Content uploaded by Bruna Rios Coelho Alves
Author content
All content in this area was uploaded by Bruna Rios Coelho Alves on Dec 15, 2014
Content may be subject to copyright.
2222
Key words: agouti-related protein, arcuate nucleus, bovine, leptin, neuropeptide Y, puberty
© 2012 American Society of Animal Science. All rights reserved. J. Anim. Sci. 2012.90:2222–2232
doi:10.2527/jas2011-4684
ABSTRACT: It was hypothesized that a high-concen-
trate diet fed during early calfhood alters the expression
of genes within the arcuate nucleus that subserve repro-
ductive competence. Beef heifers (n = 12) were weaned
at approximately 3 mo of age, and after acclimation, were
allocated randomly to 1 of 2 nutritional groups: 1) High
Concentrate/High Gain (HC/HG), a high concentrate diet
fed to promote a gain of 0.91 kg/d; or 2) High Forage/
Low Gain (HF/LG), a forage-based diet fed to promote a
gain of 0.45kg/d. Experimental diets were fed under con-
trolled intake for 91 d. At the end of 91 d, heifers were
slaughtered by humane procedures, blood samples were
collected, brains were removed, liver weights were deter-
mined, and rumen fl uid was collected for VFA analyses.
Tissue blocks containing the hypothalamus were dis-
sected from the brains, frozen, and cut using a cryostat,
and frozen sections were mounted on slides. Tissue from
the arcuate nucleus (ARC) was dissected from sections
for mRNA extraction. Microarray analysis was used to
assess genome-wide transcription in the ARC using a
60-mer oligonucleotide 44K bovine expression array.
The ADG was greater (P < 0.001) in heifers fed the HC/
HG diet than in heifers fed the HF/LG diet. At slaughter,
mean propionate to acetate ratios in the ruminal fl uid and
liver weight as a percentage of BW were increased (P <
0.005) in HC/HG compared with HF/LG heifers. Mean
serum concentrations of insulin (P < 0.05) and IGF-1 (P <
0.005) were greater, and leptin tended to be greater (P =
0.1) in HC/HG heifers compared with HF/LG heifers.
Approximately 345 genes were observed to be differen-
tially expressed in the HC/HG group with approximately
two-thirds of the genes exhibiting increased expression in
the HC/HG group. Genes exhibiting decreased expression
in the HC/HG group included agouti-related protein and
neuropeptide Y, products of which are known to regulate
feed intake and energy expenditure. Functional annota-
tion of enriched Gene Ontology terms indicates that a
number of biological processes within the hypothala-
mus are affected by consumption of high-concentrate
diets, including those related to control of feed intake,
regulation of cellular metabolic processes, receptor and
intracellular signaling, and neuronal communication. In
summary, dietary treatments shown previously to accel-
erate the timing of pubertal onset in heifers increased
ruminal propionate, promoted enhanced metabolic hor-
mone secretion, and altered gene expression in the ARC.
Gene expression in the arcuate nucleus of heifers is affected by
controlled intake of high- and low-concentrate diets1
C. C. Allen,*† B. R. C. Alves,† X. Li, ‡ L. O. Tedeschi,† H. Zhou, ‡ J. C. Paschal,§
P. K. Riggs,† U. M. Braga-Neto,# D. H. Keisler,║ G. L. Williams,*† and M. Amstalden†2
*Animal Reproduction Laboratory, Texas AgriLife Research, Beeville 78102;
Departments of †Animal Science, ‡Poultry Science, and #Electrical and Computer Engineering,
Texas A&M University, College Station 77843; §Texas AgriLife Extension, Texas AgriLife Research and
Extension Center, Corpus Christi 78406; and Division of Animal Sciences, University of Missouri, Columbia 65211
INTRODUCTION
Age at onset of puberty is largely dependent upon
rate of growth during the prepubertal period. Nutrient
restriction during postnatal development delays puber-
ty (Day et al., 1984) by inhibiting the release of GnRH
(I’Anson et al., 2000). Hormones such as insulin (Adam
and Findlay, 1998), IGF-1 (Hiney et al., 1991; Yelich et
al., 1996), GH (Simpson et al., 1991), and leptin (Garcia
1
Supported by Texas Beef Initiative grant 114443, Texas AgriLife
Research projects H-6881 and TEX09202 of the Texas A&M System,
and Agriculture and Food Research Initiative Competitive Grant no.
2009-65203-05678 from the USDA National Institute of Food and
Agriculture. We acknowledge Kelli Kochan, Randel Franke, and Ray
Villarreal for providing technical assistance and A. F. Parlow, NIDDK
National Hormone and Peptide Program, for providing IGF-1 antiserum.
2Corresponding author: m.amstalden@tamu.edu
Received September 10, 2011.
Accepted January 10, 2012.
Gene expression in arcuate nucleus of heifers 2223
et al., 2003), and nutrients such as glucose (Adam and
Findlay, 1998) and fatty acids (Garcia et al., 2003) have
been implicated in signaling nutritional status. These
signals act within the hypothalamus to regulate feed in-
take, energy expenditure, and neuroendocrine functions,
including reproduction (Hiney et al., 1996; Zieba et al.,
2004; Stanley et al., 2005). Although multiple hypotha-
lamic areas are involved in the pathways mediating the
metabolic regulation of neuroendocrine function, major
metabolic-sensing neurons are located within the arcu-
ate nucleus (ARC) of the hypothalamus. Neuropeptide
Y (NPY)/agouti-related protein (AgRP) neurons present
in the ARC (Broberger et al., 1998; Hahn et al., 1998)
are responsive to changes in metabolic status (McShane
et al., 1993; Stanley et al., 2005) and appear to play a
major role in mediating the effects of nutrition on repro-
duction (Raposinho et al., 1999).
In maturing heifers, accelerated growth during early
calfhood infl uences age at puberty. Heifers weaned at
3 mo of age and fed diets that promote rapid rates of
BW gain between 3 and 7 mo of age reach puberty ear-
lier and at lighter BW than heifers fed diets to gain BW
at a reduced rate during the same period (Gasser et al.,
2006a–d). Increased BW gain later during calfhood does
not have the same impact. Therefore, a critical window
for nutritional imprinting of neuroendocrine functions
that regulate age at onset of puberty appears to exist ear-
ly in juvenile development. In the study reported herein,
we examined whether nutritional inputs during early
calfhood result in changes in gene expression within the
ARC that may be critical for the integration of metabolic
and reproductive functions. Greatest emphasis was giv-
en to genes that have been well characterized relative to
their involvement in sensing nutritional inputs.
MATERIALS AND METHODS
All animal-related procedures used in this study
were approved by the Institutional Agricultural Animal
Care and Use Committee of the Texas A&M System.
Animal Procedures
Twelve Angus-sired heifers (½ Angus, ¼ Hereford,
¼ Brahman) were weaned at approximately 3 mo of age,
stratifi ed by date of birth, and assigned randomly to 1 of
2 dietary treatments (n = 6/treatment) in 2 replicates (n =
6/replicate): 1) High-Forage/Low-Gain (HF/LG): ADG
of 0.45 kg/d (n = 6); and 2) High-Concentrate/High-
Gain (HC/HG): ADG of 0.91 kg/d (n = 6). Diets were
balanced using the Large Ruminant Nutrition System
(http://nutritionmodels.tamu.edu/lrns.htm), which is
based on the Cornell net Carbohydrate and Protein
System as described by Fox et al. (2004). Targeted ADG
was attained by adjustments in DMI based on ADG de-
termined weekly. Ingredients and diet chemical compo-
sitions are presented in Table 1.
Heifers in each group were allocated to pens measur-
ing 25.9 m × 9.5 m and fed an acclimation diet for 2 wk
post-weaning. During the fi rst week of the acclimation
period, heifers in both treatments were fed the HF diet
up to a maximum of 2.7 kg/heifer daily. During the sec-
ond week of the adaptation period, heifers assigned to the
HC/HG group were fed a diet consisting of 50% HF and
50% HC up to a maximum of 2.7 kg/heifer daily. Heifers
assigned to the HF/LG treatment were fed the HF diet
through the second week of the adaptation period. After
the 2-wk adaptation period, heifers were fed 100% of
their respective treatment diets for 14 wk. Heifers were
weighed weekly for the duration of the experiment.
