Content uploaded by Caroline Ford
Author content
All content in this area was uploaded by Caroline Ford
Content may be subject to copyright.
2004;64:4755-4759. Cancer Res
Caroline E. Ford, Margaret Faedo, Roger Crouch, et al.
Mammary Tumor Virus-Like Sequences in Men and Women
Is Associated with Increasing Prevalence of Mouse
Progression from Normal Breast Pathology to Breast Cancer
Updated version
http://cancerres.aacrjournals.org/content/64/14/4755
Access the most recent version of this article at:
Cited Articles
http://cancerres.aacrjournals.org/content/64/14/4755.full.html#ref-list-1
This article cites by 32 articles, 11 of which you can access for free at:
Citing articles
http://cancerres.aacrjournals.org/content/64/14/4755.full.html#related-urls
This article has been cited by 5 HighWire-hosted articles. Access the articles at:
E-mail alerts
related to this article or journal.Sign up to receive free email-alerts
Subscriptions
Reprints and
.pubs@aacr.orgDepartment at
To order reprints of this article or to subscribe to the journal, contact the AACR Publications
Permissions
.permissions@aacr.orgDepartment at
To request permission to re-use all or part of this article, contact the AACR Publications
Research.
on June 12, 2013. © 2004 American Association for Cancercancerres.aacrjournals.org Downloaded from
[CANCER RESEARCH 64, 4755–4759, July 15, 2004]
Progression from Normal Breast Pathology to Breast Cancer Is Associated with
Increasing Prevalence of Mouse Mammary Tumor Virus-Like Sequences
in Men and Women
Caroline E. Ford,
1,2
Margaret Faedo,
1,2
Roger Crouch,
3
James S. Lawson,
4
and William D. Rawlinson
1,2
1
Virology Division, Department of Microbiology, South Eastern Area Laboratory Services, Prince of Wales Hospital, Randwick, New South Wales, Australia;
2
Department of
Biotechnology and Biomolecular Science, University of New South Wales, Kensington, New South Wales, Australia;
3
Department of Anatomical Pathology, Prince of Wales
Hospital, Randwick, New South Wales, Australia; and
4
School of Public Health, University of New South Wales, Kensington, New South Wales, Australia
ABSTRACT
Mouse mammary tumor virus (MMTV)-like sequences have been
found in up to 40% of breast cancer samples but in <2% of normal breast
tissue samples from Australian women studied by our group. Screening of
a larger and more diverse cohort of female breast cancer samples has now
shown a correlation of MMTV-like sequences with the severity (grade) of
breast cancer. Thirty-two percent (43 of 136) of female breast cancer
samples were positive for MMTV-like sequences when screened using
PCR. A significant gradient of MMTV positivity was observed with
increasing severity of cancer from 23% of infiltrating ductal carcinoma
(IDC) grade I tumors to 34% of IDC grade II tumors (P ⴝ 0.00034) and
38% of IDC grade III tumors (P ⴝ 0.00002). We also report for the first
time the detection of MMTV-like sequences in 62% (8 of 13) of male
breast cancer samples and 19% (10 of 52) of male gynecomastia samples
screened. MMTV-like sequences were demonstrated in various premalig-
nant breast lesions of females, including fibroadenoma (20%) and fibro-
cystic disease(28%) samples, at a significantly higher prevalence than that
seen in normal breast tissue (1.8%; P ⴝ 0.00001). Study of a longitudinal
cohort of female breast cancer patients indicated that MMTV was co-
incident with tumor but was not present when tumor was absent on
histology. These results support the association of MMTV-like sequences
with development of breast tumors in men and women and suggest
association of MMTV with increasing severity of cancer.
INTRODUCTION
The possible role of mouse mammary tumor virus (MMTV)-like
sequences in human breast cancer remains controversial. The majority
of recent reports linking MMTV and human breast cancer have come
from one research group (1–4), including sequences of two complete
pro-viral structures from human breast cancer tissue (5). A second
group has confirmed these results and also reported the presence of
MMTV-like sequences in lymphomas (6). We have independently
reported the presence of MMTV-like sequences in 42% of Australian
breast cancer samples and 1.8% of normal breast tissue samples (7),
similar to the results in studies of American, Argentinian, and Italian
women (1, 2). However, there have recently been two small studies
reporting the absence of MMTV-like sequences in breast tumors from
Italian (8) and Austrian women (9). Although all other studies to date
demonstrate strong associations between the presence of MMTV-like
sequences and human breast cancer, no causal link has yet been
shown.
