: 237–242.
36 Bertheas MF, Jaubert J, Vasselon C, Reynaud J, Pomier G, Le Petit
JC et al. A complex t(3;8;17) involving breakpoint 8p11 in a case of
M5 acute nonlymphocytic leukemia with erythrophagocytosis.
Cancer Genet Cytogenet 1989; 42: 67–73.
37 Imamura T, Kakazu N, Hibi S, Morimoto A, Fukushima Y,
Ijuin I et al. Rearrangement of the MOZ gene in pediatric
therapy-related myelodysplastic syndrome with a novel chromo-
somal translocation t(2;8)(p23;p11). Genes Chromosomes Cancer
2003; 36: 413–419.
38 Esteyries S, Perot C, Adelaide J, Imbert M, Lagarde A, Pautas C
et al. NCOA3, a new fusion partner for MOZ/MYST3 in M5 acute
myeloid leukemia. Leukemia 2007; 22: 663–665.
39 Panagopoulos I, Isaksson M, Lindvall C, Hagemeijer A, Mitelman
F, Johansson B. Genomic characterization of MOZ/CBP and CBP/
MOZ chimeras in acute myeloid leukemia suggests the involve-
ment of a damage-repair mechanism in the origin of the
t(8;16)(p11;p13). Genes Chromosomes Cancer 2003; 36: 90–98.
40 Rozman M, Camos M, Colomer D, Villamor N, Esteve J, Costa D
et al. Type I MOZ/CBP (MYST3/CREBBP) is the most common
chimeric transcript in acute myeloid leukemia with
t(8;16)(p11;p13) translocation. Genes Chromosomes Cancer
2004; 40: 140–145.
41 Tasaka T, Matsuhashi Y, Uehara E, Tamura T, Kakazu N, Abe T
et al. Secondary acute monocytic leukemia with a translocation
t(8;16)(p11;p13): case report and review of the literature. Leuk
Lymphoma 2004; 45: 621–625.
Comprehensive study of MYST3-linked AML
C Gervais et al
1574
Leukemia
42 Sainati L, Bolcato S, Cocito MG, Zanesco L, Basso G, Montaldi A et al.
Transient acute monoblastic leukemia with reciprocal (8;16)(p11;p13)
translocation. Pediatr Hematol Oncol 1996; 13: 151–157.
43 Classen CF, Behnisch W, Reinhardt D, Koenig M, Moller P,
Debatin KM. Spontaneous complete and sustained remission of
a rearrangement CBP (16p13)-positive disseminated congenital
myelosarcoma. Ann Hematol 2005; 84: 274–275.
44 Weintraub M, Kaplinsky C, Amariglio N, Rosner E, Brok-Simoni F,
Rechavi G. Spontaneous regression of congenital leukaemia with
an 8;16 translocation. Br J Haematol 2000; 111: 641–643.
Appendix
Participant centres (number of patients of each centre is
indicated in parentheses): CHU d’Angers (1); CHU de Bordeaux
(4); CHU de Dijon (2); Centre de Ge
´
ne
´
tique de Gent (2); Ho
ˆ
pital
de Lieges (1*); CHU de Lyon-Sud (3); Institut Paoli-Calmettes,
Marseille (2); CHU de Nantes (2); CHU de Reims (1);
CHU de Rouen (3); CHU de Tours (1); Paris, Ho
ˆ
pital
Pitie
´
-Salpe
ˆ
trie
`
re (1); Paris, Ho
ˆ
pital Saint-Antoine (2); Paris,
Ho
ˆ
pital Saint-Louis (2*); CHU de Saint-Etienne (1); CHU de
Strasbourg (5). *Cases not included in the series (absence of
cytological review).
Comprehensive study of MYST3-linked AML
C Gervais et al
1575
Leukemia