At the completion of the experimental feeding pe-
riod, heifers were slaughtered by humane procedures
after overnight fasting. A block of tissue containing the
septum, preoptic area, and hypothalamus was dissected
and frozen in liquid-nitrogen vapor. Tissue blocks were
stored at 80°C until further processing. A composite
of ruminal fl uid sample was obtained from each heifer
immediately post mortem by mixing 3 subsamples of
ruminal fl uid collected from the dorsal, ventral, and
caudal aspects of the rumen. The ruminal fl uid samples
were processed as described subsequently and frozen at
20°C for determination of VFA profi le. A single blood
sample (15 mL) was collected and liver weights were
obtained at slaughter. Blood samples were placed on ice
immediately after collection. Serum was obtained from
blood samples by centrifugation (2,200 × g for 20 min at
4°C) and stored at 20°C.
Hormone Assays
Circulating concentrations of insulin, IGF-I, and
leptin were determined in serum samples collected at
Table 1. Ingredients and chemical composition of high-
forage (HF) and high-concentrate (HC) diets fed to heif-
ers during the study
Item HF HC
Ingredients
Cracked corn, % 39.03 50.75
Soybean meal, % — 17.61
Chopped coastal Bermuda grass hay, % 3.47 26.95
Dehydrated alfalfa meal pellet, % 57.30 3.83
Calcium carbonate, % — 0.86
Calcium monophosphate, % 0.20 —
Vitamin A/D/E premix, mg/kg 71 73
Chemical composition
ME, Mcal/kg 0.48 0.53
CP, % DM 14.3 17.5
Digestible intake protein, % 66 67
Allen et al.
2224
the time of slaughter. Concentrations of insulin were
determined by a single-phase RIA kit (Coat-A-Count;
Siemens, Los Angeles, CA) reported previously for
bovine serum (DiCostanzo et al., 1999; Accorsi et al.,
2005). However, we used a bovine insulin preparation
for standards and references instead of the human insu-
lin standards provided with the kit. Minimum detectable
concentrations were 0.1 ng/mL and intra- and inter-as-
say CV were 9.8% and 14.5%, respectively. Circulating
concentrations of IGF-1 were determined in triplicate
samples as reported previously (Ryan et al., 1994), ex-
cept that we used a rabbit anti-IGF-1 serum provided
by the National Hormone and Pituitary Program (NHPP,
Torrance, CA). Concentrations of IGF-1 in samples col-
lected at slaughter were determined in a single assay and
intra-assay CV was 19%. Circulating concentrations of
leptin were determined in a single RIA as described pre-
viously (Delavaud et al., 2000). Sensitivity of the assay
was 0.1 ng/mL and intra-assay CV averaged 12%.
Volatile Fatty Acid Analysis of Ruminal Fluid
Ruminal fl uid collected from experimental animals
at slaughter was mixed briefl y, transferred to 15-mL
conical tubes, centrifuged, and the aqueous portion was
transferred to a fresh 15-mL conical tube. Samples were
stored at 20°C until analysis for VFA composition us-
ing GLC (Salanitro and Muirhead, 1975).
Tissue Processing
Frozen blocks of diencephalic tissue were cut in
coronal sections of 20 m using a cryostat. Tissue sec-
tions were thaw-mounted on Superfrost/Plus glass mi-
croscope slides (Fisher Scientifi c, Waltham, MA) and
frozen immediately. Slides were then stored at 80°C
until processing.
RNA Isolation and Extraction
A single series of tissue sections from the hypothal-
amus of each heifer containing sections 200 m apart
was processed for Cresyl violet staining and observed
using bright- and dark-fi eld microscopy to determine
the location of the ARC. Location of the ARC was
based upon identifi cation of well-established anatomi-
cal markers for rat (Pellegrino et al., 1979) and sheep
(Lehman et al., 1993) brains. A separate series of sec-
tions containing the ARC was used for tissue dissection
and RNA isolation. Using a 25-ga needle, an area of ap-
proximately 1 mm in diameter encompassing the ARC
was scraped from the slides (Figure 1). Scraped tissue
was placed immediately in lysis solution (RNAqueous-
Micro; Ambion, Austin, TX). Sections were maintained
frozen during scraping and, on average, approximately
48 sections from each heifer were used. Total RNA was
collected from tissue scrapes using RNAqueous-Micro
(Ambion) according to manufacturer’s instructions for
the laser-capture micro-dissected tissue protocol, except
that RNA was harvested into 400 L of lysis solution
(RNAqueous-Micro) and precipitated with 200 L of
100% ethanol. Samples were incubated in elution solu-
tion (RNAqueous-Micro) for 5 min before being elut-
ed through the column. Total RNA isolated was treat-
ed with DNase to remove genomic DNA. Quantity of
RNA was determined by spectrophotometry (NanoDrop
ND-1000; ThermoFisher Scientifi c, Wilmington, DE).
Quality of RNA was determined using the RNA 6000
Pico Kit (Agilent Technologies, Santa Clara, CA), ac-
cording to manufacturer’s instructions.
Figure 1. Cresyl violet-stained section through the mediobasal hypo-
thalamus depicting an area (asterisk) of the arcuate nucleus dissected for RNA
extraction. Dissection was based on anatomical landmarks: ARC = arcuate
nucleus; FX = fornix; me = median eminence; VMH = ventromedial hypo-
thalamus; 3V = third ventricle. Scale bar = 500 m.
Gene expression in arcuate nucleus of heifers 2225
Microarray Procedure and Analysis
cRNA Labeling. Total RNA (120 ng) from each
heifer was initially reverse transcribed to cDNA us-
ing the 2-color Quick Amp Labeling Kit (Agilent
Technologies). Labeled cRNA was synthesized by in
vitro-transcription of cDNA in presence of either cya-
nine-3 (Cy3) or cyanine-5 (Cy5; RNA Spike-In Kit,
Two-Color; Agilent Technologies) as per manufacturer’s
instructions. One-half of the samples from each dietary
group were labeled with Cy3 and the other half with
Cy5. Labeled cRNA was purifi ed using RNeasy Mini
columns (Qiagen, Valencia, CA). Yield and specifi city
of cRNA were determined based on fl uorospectrometry
(NanoDrop ND-1000; ThermoFisher Scientifi c).
Microarray Hybridization. Microarray hybrid-
izations were conducted using the Agilent two-dye 4
× 44 K bovine gene expression array (G2514; Agilent
Technologies). Each array contained 44,407 oligo probes,
1,264 of which were positive control probes, and 153
were negative control probes. Each probe was replicat-
ed twice on each array; therefore, each array contained
21,495 unique oligos.
Hybridizations were performed using the Gene
Expression Hybridization Kit (Agilent Technologies)
following manufacturer instructions. Six array hybrid-
izations were conducted using a dye-swap design. Three
of the hybridizations were performed with Cy3-labeled
cRNA from each of 3 heifers in the HC/HG group and
Cy5-labeled cRNA from each of 3 heifers in the HF/LG
group. The remaining 3 hybridizations were performed
with Cy5-labeled cRNA from each of 3 heifers in the
HC/HG group and Cy3-labeled cRNA from each of 3
heifers in the HF/LG group. The dye-swap design result-
ed in each array being hybridized to either Cy3-labeled
HC/HG cRNA and Cy5-labeled HF-LG samples, or
Cy5-labeled HC/HG and Cy3-labeled HF/LG samples.
Arrays were incubated at 65°C with rotation for 17 h in
a microarray hybridization chamber. After hybridization,
arrays were washed according to the Agilent Two-Color
Microarray protocol (Agilent Technologies).