Investigations into the role of MMTV-like sequences in the pro-
gression from normal breast pathology to breast cancer were under-
taken by examining a longitudinal cohort of breast cancer patients. We
sought to determine whether MMTV-like sequences would be present
in nonmalignant (NM) tissues and whether cases of MMTV-like
sequences would be detected before positive breast cancer to further
support the causal role of MMTV in tumorigenesis.
The prevalence of MMTV-like sequences has been shown to in-
crease with severity of breast cancer from 1.8% in normal breast tissue
to 26% in cases of ductal carcinoma in situ to 54% in infiltrating
ductal carcinoma (IDC) cases in previous studies of Australian
women (7). We have subsequently followed up the two cases of
MMTV sequence-positive normal breast tissue (2 of 111, 1.8%) and
learned that breast cancer was present in one patient before testing for
MMTV and in one patient after testing for MMTV, in the contralateral
and ipsilateral breasts, respectively (10). We have tested a larger and
more diverse cohort of female breast cancer samples in this study to
confirm our previous results showing a high prevalence of MMTV-
like sequences in the Australian population. We also sought to cor-
relate virus positivity with the specific grade of cancer in cases
of IDC.
An area of controversy in the etiology of breast cancer is the effect
of previous benign breast conditions (often referred to as premalignant
breast lesions), such as fibrocystic disease, hyperplasia, and fibroad-
enoma, on the risk of subsequent breast cancer. These are relatively
common breast lesions in women, although their contribution to the
overall risk of breast cancer remains unclear (11, 12). Although not all
women with a premalignant breast lesion develop breast cancer, it
appears that a large number of patients do, and the reasons for this
association remain unclear (13–17). Explanations include the involve-
ment of an oncogenic virus (18) and the coexistence of hormonal
factors in benign and malignant conditions.
Gynecomastia is a benign breast disorder of males, characterized by
enlargement of the breasts, that often occurs during puberty and other
periods of hormonal imbalance in the breast (19). The role of gyneco-
mastia as a risk factor for breast cancer is contentious and is further
complicated by the fact that many males choose to undergo surgery
after the diagnosis of gynecomastia, thereby reducing the incidence of
subsequent breast cancer (20).
The vast majority of reports linking MMTV-like sequences and
breast cancer have studied tissue from women only. Male breast
cancer is a rare yet severe cancer of men (21). Subsequently, due to
the rarity of this disease in comparison with female breast cancer,
much of what we know about the disease has been extrapolated from
women (22). No clear cause of male breast cancer has yet been
determined, and the risk factors for the development of the disease in
men are still unclear (23). There has been one published study of the
association between MMTV and male breast cancer (24). This study
has potential confounders because human endogenous retroviruses
with close sequence homology to MMTV may also have been de-
tected by the methods used (1, 24). We have therefore examined for
the first time using molecular techniques the prevalence of these gene
sequences in male breast cancer samples.
In summary, this study uses a new approach to examine the pos-
sibility of involvement of a MMTV-like virus in the progression from
Received 12/5/03; revised 4/19/04; accepted 5/6/04.
Grant support: Cancer Council New South Wales.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance with
18 U.S.C. Section 1734 solely to indicate this fact.
Requests for reprints: William Rawlinson, Virology Division, Department of Micro-
biology, South Eastern Area Laboratory Services, The Prince of Wales Hospital, Rand-
wick NSW 2031, Australia. Phone: 61-2-93829050; Fax: 61-2-93984275; E-mail:
w.rawlinson@unsw.edu.au.
4755
Research.
on June 12, 2013. © 2004 American Association for Cancercancerres.aacrjournals.org Downloaded from
normal breast pathology to breast cancer. The prevalence of MMTV-
like sequences was studied in female premalignant breast lesions, a
graded cohort of female breast cancer samples, a longitudinal cohort
of women with breast cancer, males with gynecomastia, and males
with breast cancer. Results demonstrate the increasing prevalence of
MMTV-like sequences in more severe tumors, association with tu-
mors during overt cancer, and an apparent gradation of prevalence
with the progression from normal to malignant pathology. These data
support association of virus with tumorigenesis but also indicate wider
prevalence of the virus in premalignant conditions.