Microarray Imaging, Data Acquisition,
Normalization and Analysis. Agilent arrays were
scanned at 5-m resolution on an Axon GenePix 4100
scanner (Molecular Devices Corporation, Sunnyvale,
CA). Signal intensities were quantifi ed using the GenePix
pro 6.0 software (Molecular Devices Corporation,
Downingtown, PA) and following procedures described
previously (Li et al., 2008). Normalization of log-ratios
was accomplished via intensity-dependent nonlinear
location shift using Loess regression. Differential ex-
pression was assessed by fi tting a linear model to each
probe, expressing the observed log-ratio as the sum of a
probe dye-effect, the true log-ratio between the 2 dietary
groups, plus 0-mean noise. The presence of a signifi cant
true non-zero log-ratio between the dietary groups (thus
removing the dye effect) was tested for each probe us-
ing a Bayesian procedure described in Smyth (2004).
The resulting P-value is moderated by using a SD that
borrows information from correlated probes, thereby in-
creasing statistical power. In addition, statistical power
is further increased by taking into consideration in the
analysis the estimated correlation between pairs of du-
plicated spots. The analysis is weighted such that only
probes fl agged as good quality by the GenePix software
are used. The multiple-testing problem created by test-
ing each probe was addressed by adjusting the P-values
according to the False-Discovery Rate (FDR) method
(Benjamini and Hochberg, 1995).
Bioinformatics. Functional annotation of differen-
tially expressed genes was performed using the Database
for Annotation, Visualization and Integrated Discovery
(DAVID) bioinformatics resources (Huang et al., 2009).
Gene Ontology terms for Biological Process containing
3 or more genes with > 1.5-fold enrichment were con-
sidered signifi cant clusters. Terms for Biological Process
were chosen because they represent the most relevant
component of the Gene Ontology annotation for this study.
Quantitative Reverse Transcription-PCR
Four genes exhibiting differential expression in the
microarray experiment were selected for quantitative real-
time reverse transcription-PCR analysis. Glyceraldehyde-
3-phosphate dehydrogenase (GAPDH) and ribosomal
protein L19 (RPL19) were used as reference control
genes. Primers used for real-time reverse transcription-
PCR were designed using Oligo 6 software (Molecular
Biology Insights, Inc., Cascade, CO) and sequences
are shown in Table 2. Specifi city of primer sequences
were investigated using the Basic Local Alignment Tool
(BLAST; National Library of Medicine). Amplifi cation
effi ciency was > 90% for all primer pairs.
Total RNA (20 to 200 ng) isolated from the ARC was
reverse transcribed to cDNA using the High Capacity
cDNA Reverse Transcription Kit (Applied Biosystems,
Foster City, CA) and oligo (dT)
20 primer (Integrated
DNA Technologies, Coralville, IA). Briefl y, PCR reac-
tions contained 2 L cDNA (diluted 1:4 in 25 ng/L
yeast tRNA), 10 L SYBR GreenER PCR master mix
(Invitrogen, Carlsbad, CA), 0.6 L of each forward and
reverse primers, and RNase-free water to a fi nal volume
of 20 L. Reactions were performed in duplicates for
each sample. Quantitative real-time reverse transcrip-
tion-PCR was carried out in 96-well plates using the
ABI Prism 7900HT sequence detection system (Applied
Biosystems). Cycling conditions were 95°C for 10 min
followed by 40 cycles of 95°C for 15 s and 60°C for
Allen et al.
2226
1 min. A fi nal cycle with a slow increase in temperature
to 95°C was used to produce a dissociation curve of PCR
products and confi rm the absence of non-specifi c ampli-
fi cation. No-template control was used to verify the ab-
sence of primer-dimer amplifi cation. Negative control
reactions (no reverse transcriptase) confi rmed the ab-
sence of genomic DNA carryover in RNA preparations.
Quantitative reverse transcription-PCR data
were analyzed by relative quantifi cation (Livak and
Schmittgen, 2001). Threshold cycle (Ct) data for each
gene was normalized to the geometric mean Ct values
of the control genes GAPDH and RPL19 for each sam-
ple (Ct), and transformed to the average expression
of HF/LG samples (Ct). The VBA applet, geNorm
(Vandesompele et al., 2002) was used to determine sta-
bility of control genes. Mean fold change in the HC/HG
group was compared with the HF/LG group.
Statistical Analysis
Initial and fi nal BW, cumulative ADG, liver weight
(as percentage of BW), ruminal propionate to acetate ra-
tio, hormone concentrations at slaughter, and mean fold
change of selected differentially expressed genes were
analyzed using the PROC MIXED procedure (SAS Inst.
Inc., Cary, NC). Dietary treatment, replicate, and the
treatment by replicate interaction were used as sources
of variation. Liver weight as a percent of BW and pro-
pionate to acetate ratio were transformed using the arc-
sine of the square root method to normalize data before
performing the statistical analysis.
RESULTS
Performance, Ruminal Volatile Fatty Acid, and
Metabolic Hormone Measures
Mean BW at the beginning of the study did not dif-
fer between groups (HF/LG, 139.7 ± 6.4 kg; HC/HG,
127 ± 6.4 kg; P > 0.1). Body weight increased linearly in
both dietary groups (Figure 2). As expected based on the
experimental design, ADG was greater (P < 0.0001) in
HC/HG heifers (0.98 ± 0.05 kg/d) than in HF/LG heifers
(0.51 ± 0.06 kg/d).
Mean BW, mean liver weight (as a percentage of
BW), and propionate to acetate ratio in the ruminal fl uid
were greater (P < 0.05) at the time of slaughter in HC/
HG heifers than in HF/LG heifers (Table 3). Mean cir-
culating concentrations of insulin (P < 0.05) and IGF-1
(P < 0.005) were greater at the time of slaughter in HC/
HG heifers than in HF/LG heifers, and circulating con-
centrations of leptin tended to be greater (P = 0.1) in HC/
HG heifers (Table 3).
Microarray Gene Expression
A total of 346 probes presented a signifi cant non-
zero log ratio between the HC/HG and HF/LG groups at
a signifi cance level of 0.05 after multiple-test correction
by the FDR method. Therefore, 346 unique sequences
Figure 2. Mean (± SEM) BW of heifers weaned at 3 mo of age and
fed either a High-Forage/Low-Gain (HF/LG; n = 6) or a High-Concentrate/
High-Gain (HC/HG; n = 6) diet for 14 wk. Body weight of HC/HG heifers
was greater than HF/LG heifers beginning at wk 11 (P < 0.06) and continuing
through wk 14 (P < 0.01 to P < 0.03).
Table 2. Gene name, symbol, primer sequence, and accession number for all genes validated by quantitative reverse
transcription PCR
Gene name Gene symbol Primer sequences (forward/reverse) Accession number
Agouti-related protein AGRP GAAGAGGATAACGAACAG
CAGGGGTTCGTGGTGGGTA
NM_173983
GH receptor GHR ATCACCACAGAAAGCCTTACCACTA
GACAGGTATCTCAGAACTTGGAAC
NM_176608
Neuropeptide Y NPY AAGCAGAGATACGGGAAACGA
ATTGGGAGGACTGGCAGACT
NM_001014845
Prolactin-releasing hormone receptor PRLHR AGGGAGTGAAGGAGCAATAAGCA
GAAGGTAATGGGTTTGAATGGACTA
NM_001030300
Glyceraldehyde-3- phosphate dehydrogenase GAPDH CAGCGACACTCACTCTTCTACCTT
GAACTCTTCCTCTCGTGCTCCT
NM_001034034
Ribosomal protein L19 RPL19 ACCCCAATGAGACCAATGAA
GCAGTACCCTTTCGCTTACCTAT
NC_007317
Gene expression in arcuate nucleus of heifers 2227
(genes) were observed to be differentially expressed in
the ARC of heifers in the HC/HG group compared with
the HF/LG group (adjusted P < 0.05). Among the dif-
ferentially expressed genes, 229 exhibited increased and
117 exhibited decreased expression in HC/HG heifers
compared with HF/LG heifers. Functional annotation of
differentially expressed genes identifi ed enriched Gene
Ontology (GO) terms for biological process in clusters
that included responses to hormones and nutrients, feed-
ing behavior, intracellular signaling, cell to cell commu-
nication and synaptic transmission (Tables 4 and 5). One
of the clusters included down-regulated genes in the ARC
of HC/HG heifers that are involved in regulating feed-
ing behavior. Genes in this cluster included AGRP, NPY,
and prolactin-releasing hormone receptor (PRLHR).
Additional clusters of down-regulated genes in HC/HG
heifers include genes involved in the response to hor-
mones and nutrients, and metabolic processes. Genes
in these clusters included GH receptor (GHR) and sig-
nal transducer and activator of transcription 1 (STAT1),
deiodinase type II (DIO2), and retinol-binding protein 1
(RBP1). Clusters representing genes that were up reg-
ulated in HC/HG heifers included signaling molecules
(phospholipase D2, adenyl cyclase type 1, sphingosine
kinase, tyrosine kinase, and dynamin 2), and molecules
involved in synaptic transmission (voltage-gated potas-
sium channel-interacting protein 2, gamma amino butyr-
ic acid A receptor delta). Genes associated with control
of feed intake were also up-regulated in HC/HG heifers
and included pro-opiomelanocortin (POMC), the gene
encoding the precursor molecule for alpha-melanocyte-
stimulating hormone (α-MSH). A partial list of up-reg-
ulated and down-regulated genes with greatest changes
in the ARC of HC/HG heifers is depicted in Table 6. A
complete list of differentially expressed genes identifi ed
by the microarray analysis is available (see Supplemental
Tables; available in the online version of this paper).
Quantitative Reverse Transcription
PCR of Selected Genes
Neuropeptide Y, AGRP, GHR, and PRLHR genes
were selected for further analysis from the 346 differ-
entially expressed genes because of their known roles
in signaling metabolic status in the hypothalamus and
regulating energy expenditure. Quantitative reverse
transcription-PCR analysis of these genes confi rmed
microarray observations and indicated that mean expres-
sion of NPY (P < 0.001), AGRP (P < 0.001), GHR (P <
0.02), and PRLHR (P < 0.06) genes was less in HC/HG
heifers than in HF/LG heifers (Figure 3).
DISCUSSION
The ARC is a major area of the hypothalamus that
integrates complex signaling pathways regulating met-
abolic and reproductive functions. The ARC region of
the hypothalamus is populated by important metabolic-
sensing neurons (Broberger et al., 1998; Hahn et al.,
1998), as well as neurons implicated in pubertal devel-
opment (Redmond et al., 2011). Because the initiation
of puberty is greatly infl uenced by nutritional balance
and metabolic status, we sought to examine an array of
genes within the ARC that may be responsive to, or may
mediate the effects of, nutritional inputs known to affect
the process of sexual maturation. The precocious puber-
ty model in heifers described by Gasser et al. (2006a–d)
provides an ideal approach for examining the involve-
ment of the ARC in the nutritional regulation of neuro-
endocrine function during early juvenile development.
The microarray and computational methods used in the
Table 4. Functional annotation of most signifi cant enriched
Gene Ontology terms for Biological Process of down-regu-
lated genes in the arcuate nucleus of heifers gaining BW at
high rates (High-Concentrate/High-Gain group)
Biological
process term
Fold
enrichment
No. of
genes
Cellular response to insulin stimulus 9.82 4
Feeding behavior 9.68 4
Hormone metabolic process 7.88 5
Cellular response to hormone stimulus 6.68 5
Regulation of hormone concentrations 5.53 5
Response to peptide hormone stimulus 5.42 5
Gland development 4.95 4
Response to extracellular stimulus 4.55 6
Response to nutrient quantities 4.24 5
Response to endogenous stimulus 3.30 8
Response to hormone stimulus 3.19 7
Table 3. Mean (± SEM) BW, liver weight, rumen pro-
pionate to acetate ratio, and serum concentrations of
metabolic hormones at the time of slaughter in heifers
fed High-Forage/Low-Gain (HF/LG; n = 6) or High-
Concentrate/High-Gain (HC/HG; n = 6) diets for 14 wk
beginning at 16 ± 1 wk of age.
Dietary treatment
Variable HF/LG HC/HG
BW, kg 172.12 ± 9.19a218.49 ± 11.47b
Liver weight, % of BW11.07 ± 0.04c1.42 ± 0.04d
Propionate:acetate1 0.23 ± 0.01c0.31 ± 0.01d
Insulin, ng/mL 0.95 ± 0.07a1.16 ± 0.11b
IGF-1, ng/mL 52.01 ± 4.39c103.75 ± 9.9d
Leptin, ng/mL 2.55 ± 0.35e3.62 ± 0.43f
1Liver weight as percentage of BW and propionate to acetate ratio was
transformed using the arcsine of the square root method to normalize data
before performing statistical analysis. Data shown in the table represents un-
transformed data.
a-fRow means without a common superscript differ (a,b P = 0.05; c,d P <
0.005; e,f P = 0.1).
Allen et al.
2228
current studies provide an opportunity to investigate
gene networks that may be involved in integrating nutri-
ent metabolism and reproductive function. Results from
these studies support the premise that a considerable
number of genes expressed within the ARC are regu-
lated by nutrient intake concurrent with the development
of distinct metabolic and hormonal states. Interestingly,
this differential gene expression was observed in heif-
ers that were under positive nutrient balance, except that
groups differed in the rate at which BW increased.
Using microarray gene expression analysis, we iden-
tifi ed a total of 346 genes that were differentially ex-
pressed between HC/HG and HF/LG heifers at the end of
the 14-wk feeding period (approximately at 7 mo of age).
This observation demonstrates that the heifer is exqui-
sitely sensitive to nutritional input during early calf-hood.
Importantly, nutrient requirements for maintenance were
met, and both groups of heifers were in positive energy
balance. However, nutrient availability for growth dif-
fered between groups. Therefore, differences in gene
expression within the ARC between heifers growing at
distinct rates indicate that the state of nutrient suffi ciency
to support growth involves functional changes within the
hypothalamus early in development. We propose that
those changes may be important for early maturation of
the reproductive neuroendocrine axis. In mice, neuronal
Table 5. Functional annotation of most signifi cant enriched
Gene Ontology terms for Biological Process of up-regulated
genes in the arcuate nucleus of heifers gaining BW at high
rates (High-Concentrate/High-Gain group)
Biological
process term
Fold
enrichment
No. of
genes
Regulation of oxidoreductase activity 9.46 4
Receptor metabolic process 9.15 3
Synaptic vesicle transport 8.60 3
Regulation of amine transport 8.60 3
Cell maturation 6.31 5
Activation of immune response 6.04 6
Feeding behavior 5.48 4
Positive regulation of defense response 5.18 4
Regulation of Rho protein signal transduction 4.78 5
Developmental maturation 4.68 5
Regulation of MAPKKK cascade 4.34 5
Positive regulation of immune response 3.91 6
Positive regulation of response to stimulus 3.61 9
Regulation of cell morphogenesis 3.61 5
Regulation of small GTPase mediated signal transduction 3.38 9
Synaptic transmission 3.17 10
Membrane invagination 3.01 7
Phospholipic metabolic process 2.99 6
Regulation of phosphorylation 2.84 14
Transmission of nerve impulse 2.70 10
Cell-cell signaling 2.68 17
Regulation of protein kinase cascade 2.66 7
Positive regulation of cell communication 2.59 9
Positive regulation of signal transduction 2.57 8
Membrane organization 2.48 10
Regulation of kinase activity 2.38 9
Intracellular signaling cascade 1.81 24
Figure 3. Normalized mean (± SEM) expression of neuropeptide-Y
(NPY), agouti-related protein (AGRP), growth hormone receptor (GHR), and
prolactin-releasing hormone receptor (PRLHR) genes in the arcuate nucleus
of heifers fed a high-forage diet to gain BW at a slow rate (HF/LG; n = 6) and
heifers fed a high-concentrate diet to gain BW at a rapid rate (HC/HG; n = 6).
Expression is relative to mean normalized expression of HF/LG samples in
the experiment. Statistical differences between HF/LG and HC/HG are indi-
cated: *P < 0.001; **P < 0.02; ***P < 0.06.