MATERIALS AND METHODS
Cell Lines and Tissues. The NIH3T3 (MMTV-positive murine cell line)
and MCF-7 (MMTV-like env-positive human breast tumor cell line) cell lines
were cultured according to conditions recommended by the manufacturer
(American Type Culture Collection, Manassas, VA) and used as positive
controls for PCR.
Tissue culture was conducted in a separate laboratory in a separate area of
the hospital to the main laboratory. All breast tissues studied were from
formalin-fixed, paraffin-embedded tissue samples selected from the archives of
the Department of Anatomical Pathology, Prince of Wales Hospital (Sydney,
Australia) between the years 1995 and 2003. This study was approved by the
South Eastern Sydney Area Health Service Ethics Committee (00/189). Sam-
ples in the longitudinal cohort were selected on the basis of the availability of
multiple biopsies taken between 1995 and 2003. Breast tissue samples were
graded histopathologically as either high- or low-grade ductal carcinoma
in situ; grade I, II, or III IDC; infiltrating lobular carcinoma; or NM/normal
tissue by an experienced histopathologist, and grading was confirmed by a
second histopathologist (R. C.) (25, 26). DNA was extracted and quantitated
from the cell line, original breast cancer samples, subsequent episodes, and
premalignant breast lesions as described previously (7).
Detection of MMTV-Like Sequences using PCR. Samples were tested
for housekeeping genes and MMTV-like sequences using standard PCR pre-
cautions and procedures to avoid contamination, as described previously (7,
27). Due to problems with fragmentation of DNA from formalin fixation (28,
29), a new internal primer (MMTV 5F, GTATGAAGCAGGATGGGTAGA)
was specifically designed to amplify a smaller (190-bp) template of MMTV
envelope gene, thereby allowing improved amplification of MMTV-like se-
quences. The first round of amplification using primers 1X and 2NR (1) was
performed as described previously (7), followed by a semi-nested PCR step
(primers MMTV 5F and 2NR), with cycling conditions of 94°C for 2 min; 30
cycles of 94°C for 30 s, 60°C for 30 s, and 72°C for 30 s; and 72°C for 3 min.
Samples positive using PCR were retested and sequenced to confirm the
presence of MMTV-like sequences in the sample and rule out amplification of
nonspecific or endogenous retroviral sequences (7). Sequences were analyzed
using BLAST and EclustalW programs from the Australian National Genomic
information Service to compare sequences between positive longitudinal sam-
ples and previously reported MMTV-like sequences amplified from human
breast tissue.
Statistical Analysis. Statistical analysis (Fisher’s exact test) was per-
formed using the computer program SPSS Version 6.1.
RESULTS
Longitudinal Cohort. Thirty-six cases of breast cancer were
tested using PCR, and 10 (28%) of these were positive for MMTV-
like sequences (Fig. 1; Table 1). Four of the 10 MMTV-positive
patients (patients A-D) had NM breast tissue excised adjacent to the
MMTV-positive breast cancer tissue. All four cases consisted of an
original local excision to remove tumor, followed by a full mastec-
tomy to remove additional tissue and clear tumor margins. All of the
NM tissues were negative for MMTV-like sequences. An additional
four patients (patients D-G) with recurrences of breast cancer had both
breast cancer samples positive for MMTV-like sequences. These four
cases consisted of local excisions to remove tumor, followed by the
removal of additional tissue and/or mastectomy. Sequencing of the
samples from initial and recurrent tumors showed 100% nucleotide
identity and between 96.5% and 97.4% identity to the MMTV C3H
strain (GenBank accession numbers AY496179-AY496184). There
were two cases in which the second biopsy specimen (following
original mastectomy to remove breast tumor) was located elsewhere
than the breast (patients H and I). In patient H, in whom the second
tumor biopsy was located in the cervix, MMTV-like sequences were
detected, whereas in patient I, in whom the second tumor biopsy was
located in the neck, no MMTV-like sequences were detected. There
was one case of a lymph node excised (axillary dissection) following
MMTV-like gene sequence-positive breast cancer that was also pos-
itive for MMTV-like sequences (patient J). The lymph node was
histopathologically graded as NM but was positive on PCR for
Fig. 1. Products amplified from longitudinal cohort using mouse mammary tumor virus semi-nested PCR (A) and glyceraldehyde-3-phosphate dehydrogenase housekeeping gene
PCR (B). Lane M, size marker; Lane 1, patient A, infiltrating ductal carcinoma (IDC) grade II; Lane 2, patient A, nonmalignant (NM) breast tissue; Lane 3, patient B, IDC grade I;
Lane 4, patient B, NM breast tissue; Lane 5, patient C, IDC grade III; Lane 6, patient C, fibrocystic disease; Lane 7, patient C, NM breast tissue; Lane 8, patient C, NM breast tissue;
Lane 9, patient D, high-grade IDC; Lane 10, patient D, NM breast tissue; Lane 11, patient D, IDC grade III; Lane 12, patient E, IDC grade I; Lane 13, patient E, IDC grade I; Lane
14, negative control; Lane 15, extraction control; Lane 16, patient F, IDC grade II; Lane 17, patient F, low-grade ductal carcinoma in situ; Lane 18, patient G, IDC grade II; Lane 19,
patient G, high-grade ductal carcinoma in situ; Lane 20, patient G, high-grade ductal carcinoma in situ; Lane 21, patient H, IDC grade II; Lane 22, patient H, papillary serous
adenocarcinoma; Lane 23, patient I, IDC grade II; Lane 24, patient I, basal cell carcinoma; Lane 25, patient J, IDC grade I; Lane 26, patient J, NM lymph node; Lane 27, negative
control; Lane 28, extraction control.
4756
MMTV-LIKE SEQUENCES AND PREMALIGNANT BREAST CONDITIONS
Research.
on June 12, 2013. © 2004 American Association for Cancercancerres.aacrjournals.org Downloaded from
MMTV-like sequences. This was not due to contamination because
appropriate controls and procedures were undertaken as described
above, and the result were reproducible. All secondary tumor biopsies
were negative from the 26 breast cancer samples negative on initial
PCR for MMTV-like sequences. Twenty-two of the 26 negative tumor
biopsies were located in the breast; however, there was one case each
of a second biopsy taken from lymph node, nipple, leg, and skin
tissue, all of which were negative for MMTV-like sequences.
Female Samples. An additional 136 female breast cancer samples
were tested for the presence of MMTV-like sequences, and 43 sam-
ples were positive (32%). Of these 43 positive samples, a gradient of
positivity was observed with increasing severity of breast cancer. The
percentage of MMTV-positive tumors was significantly higher in IDC
grade II (34%; P ⫽ 0.00034) and IDC grade III tumors (38%;
P ⫽ 0.00002) when compared with IDC grade I tumors (23%; Table
2). Common breast lesions of females, identified as premalignant by
some authors (11–17), were also tested for MMTV-like sequences
because these conditions have been suspected to be risk factors for
subsequent breast cancer. Five of 25 (20%) fibroadenoma, 7 of 25
(28%) fibrocystic disease, and 1 of 4 (25%) hyperplasia samples
tested were positive for MMTV-like sequences. Sequences amplified
from female premalignant tissues were between 95.8% and 97.6%
similar to the MMTV C3H strain (GenBank accession numbers
AY600608-AY600615). The sequence differences to MMTV C3H
noted in female premalignant breast conditions were not different
from those noted previously in female breast cancer samples (7). The
difference in prevalence of MMTV-like sequences between all pre-
malignant breast lesions and normal breast tissues was found to be
highly significant (P ⫽ 0.00001; Table 2).