Table 6. Partial list of differentially-expressed genes in
the arcuate nucleus of heifers fed high-concentrate diets
to gain BW at a rapid rate (High-Concentrate/High-Gain
group)1
Gene symbol Gene description Fold change2
Up-regulated
IGFLR1 IGF-like family receptor 1 1.54
GTF2H5 General transcription factor IIH, polypeptide 5 1.02
GPR45 G protein-coupled receptor 45 1.01
AGOUTI Agouti protein 0.91
LOC513294 Similar to SEC14p-like protein TAP3 0.88
LOC539711 Similar to dedicator of cytokinesis 6 0.82
DSPP Dentin sialophosphoprotein 0.80
TNS4 Tensin 4 0.74
TLR6 Toll-like receptor 6 0.74
RRAD Ras-related associated with diabetes 0.71
Down-regulated
AGRP Agouti related protein -2.36
ORM1 Alpha-1 acid glycoprotein -2.10
NPY Neuropeptide Y -1.65
LOC538993 KIAA0748 ortholog -0.92
CRYM Crystallin, mu -0.90
COL9A3 Collagen, type IX, alpha 3 -0.88
CB456458 Idothyronine, Type II (DIO2) transcript variant 1 -0.83
CRH Corticotropin releasing hormone -0.72
LOC519502 Similar to glutamate receptor interacting protein 1 -0.70
LOC525861 Similar to Homeobox protein orthodpedia -0.68
1Complete list is provided as Supplemental Tables; available in the online
version of this paper.
2Fold change was calculated as the ratio between the mean of intensities
of High-Forage/Low-Gain and High-Concentrate/High-Gain samples trans-
formed to the natural logarithm.
Gene expression in arcuate nucleus of heifers 2229
projections originating in the ARC toward hypothalamic
regions that regulate metabolism and feed intake are es-
tablished during the fi rst 2 wk after birth (Bouret et al.,
2004). This observation indicates that the early juvenile
period of development is critical for development of hy-
pothalamic pathways that control neuroendocrine func-
tions during maturation and adulthood.
Clustering of differentially expressed genes in juve-
nile heifers growing at distinct rates provides evidence
of important biological functions affected by nutritional
input. One includes the control of feed intake. Peptide
products of genes included in this cluster are well known
for stimulating (NPY and AGRP) or inhibiting (-MSH)
feeding behavior (Stanley et al., 2005). In addition, clus-
tering of differentially expressed genes involved in the
regulation of cellular metabolic processes, receptor and
intracellular signaling, and neuronal communication pro-
vides evidence of a broad array of biological functions
that are regulated within the ARC in response to changes
in nutritional status. It is evident that the expression of
many differentially expressed genes is not limited to
neurons. The methodology used in the current study did
not allow us to isolate neurons from other cell types, nor
specifi c populations of neurons within the ARC nucleus.
Nevertheless, the integrative approach used in the cur-
rent study maximized our ability to investigate, at the
cellular level, complex functional changes that occur
within the ARC nucleus that may be critical for the regu-
lation of various physiological functions. This is particu-
larly important because the control of neuroendocrine
functions involves interactions among neurons, glia and
vascular elements (Haydon and Camignoto, 2006; Ojeda
et al., 2006; Roth et al., 2007). Moreover, the approach
used in this study will direct further investigations of nu-
tritionally responsive, cellular components of the neuro-
endocrine system in a reductive manner.
Of the differentially expressed genes identifi ed in
the microarray study, expression of NPY, AGRP, GHR,
and PRLHR genes were confi rmed by quantitative PCR.
Neuropeptide Y and AGRP are known to be intimately
involved in signaling metabolic status to the central
reproductive axis (Pierroz et al., 1996; Schioth et al.,
2001; Vulliémoz et al., 2005) through neuronal path-
ways emanating from within the ARC (Turi et al., 2003).
Neuropeptide Y projections are observed in close prox-
imity to GnRH neurons and dendrites in the pre-optic
area (POA; Campbell et al., 2001) and GnRH fi bers in
the median eminence (Li et al., 1999). Neuropeptide Y5
receptor has been localized in GnRH neurons (Li et al.,
1999; Campbell et al., 2001), indicating direct actions of
NPY upon GnRH neurons. Neuropeptide Y expression
increases during negative energy balance (McShane et
al., 1993) and decreases during adequate or excess en-
ergy (Sanacora et al., 1990). Therefore, because of its in-
volvement in the control of reproductive function in sex-
ually mature animals (Catzefl ies et al., 1993; Gazal et al.,
1998; Thomas et al., 1999), NPY is a major focal point
in the efforts to understand mechanisms associated with
the metabolic control of sexual maturation. Importantly,
treatment of female rats with NPY delays sexual matura-
tion and disrupts reproductive cyclicity (Catzefl ies et al.,
1993). Furthermore, McShane et al. (1992) have reported
that intracerebroventricular administration of NPY to
estradiol-implanted and non-implanted, ovariectomized
ewes reduced release of LH. Others have reported that
NPY administration suppresses circulating concentra-
tions of LH by inhibiting pulsatile release of GnRH and
LH in ovariectomized, estradiol-implanted cows (Gazal
et al., 1998; Thomas et al., 1999). Additionally, acute
central administration of NPY inhibits secretion of LH
in mature, ovariectomized cows pretreated with leptin
(Garcia et al., 2004), suggesting that NPY signaling may
be downstream of the actions of leptin. Based on previous
reports (Gasser et al., 2006a–d), the nutritional strategies
employed in the current experiment were designed to
promote a relatively rapid rate of BW gain, which, when
associated with high concentrate diets, have been shown
to markedly hasten puberty in heifers. Thus, our obser-
vation of decreased NPY expression in the ARC of HC/
HG heifers compared with HF/LG support the hypoth-
esis that NPY neuronal pathways may serve as metabolic
integrators of the pubertal process. Specifi cally, elevated
NPY expression in the ARC may serve as a metabolic
‘brake’ for pubertal onset. However, the neuroendocrine
mechanisms and pathways by which NPY exerts this
function remain unclear, but may involve differential
NPY projections that are established during early calf-
hood development (Alves et al., 2011). In addition, al-
terations in hypothalamic neuronal circuitry associated
with nutritional inputs have been observed during early
postnatal development in rodents (Bouret et al., 2008).
The majority of the NPY neurons in the ARC co-
express AGRP (Broberger et al., 1998), which functions
in concert with NPY to increase nutrient intake and de-
crease energy expenditure during times of inadequate
nutrition. In the current study, differential expression of
AGRP between HC/HG and HF/LG heifers was parallel
to that of NPY. Agouti-related protein is an antagonist of
melanocortin receptors (MCR) and blocks the actions of
-MSH (Ollmann et al., 1997). Hypothalamic -MSH is
cleaved from its polypeptide precursor, POMC, during
post-translational processing and upon binding to MCR
suppresses appetite and feeding behavior. In the current
study, expression of POMC gene was increased in heif-
ers fed high concentrate diets to gain BW at rapid rates.
This is in agreement with the opposing roles of NPY/
AGRP and -MSH in the control of feeding and energy
expenditure (Stanley et al., 2005). It has been suggested
Allen et al.
2230
previously that AGRP exerts negative modulatory ef-
fects on GnRH neurons (Schioth et al., 2001; Vulliémoz
et al., 2005) and thus ultimately, decreases secretion of
gonadotropins from the adenohypophysis. Melanocortin
4 receptor (MC4R) is expressed in immortalized hy-
pothalamic GnRH-secreting GT-1 cells (Khong et al.,
2001), but it is unclear if they are expressed specifi -
cally on GnRH neurons. Based on in vitro experiments,
AGRP does not appear to affect gonadotropin secretion
directly in cultured pituitary cells (Stanley et al., 1999).
The apparent role of AGRP in regulating gonadotropin
secretion is to function in synchrony with NPY to in-
crease appetite and feeding behavior by blocking the
actions of -MSH. Similar to NPY, AGRP expression
was more abundantly expressed in HF/LG than in HC/
HG heifers. Thus, AGRP may bolster the actions of NPY
as a metabolic ‘brake’ on pubertal onset by suppressing
GnRH release. Previously, it has been demonstrated that
nutritional inputs during early postnatal development af-
fect neuronal development of AGRP projections in the
hypothalamus (Bouret et al., 2008).