Male Samples. Due to the extreme rarity of male breast cancer in
the Australian and other populations, establishment of a large cohort
was difficult (30). Eight of 13 (62%) male breast cancer samples were
positive for MMTV-like sequences. Sequences amplified from male
breast cancer tissue were between 96.6% and 98.6% similar to the
MMTV C3H strain (GenBank accession numbers AY600596-
AY600601). These 13 samples consisted of 8 IDC grade II tumors,
2 IDC grade III tumors, 2 ductal carcinoma in situ tumors, and
1 adenocarcinoma. Testing of male gynecomastia samples for the
presence of MMTV-like sequences showed that 10 of 52 (19%) were
positive, and these sequences were between 96.5% and 97.4% similar
to the MMTV C3H strain (GenBank accession numbers AY600602-
AY60007; Table 2). Whereas there were significant sequence differ-
ences between isolates from male breast cancer and gynecomastia and
the MMTV C3H strain, there were no significant differences between
sequences amplified from males and those amplified from females.
DISCUSSION
These data contribute to the growing number of studies supporting
the involvement (causal or epiphenomenon) of MMTV-like sequences
Table 1 Summary of longitudinal breast cancer samples positive for MMTV
a
-like sequences with initial and subsequent biopsies from the same individuals
Patient Age (yrs)
b
Tissue Pathology
c
Surgery details MMTV PCR Time period (mo)
d
A 55 Breast IDC II Local excision ⴙ 0
Breast NM Mastectomy ⫺ 0.5
B 76 Breast IDC I Local excision ⴙ 0
Breast NM Removal of additional tissue ⫺ 1
C 37 Breast IDC III Local excision ⴙ 0
Breast Fibrocystic Mastectomy ⴙ 2
Breast NM Reconstruction ⫺ 7
Skin NM Scar tissue removal ⫺ 24
D 36 Breast IDC high Mastectomy ⴙ 0
Breast NM Removal of additional tissue ⫺ 1
Breast IDC III Removal of tissue in chest wall ⴙ 24
E 64 Breast IDC I Lumpectomy ⴙ 0
Breast IDC I Mastectomy ⴙ 1
F 65 Breast IDC II Local excision ⴙ 0
Breast Low DCIS Removal of additional tissue ⴙ 0.5
G 50 Breast IDC II Axillary clearance ⴙ 0
Breast High DCIS Removal of additional tissue ⴙ 2
Breast High DCIS Mastectomy ⴙ 4
H 78 Breast IDC II Mastectomy ⴙ 0
Cervix Papillary serous adenocarcinoma Cervical biopsy ⴙ 48
I 66 Breast IDC II Mastectomy ⴙ 0
Neck Basal cell carcinoma Biopsy ⫺ 12
J 47 Breast IDC I Local excision ⴙ 0
Lymph Node NM Axillary dissection ⴙ 0.75
a
MMTV, mouse mammary tumor virus; IDC, infiltrating ductal carcinoma; NM, nonmalignant tissue as diagnosed pathologically; Low, low-grade; DCIS, ductal carcinoma in situ;
High, high-grade.
b
Age at initial presentation.
c
Pathology was classified according to Refs. 25 and 26.
d
Time period after initial breast biopsy.
Table 2 Summary of archival breast tissue samples tested using seminested PCR,
showing the percentage of samples positive for MMTV
a
-like sequences
Tissue type Total no. studied PCR positive 关no. (%)兴
Females
Normal
b
111 2 (1.8)
Fibroadenoma 25 5 (20)
Hyperplasia 4 1 (25)
Fibrocystic 25 7 (28)
Female breast cancer (total) 136 43 (32)
DCIS
c
8 2 (25)
IDC
c
grade I
40 9 (23)
d
IDC grade II 56 19 (34)
IDC grade III 40 15 (38)
Males
Gynecomastia 52 10 (19)
Male breast cancer (total) 13 8 (62)
DCIS 2 1 (50)
IDC grade II 8 5 (63)
IDC grade III 2 1 (50)
Adenocarcinoma 1 1 (100)
a
MMTV, mouse mammary tumor virus; DCIS, ductal carcinoma in situ; IDC, infil
-
trating ductal carcinoma.
b
Normal breast tissue was from reduction mammoplasties, as described previously (7).
One positive was shown to have had prior breast cancer; the other positive had subsequent
breast cancer (10).
c
Ductal carcinoma in situ and infiltrating ductal carcinoma.were classified according
to Refs. 25 and 26.
d
P ⫽ 0.00034 compared with IDC grade II; P ⫽ 0.00002 compared with IDC grade
III (Fisher’s exact test).
4757
MMTV-LIKE SEQUENCES AND PREMALIGNANT BREAST CONDITIONS
Research.
on June 12, 2013. © 2004 American Association for Cancercancerres.aacrjournals.org Downloaded from
in human breast cancer. There are several postulates that need to be
fulfilled to establish a causal link between an agent and tumor devel-
opment (31, 32). Firstly, it must be conclusively shown that the
putative causative agent is consistently associated with the disease in
question. Three independent groups have now demonstrated the pres-
ence of MMTV-like sequences in a large proportion of breast cancer
samples, as opposed to normal breast samples (1, 6, 7). Additionally,
MMTV-like sequences have also consistently been shown to be
present in a very low percentage of normal breast tissues (0–1.8%),
including those from within the same breast (1, 7, 33). Furthermore,
the longitudinal study reported here shows that all NM breast tissues
excised up to 24 months after breast cancer surgery are negative for
MMTV-like sequences. The specificity of detecting MMTV-like se-
quences in virus-associated tumors is also supported by the 26 cases
of breast cancer that were initially negative for MMTV and remained
negative in their secondary tumor biopsy samples, which were located
in the breast or elsewhere. The one other cancer positive for MMTV-
like sequences was a case of papillary serous adenocarcinoma of the
endocervix, a gynecological carcinoma (34, 35). This carcinoma oc-
curred 4 years after a MMTV-like sequence-positive breast cancer
was treated in the same woman.
The second postulate to be fulfilled in proving causality is to show
that the suspected casual agent precedes the disease (31, 32). This has
not yet been demonstrated in relation to MMTV-like sequences and
human breast cancer. We have attempted to address this postulate by
studying longitudinal breast cancer samples from a cohort of women,
to follow the progression from normal breast pathology to breast
cancer. The second approach taken to address this postulate was to test
benign and possibly precancerous breast disease samples from both
males and females for MMTV-like sequences.
For the first time, a clear gradient of samples positive for MMTV-
like sequences with increasing severity of breast cancer has been
demonstrated. The percentage of female breast cancer samples posi-
tive for MMTV-like sequences increased from 23% of IDC grade I
tumors, to 34% of IDC grade II tumors to 38% of IDC grade III
tumors. Furthermore, the prevalence of MMTV-like sequences in
premalignant breast lesions (20–28%) was lower than that of cancer-
ous tissue yet significantly higher (P ⫽ 0.00001) than that recorded in
normal breast tissue (1.8%; Ref. 7). The recent description that the
two cases of MMTV-positive normal breast tissue both had episodes
of breast cancer adds further support to the association of a MMTV-
like virus with breast cancer (10). The gradient of MMTV prevalence
with severity was also found in tumors taken from the male cohort,
with 19% of gynecomastia samples positive for MMTV-like se-
quences compared with 62% of male breast cancer samples. The
presence of MMTV-like sequences in fibroadenoma, fibrocystic dis-
ease, and gynecomastia samples is intriguing. There is evidence that
these conditions increase a patient’s risk for subsequent breast cancer.
If these are premalignant conditions, the presence of sequences from
a possible oncogenic virus is of great interest. This raises the possi-
bility that the presence of these sequences may act as a marker for
future carcinogenesis. However, the possibility that these sequences
do not contribute to the etiology of breast cancer and are instead an
epiphenomenon cannot be ruled out at this stage. The absence of
MMTV-like sequences from normal breast tissues anatomically re-
lated (NM tissue adjacent to MMTV-positive cancer tissue) and
anatomically unrelated (normal breast tissue from reduction mammo-
plasties) to cancerous tissues suggests that these MMTV-like se-
quences do play a role in development of breast cell oncogenesis.
The connection between MMTV-like sequences and hormones is
not yet clear; however, the results from this study suggest that some
link exists. Breast cancer is a hormonally related tumor, as is endo-
metrial carcinoma, both of which have been shown to be positive for
MMTV-like sequences. The female premalignant breast lesions and
male gynecomastia samples with significant rates of MMTV positiv-
ity (20–28% and 19%, Table 2) have strong links to hormonal
imbalances of the breast (36, 37). Both MMTV and the putative
human homolog of the virus have been shown to have hormone-
responsive elements in the long terminal repeat regions of their
genomes (5, 38). We have previously proposed a multifactorial model
for breast carcinogenesis involving viral infection, hormones, and
genetic elements (18), and these additional data are consistent with
such a model.