The current study also revealed that GHR expres-
sion was decreased in HC/HG heifers relative to HF/LG.
Growth hormone is the cognate ligand for GHR, and
GH secretion is regulated by an intricate interaction be-
tween GHRH and somatostatin actions on somatotrophs
(Tannenbaum and Ling, 1984). Only a small proportion
of GHRH neurons in the ARC express GHR (Burton et
al., 1995); however, the majority (98%) of NPY neurons
in the ARC express GHR mRNA (Chan et al., 1996). In
addition, evidence indicates that NPY neurons act as an
intermediate step in the regulation of GH (Chan et al.,
1996). In rats, hypophysectomy caused a signifi cant re-
duction of NPY mRNA expression in the ARC, and treat-
ment with GH restored mRNA expression to that of con-
trol animals (Chan et al., 1996). This indicates a direct
regulation of NPY expression by GH, likely via GHR on
NPY neurons in the ARC. Concentrations of GH in cir-
culation tend to decrease during the juvenile growth and
are low at puberty, particularly in heifers gaining BW at
rapid rates (Yelich et al., 1995). Therefore, it is possible
that the increased nutritional status promoted in the HC/
HG group supports alterations in the NPY system with
downstream effects on GH secretion and GH feedback
signaling on NPY neurons. Previous reports from our
group (Thomas et al., 1999) and from others (McMahon
et al., 1999; Morrison et al., 2003) have demonstrated
clear stimulatory effects of NPY on release of GH in
cattle and sheep. Thus, the interrelationships between
NPY and GH release seem to reinforce a metabolic sta-
tus that may be permissive (if suppressed) or restrictive
(if maintained elevated) to reproductive maturation.
The PRLHR gene (originally denominated GPR10)
has been found to be highly expressed in regions of the
brain that are involved in the control of nutrient intake and
energy expenditure, including the hypothalamus (Fujii et
al., 1999). PRLHR was found to be abundant in the ade-
nohypophysis (Fujii et al., 1999) and its endogenous pep-
tide ligand, prolactin-releasing hormone (PRLH), was
found to induce prolactin release, and reduce feed intake
and BW (Lawrence et al., 2000). Moreover, intracerebro-
ventricular injection of PRLH increases body temperature
and oxygen consumption, indicating that activation of
PRLHR increases energy expenditure. Further, PRLHR-
defi cient female mice show increased circulating leptin
and increased hypothalamic expression of corticotropin-
releasing hormone (CRH) and POMC genes (Bjursell et
al., 2007). These observations corroborate our fi ndings in
which expression of POMC was greater in HC/HG than in
HF/LG heifers (see Supplemental Tables; available in the
online version of this paper).
The greater circulating concentrations of leptin and
insulin in HC/HG compared with HF/LG heifers con-
fi rm the elevated nutritional status in that group, and the
greater concentrations of IGF-1 in circulation, support
greater potential for increased somatic growth. The in-
crease in mean circulating concentrations of leptin in
HC/HG heifers is congruent with the observed decrease
in expression of NPY and AGRP, because leptin has
been shown to suppress NPY and AGRP gene expression
and release (Aubert et al., 1998; Belgardt et al., 2009;
Olofsson et al., 2009). Leptin also positively modulates
GH secretion under fasting conditions by direct actions
at the anterior pituitary (Zieba et al., 2003) and attenu-
ates the stimulatory effects of NPY on GH release in
cattle (Garcia et al., 2004). In addition, numerous stud-
ies have demonstrated the close association between se-
cretion patterns of leptin and insulin. Similar to leptin,
insulin also has negative regulatory effects on NPY and
AGRP expression (Wang and Leibowitz, 1997).
The foregoing changes in metabolic hormones and
in expression of key regulatory genes in the ARC are
also congruent with the observed changes of ruminal
VFA content. In ruminants, propionate is readily con-
verted to glucose in the liver, whereas acetate is not (Van
Soest, 1982). Increased hepatic function may explain in-
creased liver weight in HC/HG heifers, supporting in-
creased hepatic IGF-1 synthesis and maintaining greater
concentrations of IGF-1 in circulation.
In summary, our results have confi rmed marked
differences in gene expression within the ARC in heif-
ers nutritionally programmed to hasten pubertal onset.
Among the numerous differently-expressed genes, NPY,
AGRP, GHR and PRLHR exhibited decreased expres-
sion under nutritional conditions that promoted a rela-
tively rapid rate of gain. These genes are known to be
involved in the neuroendocrine control of metabolic
functions, and interact to regulate the reproductive neu-
Gene expression in arcuate nucleus of heifers 2231
roendocrine axis. Therefore, nutritional inputs during
juvenile development regulate expression of an array of
genes in the ARC that are involved in various biological
processes; most notably, response to hormones and nu-
trients, feeding behavior and neural transmission. Fine
regulation of these biological processes may be critical
for timing the onset of puberty in heifers.
LITERATURE CITED
Accorsi, P. A., N. Govoni, R. Gaiani, C. Pezzi, E. Seren, and C. Tamanini. 2005.
Leptin, GH, PRL, insulin and metabolic parameters throughout the dry
period and lactation in dairy cows. Reprod. Dom. Anim. 40:217–223.
Adam, C. L., and P. A. Findlay. 1998. Inhibition of luteinizing hormone secre-
tion and expression of c-fos and corticotrophin-releasing factor genes
in the paraventricular nucleus during insulin-induced hypoglycaemia in
sheep. J. Neuroendocrinol. 10:777–783.
Alves, B. R. C., S. Liu, E. Stevenson, J. Thorson, R. C. Cardoso, L. O. Tedeschi,
D. H. Keisler, G. L. Williams, and M. Amstalden. 2011. Accelerated
body weight gain during the juvenile period reduces neuropeptide Y
close contacts with GnRH neurons in heifers. Proc. Soc. Study Reprod.
Abstr.191:44.
Aubert, M. L., D. D. Pierroz, N. M. Gruaz, V. d’Alleves, B. A. M. Vuagnat, F.
P. Pralong, W. F. Blum, and P. C. Sizonenko. 1998. Metabolic control of
sexual function and growth: Role of neuropeptide Y and leptin. Mol. Cell.
Endocrinol. 140:107–113.
Belgardt, B. F., T. Okamura, and J. C. Bruning. 2009. Hormone and glucose
signaling in POMC and AgRP neurons. J. Physiol. 587:5305–5314.
Benjamini, Y., and Y. Hochberg. 1995. Controlling the false discovery rate: A
practical and powerful approach to multiple testing. J. R. Stat. Soc. Ser. B
Stat. Methodol. 57:289–300.
Bjursell, M., M. Lennerås, M. Göransson, A. Elmgren, and M. Bohlooly-Y.
2007. GPR10 defi ciency in mice results in altered energy expenditure and
obesity. Biochem. Biophys. Res. Commun. 363:633–638.
Bouret, S. G., S. J. Draper, and R. B. Simerly. 2004. Formation of projection
pathways from the arcuate nucleus of the hypothalamus to hypothalamic
regions implicated in the neuronal control of feeding in mice. J. Neurosci.
24:2797–2805.
Bouret S. G., J. N. Gorski, C. M. Patterson, S. Chen, B. E. Levin, and R. B.
Simerly. 2008. Hypothalamic neuronal projections are permanently dis-
rupted in diet-induced obese rats. Cell. Metab. 7:179–185.
Broberger, C., J. Johansen, C. Johansson, M. Schalling, and T. Hokfelt. 1998.
The neuropeptide Y/agouti gene-related protein (AGRP) brain circuitry
in normal, anorectic and monosodium glutamate-treated mice. Proc. Natl.
Acad. Sci. USA 95:15043–15048.
Burton, K. A., E. B. Kabigting, R. A. Steiner, and D. K. Clifton. 1995.
Identifi cation of target cells for growth hormone’s action in the arcuate
nucleus. Am. J. Physiol. 269:E716–E722.
Campbell, R. E., J. M. ffrench-Mullen, M. A. Cowley, M. S. Smith, and K. L.