Overall, these new data support the association of a MMTV-like
virus with human breast cancer. This study was conducted indepen-
dently of earlier studies reporting a high prevalence of MMTV-like
sequences in human breast cancer (1, 6) and is in direct contrast to two
recent negative reports questioning the association of MMTV-like
sequences with breast cancer (8, 9). We have carefully refined
the detection of MMTV-like sequences in formalin-fixed, paraffin-
embedded breast tissues and used a different approach to the question
of causality or epiphenomenon than previously undertaken. This is the
first report of MMTV-like sequences in male gynecomastia samples
and the first report to use molecular techniques to describe the
prevalence of these sequences in male breast cancer and female
premalignant breast lesions. These data, taken together, add to the
growing number of studies implicating a MMTV-like virus in human
breast cancer, although a clear causal relationship of MMTV to breast
cancer remains to be established.
ACKNOWLEDGMENTS
We thank Ting Ly and Enisa Hasic for technical assistance.
REFERENCES
1. Wang Y, Holland JF, Bleiweiss IJ, et al. Detection of mammary tumor virus env
gene-like sequences in human breast cancer. Cancer Res 1995;55:5173–9.
2. Wang Y, Go V, Holland JF, Melana SM, Pogo BGT. Expression of mouse mammary
tumor virus-like env gene sequences in human breast cancer. Clin Cancer Res
1998;4:2565–8.
3. Wang Y, Pelisson I, Melana SM, et al. MMTV-like env gene sequences in human
breast cancer. Arch Virol 2001;146:171–80.
4. Melana SM, Picconi MA, Rossi C, et al. Detection of murine mammary tumor virus
(MMTV) env gene-like sequences in breast cancer from Argentine patients. Medicina
2002;62:323–7.
5. Liu B, Wang Y, Melana SM, et al. Identification of a proviral structure in human
breast cancer. Cancer Res 2001;61:1754–9.
6. Etkind P, Du J, Khan A, Pillitteri J, Wiernik PH. Mouse mammary tumor virus-like
env gene sequences in human breast tumors and in a lymphoma of a breast cancer
patient. Clin Cancer Res 2000;6:1273–8.
7. Ford CE, Rawlinson WD, Tran D, et al. MMTV-like gene sequences in breast tumors
of Australian and Vietnamese women. Clin Cancer Res 2003;9:1118–20.
8. Zangen R, Harden S, Cohen D, Parrella P, Sidransky D. Mouse mammary tumor-like
env gene as a molecular marker for breast cancer? Int J Cancer 2002;102:304–7.
9. Witt A, Hartmann B, Marton E, et al. The mouse mammary tumor virus-like env gene
sequence is not detectable in breast cancer tissue of Austrian patients. Oncology Rep
2003;10:1025–9.
10. Ford CE, Faedo M, Delprado W, Rawlinson WD. Corrigium to “mouse mammary
tumor virus-like gene sequences in breast tumors of Australian and Vietnamese
women [Letter]. Clin Cancer Res 2004;10:802.
11. Schnitt SJ. Benign breast disease and breast cancer risk: potential role for antiestro-
gens. Clin Cancer Res. 2001;7:4419s–22s.
12. Schnitt SJ. Benign breast disease and breast cancer risk: morphology and beyond.
Am J Surg Pathol 2003;27:836–41.
13. Ali-Fehmi R, Carolin K, Wallis T, Visscher W. Clinocopathologic analysis of breast
lesions associated with multiple papillomas. Hum Pathol 2003;34:234–9.
14. Going JJ. Stages on the way to breast cancer. J Pathol 2002;199:1–3.
15. Hoogerbrugge N, Bult P, de Widt-Levert LM, et al. High prevalence of premalignant
lesions in prophylactically removed breast from women at hereditary risk for breast
cancer. J Clin Oncol 2003;21:41–5.
16. Levi F, Randimbison L, Te VC, La Vecchia C. Incidence of breast cancer in women
with fibroadenoma. Int J Cancer 1994;57:681–3.
17. Simmons RM, Osborne MP. The evaluation of high risk and pre-invasive breast
lesions and the decision process for follow up and surgical intervention. Surg Oncol
1999;8:55–65.
4758
MMTV-LIKE SEQUENCES AND PREMALIGNANT BREAST CONDITIONS
Research.
on June 12, 2013. © 2004 American Association for Cancercancerres.aacrjournals.org Downloaded from
18. Lawson JS, Tran D, Rawlinson WD. From Bittner to Barr: a viral, diet and hormone
breast cancer aetiology hypothesis. Breast Cancer Res 2000;3:81–5.
19. Daniels IR, Layer GT. Gynaecomastia. Eur J Surg 2001;167:885–92.
20. Olsson HK, Bladstrom A, Alm P. Gynecomastia and the risk for malignant tumours:
a cohort investigation. BMC Cancer 2002;2:26–31.
21. Giordano SH, Buzdar AU, Hortobagyi GN. Breast cancer in men. Ann Intern Med
2002;137:678–87.
22. Clamp A, Danson S, Clemons M. Hormonal risk factors for breast cancer: identification,
chemoprevention, and other intervention strategies. Lancet Oncol 2002;3:611–9.
23. Meguerditchian AN, Falardeau M, Martin G. Male breast carcinoma. Can J Surg
2002;45:296–302.
24. Lloyd RV, Rosen PP, Sarkar NH, et al. Murine mammary tumor virus related antigen
in human male mammary carcinoma. Cancer (Phila) 1983;51:654–61.
25. Dupont WD, Page DL. Risk factors for breast cancer in women with proliferative
breast disease. New Engl J Med 1985;312:146–51.
26. Bloom HJG, Richardson WW. Histological grading and prognosis in breast cancer.
Br J Cancer 1957;11:359–77.
27. Kwok S, Higuchi R. Avoiding false positives with PCR. Nature (Lond) 1989;339:237–8.
28. Greer CE, Peterson SL, Kiviat NB, Manos MM. PCR amplification from paraffin-
embedded tissues. Effects of fixative and fixation time. Am J Clin Pathol 1991;95:
117–24.
29. Greer CE, Lund JK, Manos MM. PCR amplification from paraffin-embedded tissues:
recommendations on fixatives for long-term storage and prospective studies. PCR
Methods Applications 1991;1:46–50.
30. Australian Institute of Health and Welfare. Cancer in Australia 1998. Canberra,
Australia: Australian Institute of Health and Welfare, Australasian Association of
Cancer Registries, 2001; p. 97.
31. Evans AS, Mueller NE. Viruses and cancer. Causal associations. AEP 1990;1:71–92.
32. Vonka V. Causality in medicine: the case of tumours and viruses. Philos Trans R Soc
Lond 2000;355:1831–41.
33. Melana SM, Holland JF, Pogo BG-T. Search for mouse mammary tumor virus-like
env sequences in cancer and normal breast from the same individuals. Clin Cancer
Res 2001;7:283–4.
34. Batistatou A, Zolota V, Tzoracoleftherakis E, Scopa CD. Papillary serous adenocar-
cinoma of the endocervix: a rare neoplasm. Immunohistochemical profile. Int J
Gynecol Cancer 2000;10:336–9.
35. Re A, Taylor TH, DiSaia PJ, Anton-Culver A. Risk for breast and colorectal cancers
subsequent to cancer of the endometrium in a population-based case series. Gynecol
Oncol 1997;66:255–7.
36. Fuqua SAW, Wiltschke C, Zhang QX, et al. A hypersensitive estrogen receptor-a
mutation in premalignant breast lesions. Cancer Res 2000;60:4026–9.
37. Tan-Chiu E, Wang J, Costantino JP, et al. Effects of tamoxifen on benign breast
diseases in women at high risk for breast cancer. J Natl Cancer Inst (Bethesda)
2003;95:302–7.
38. Wang Y, Pelisson I, Melana SM, Holland JF, Pogo BG. Detection of MMTV-like
LTR and LTR-env gene sequences in human breast cancer. Int J Oncol 2001;18:
1041–4.
4759
MMTV-LIKE SEQUENCES AND PREMALIGNANT BREAST CONDITIONS
Research.
on June 12, 2013. © 2004 American Association for Cancercancerres.aacrjournals.org Downloaded from