Grove. 2001. Hypothalamic circuitry of neuropeptide Y regulation of
neuroendocrine function and food intake via the Y5 receptor subtype.
Neuroendocrinology 74:106–119.
Catzefl ies, C., D. D. Pierroz, F. Rohner-Jeanrenaud, J. Rivier, P. C. Sizonenko,
and M. L. Aubert. 1993. Neuropeptide Y administered chronically into
the lateral ventricle profoundly inhibits both the gonadotropic and the so-
matotropic axis in intact adult female rats. Endocrinology 132:224–234.
Chan, Y. Y., D. K. Clifton, and R. A. Steiner. 1996. Role of NPY neurons in GH-
dependent feedback signalling to the brain. Horm. Res. Suppl. 1:12–14.
Day, M. L., K. Imakawa, M. Garcia-Winder, D. D. Zalesky, B. D. Schanbacher,
R. J. Kittok, and J. E. Kinder. 1984. Endocrine mechanisms of puberty
in heifers: Estradiol negative feedback regulation of luteinizing hormone
secretion. Biol. Reprod. 31:332–341.
Delavaud, C., F. Bocquier, Y. Chilliard, D. H. Keisler, A. Gertler, and G. Kann.
2000. Plasma leptin determination in ruminants: Effect of nutritional sta-
tus and body fatness on plasma leptin concentration assessed by a specifi c
RIA in sheep. J. Endocrinol. 165:519–526.
DiCostanzo, A., J. E. Williams, and D. H. Keisler. 1999. Effects of short- or long-
term infusions of acetate or propionate on luteinizing hormone, insulin,
and metabolite concentrations in beef heifers. J. Anim. Sci. 77:3050–3056.
Fox, D. G., L. O. Tedeschi, T. P. Tylutki, J. B. Russell, M. E. Van Amburgh, L. E.
Chase, A. N. Pell, and T. R. Overton. 2004. The Cornell net carbohydrate
and protein system model for evaluating herd nutrition and nutrient excre-
tion. Anim. Feed Sci. Technol. 112:29–79.
Fujii, R., S. Fukusumi, M. Hosoya, Y. Kawamata, Y. Habata, S. Hinuma, M.
Sekiguchi, C. Kitada, T. Kurokawa, O. Nishimura, H. Onda, Y. Sumino,
and M. Fujino. 1999. Tissue distribution of prolactin-releasing peptide
(PrRP) and its receptor. Regul Pept. 83:1–10.
Garcia, M. R., M. Amstalden, D. H. Keisler, N. Raver, A. Gertler, and G. L.
Williams. 2004. Leptin attenuates the acute effects of centrally adminis-
tered neuropeptide Y on somatotropin but not gonadotropin secretion in
ovariectomized cows. Domest. Anim. Endocrinol. 26:189–200.
Garcia, M. R., M. Amstalden, C. D. Morrison, D. H. Keisler, and G. L. Williams.
2003. Age at puberty, total fat and conjugated linoleic acid content of car-
cass, and circulating metabolic hormones in beef heifers fed a diet high in
linoleic acid beginning at four months of age. J. Anim. Sci. 81:261–268.
Gasser, C. L., E. J. Behlke, D. E. Grum, and M. L. Day. 2006a. Effect of timing
of feeding a high-concentrate diet on growth and attainment of puberty in
early-weaned heifers. J. Anim. Sci. 84:3118–3122.
Gasser, C. L., G. A. Bridges, M. L. Mussard, D. E. Grum, J. E. Kinder, and M.
L. Day. 2006b. Induction of precocious puberty in heifers III: Hastened
reduction of estradiol negative feedback on secretion of luteinizing hor-
mone. J. Anim. Sci. 84:2050–2056.
Gasser, C. L., C. R. Burke, M. L. Mussard, E. J. Behlke, D. E. Grum, J. E.
Kinder, and M. L. Day. 2006c. Induction of precocious puberty in heifers
II: Advanced ovarian follicular development. J. Anim. Sci. 84:2042–2049.
Gasser, C. L., D. E. Grum, M. L. Mussarg, F. L. Fluharty, J. E. Kinder, and M. L.
Day. 2006d. Induction of precocious puberty in heifers I: Enhanced secre-
tion of luteinizing hormone. J. Anim. Sci. 84:2035–2041.
Gazal, O. S., L. S. Leshin, R. L. Stanko, M. G. Thomas, D. H. Keisler, L. L.
Anderson, and G. L. Williams. 1998. Gonadotropin-releasing hormone
secretion into third-ventricle cerebrospinal fl uid of cattle: Correspondence
with the tonic and surge release of luteinizing hormone and its tonic inhibi-
tion by suckling and neuropeptide Y. Biol. Reprod. 56:676–683.
Hahn, T. M., F. Breininger, D. G. Baskin, and M. W. Schwartz. 1998. Co-
expression of Agrp and NPY in fasting-activated hypothalamic neurons.
Nat. Neurosci. 1:271–272.
Haydon P. G., and G. Carmignoto. 2006. Astrocyte control of synaptic transmis-
sion and neurovascular coupling. Physiol. Rev. 86:1009–1031.
Hiney, J. K., S. R. Ojeda, and W. L. Dees. 1991. Insulin-like growth factor 1:
A possible metabolic signal involved in the regulation of female puberty.
Neuroendocrinology 54:420–423.
Hiney, J. K., V. Srivastava, C. L. Nyberg, S. R. Ojeda, and W. L. Dees. 1996.
Insulin-like growth factor-1 of peripheral origin acts centrally to acceler-
ate the initiation of female puberty. Endocrinology 127:3717–3728.
Huang, D. W., B. T. Sherman, and R. A. Lempicki. 2009. Systematic and inte-
grative analysis of large gene lists using DAVID bioinformatics resources.
Nat. Protoc. 4:44–57.
I’Anson, H., J. M. Manning, C. G. Herbosa, J. Pely, C. R. Friedman, R. I. Wood,
D. C. Bucholtz, and D. L. Foster. 2000. Central inhibition of gonadotro-
pin-releasing hormone secretion in growth-restricted hypogonadotropic
female sheep. Endocrinology 141:520–527.
Khong, K., S. E. Kurtz, R. L. Sykes, and R. D. Cone. 2001. Expression of
functional melanocortin-4 receptor in the hypothalamic GT1-1 cell line.
Neuroendocrinology 74:193–201.
Lawrence, C. B., F. Celsi, J. Brennand, and S. M. Luckman. 2000. Alternative
role for prolactin-releasing peptide in the regulation of food intake. Nat.
Neurosci. 3:645–646.
Allen et al.
2232
Lehman, M. N., F. J. Ebling, S. M. Moenter, and F. J. Karsch. 1993.
Distribution of estrogen receptor-immunoreactive cells in the sheep brain.
Endocrinology 133:876–886.
Li, C., P. Chen, and M. S. Smith. 1999. Morphological evidence for direct in-
teraction between arcuate nucleus neuropeptide Y (NPY) neurons and
gonadotropin-releasing hormone neurons and the possible involvement of
NPY Y1 receptors. Endocrinology 140:5382–5390.
Li X., H. Chiang, J. Zhu, S. E Dowd, and H. Zhou. 2008. Characterization of
a newly developed chicken 44k Agilent microarray. BMC Genomics
9:60–74.
Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression
data using real-time quantitative PCR and the 2-Ct method. Methods
25:402–408.
McMahon, C. D., D. F. Buxton, T. H. Elsasser, D. R. Gunter, L. G. Sanders, B. P.
Steele, and J. L. Sartin. 1999. Neuropeptide Y restores appetite and alters
concentrations of GH after central administration to endotoxic sheep. J.
Endocrinol. 161:333–339.
McShane, T. M., T. May, J. L. Miner, and D. H. Keisler. 1992. Central actions
of neuropeptide Y may provide a neuromodulatory link between nutrition
and reproduction. Biol. Reprod. 46:1151–1157.
McShane, T. M., S. L. Petersen, S. McCrone, and D. H. Keisler. 1993. Infl uence
of food restriction on neuropeptide-Y, proopiomelanocortin, and lutein-
izing hormone-releasing hormone gene expression in sheep hypothalami.
Biol. Reprod. 49:831–839.
Morrison, C. D., J. A. Daniel, J. H. Hampton, P. R. Buff, T. M. McShane, M.
G. Thomas, and D. H. Keisler. 2003. Luteinizing hormone and growth
hormone secretion in ewes infused intracerebroventricularly with neuro-
peptide Y. Domest. Anim. Endocrinol. 24:69–80.
Ojeda S. R., A. Lomniczi, C. Mastronardi, S. Heger, C. Roth, A. S. Parent, V.
Matagne, and A. E. Mungenast. 2006. Minireview: The neuroendocrine
regulation of puberty: Is the time ripe for a systems biology approach?
Endocrinology 147:1166–1174.
Ollmann, M. M., B. D. Wilson, Y. Yang, J. A. Kerns, Y. Chen, I. Gantz, and G. S.
Barsh. 1997. Antagonism of central melanocortin receptors in vitro and in
vivo by agouti-related protein. Science 278:136–138.
Olofsson, L. E., A. A. Pierce, and A. W. Xu. 2009. Functional requirement of
AgRP and NPY neurons in ovarian cycle-dependent regulation of food
intake. Proc. Nat. Acad. Sci. 106:15932–15937.
Pellegrino, L. J., A. S. Pellegrino, and A. J. Cushman. 1979. A stereotaxic atlas
of the rat brain. Plenum Press, New York.
Pierroz, D. D., C. Catzefl ies, A. C. Aebi, J. E. Rivier, and M. L. Aubert. 1996.
Chronic administration of neuropeptide Y into the lateral ventricle inhib-
its both the pituitary-testicular axis and growth hormone and insulin-like
growth factor-1 secretion in intact adult male rats. Endocrinology 137:3–
12.
Raposinho, P. D., P. Broqua, D. D. Pierroz, A. Hayward, Y. Dumont, R. Quirion,
J. Junien, and M. L. Aubert. 1999. Evident that the inhibition of luteiniz-
ing hormone secretion exerted by central administration of neuropeptide
Y (NPY) in the rat is predominantly mediated by the NPY-Y5 receptor
subtype. Endocrinology 140:4046–4055.
Redmond, J. S., G. M. Baez-Sandoval, K. M. Spell, T. E. Spencer, C. A. Lents,
G. L. Williams, and M. Amstalden. 2011. Developmental changes in
hypothalamic Kiss1 expression during the activation of the pulsatile re-
lease of luteinizing hormone in maturing ewe lambs. J. Neuroendocrinol.
23:815–822.
Roth, C. L., C. Mastronardi, A. Lomniczi, H. Wright, R. Cabrera, A. E.
Mungenast, S. Heger, H. Jung, C. Dubay, and S. R. Ojeda. 2007.
Expression of a tumor-related gene network increases in the mammalian
hypothalamus at the time of female puberty. Endocrinology 148:5147–
5161.
Ryan, D. P., R. A. Spoon, M. K. Griffi th, and G. L. Williams. 1994. Ovarian
follicular recruitment, granulosa cell steriodogenic potential, and growth
hormone/insulin-like growth factor-I relationships in suckled beef cows
consuming high lipid diets: Effects of graded differences in body con-
dition maintained during the puerperium. Domest. Anim. Endocrinol.
11:161–174.
Salanitro, J. P., and P. A. Muirhead. 1975. Quantitative method for the gas chro-
matographic analysis of short-chain monocarboxylic and dicarboxylic
acids in fermentation media. Appl. Microbiol. 29:374–381.
Sanacora, G., M. Kershaw, J. A. Finkelstein, and J. D. White. 1990. Increased
hypothalamic content of preproneuropeptide Y messenger ribonucleic
acid in genetically obese Zucker rats and its regulation by food depriva-
tion. Endocrinology 127:730–737.
Schioth, H. B., Y. Kakizaki, A. Kohsaka, T. Suda, and H. Watanobe. 2001.
Agouti-related peptide prevents steroid-induced luteinizing hormone and
prolactin surges in female rats. Neuroreport 12:687–690.
Simpson, R. B., J. D. Armstrong, R. W. Harvey, D. C. Miller, E. P. Heimer,
and R. M. Campbell. 1991. Effect of active immunization against growth
hormone-releasing factor on growth and onset of puberty in beef heifers.
J. Anim. Sci. 69:4914–4924.
Smyth, G. K. 2004. Linear models and empirical Bayes methods for assess-
ing differential expression in microarray experiments. Stat. Appl. Genet.
Mole. Biol. 1(E-pub):Article 3.
Stanley, S., K. Wynne, B. McGowan, and S. Bloom. 2005. Hormonal regulation
of food intake. Physiol. Rev. 85:1131–1158.
Stanley, S. A., C. J. Small, M. S. Kim, M. M. Heath, L. J. Seal, S. H. Russell, M.
A. Ghatei, and S. R. Bloom. 1999. Agouti related peptide (Agrp) stimu-
lates the hypothalamo pituitary gonadal axis in vivo & in vitro in male rats.
Endocrinology 140:5459–5462.
Tannenbaum, G. S., and N. Ling. 1984. The interrelationship of growth hor-
mone (GH)-releasing factor and somatostatin in generation of the ultra-
dian rhythm of GH secretion. Endocrinology 115:1952–1957.
Thomas, M. G., O. S. Gazal, G. L. Williams, R. L. Stanko, and D. H. Keisler.
1999. Injection of neuropeptide Y into the third cerebroventricle differ-
entially infl uences pituitary secretion of luteinizing hormone and growth
hormone in ovariectomized cows. Domest. Anim. Endocrinol. 16:159–
169.
Turi, G. F., Z. Liposits, S. M. Moenter, C. Fekete, and E. Hrabovszky. 2003.
Origin of neuropeptide Y-containing afferents to gonadotropin-releasing
hormone neurons in male mice. Endocrinology 144:4967–4974.
Van Soest, P. J. 1982. Nutritional ecology of the ruminant. Ithaca, New York:
Cornell University Press.
Vandesompele, J., K. De Preter, F. Pattyn, B. Poppe, N. Van Roy, A. De Paepe,
and F. Speleman. 2002. Accurate normalization of real-time quantitative
RT-PCR data by geometric averaging of multiple internal control genes.
Genome Biol. 3:RESEARCH0034.
Vulliémoz, N. R., E. Xiao, L. Xia-Zhang, S. L. Wardlaw, and M. Ferin. 2005.
Central infusion of agouti-related peptide suppresses pulsatile luteinizing
hormone release in the ovariectomized rhesus monkey. Endocrinology
146:784–789.
Wang, J., and K. L. Leibowitz. 1997. Central insulin inhibits hypothalamic
galanin and neuropeptide Y gene expression and peptide release in intact
rats. Brain Res. 777:231–236.
Yelich, J. V., R. P. Wettemann, H. G. Dolezal, K. S. Lusby, D. K. Bishop, and
L. J. Spicer. 1995. Effects of growth rate on carcass composition and lipid
partitioning at puberty and growth hormone, insulin-like growth factor
I, insulin and metabolites before puberty in beef heifers. J. Anim. Sci.
73:2390–2405.
Yelich, J. V., R. P. Wettemann, T. T. Marston, and L. J. Spicer. 1996. Luteinizing
hormone, growth hormone, insulin-like growth factor-1, insulin and me-
tabolites before puberty in heifers fed to gain at two rates. Domest. Anim.
Endocrinol. 13:325–338.
Zieba, D. A., M. Amstalden, S. Morton, J. L. Gallino, J. F. Edwards, P. G.
Harms, and G. L. Williams. 2003. Effects of leptin on basal and GHRH-
stimulated GH secretion from the bovine adenohypophysis are dependent
on nutritional status. J. Endocrinol. 178:83–89.
Zieba, D. A., M. Amstalden, S. Morton, M. N. Maciel, D. H. Keisler, and G.
L. Williams. 2004. Regulatory roles of leptin in the hypothalamic-hy-
pophyseal axis before and after sexual maturation in cattle. Biol. Reprod.
71:804–812.
