ArticlePDF Available

The anti-inflammatory effect of 10-oxo- trans -11-octadecenoic acid (KetoC) on RAW 264.7 cells stimulated with Porphyromonas gingivalis lipopolysaccharide

April 2018
Journal of Periodontal Research 53(5)

April 2018
53(5)

DOI:10.1111/jre.12564

Authors:

Benso Sulijaya

University of Indonesia

Show all 10 authorsHide

Background There is rapidly developing interest into the role of several anti‐inflammatory agents to resolve inflammation in periodontal disease. A bioactive polyunsaturated fatty acid, 10‐oxo‐trans‐11‐octadecenoic acid (KetoC), is known to have various beneficial physiological effects; however, the effect of KetoC on inflammation remains unclear. Here, we investigated the effect of KetoC on RAW 264.7 cells stimulated with Porphyromonas gingivalis lipopolysaccharide, and explored the intracellular mechanism responsible for its anti‐inflammatory effects. Methods RAW 264.7 cells were pre‐treated with or without KetoC, and then stimulated with or without P. gingivalis lipopolysaccharide. Levels of tumor necrosis factor α (TNFα), interleukin (IL)‐6 and IL‐1β were determined by real‐time polymerase chain reaction and enzyme‐linked immunosorbent assay. Specific antagonists for G protein‐coupled receptor (GPR)40 and GPR120 were used to clarify the receptor for KetoC. The intracellular mechanism was investigated using western blotting analysis to separate nuclear and cytosolic NF‐κB p65 protein. Result KetoC (5 μmol/L) was not toxic to RAW 264.7 cells, and significantly reduced the expression of TNFα and IL‐6 mRNA and protein, and IL‐1β mRNA. No protein production of IL‐1β was observed. Additionally, when bound to GPR120, KetoC trended to downregulate nuclear NF‐κB p65 protein levels. However, the antagonist for GPR40 failed to diminish the action of KetoC. Conclusion KetoC suppressed the proinflammatory cytokines TNFα, IL‐6 and IL‐1β via NF‐κB p65, by binding to its receptor GPR120. KetoC is a promising candidate in future studies as a bioactive anti‐inflammatory agent in treating periodontal disease.

Content uploaded by Benso Sulijaya

Content may be subject to copyright.

J Periodo nt Res. 2 01 8; 1–8 .  wileyonlinelibrary.com/journal/jre 

1

Publish ed by John W iley & Sons Ltd

1 | INTRODUCTION

Periodontitis is an inflammator y disease caused by oral bacteria,

and manifests as connective tissue attachment destruction and

alveolar bone resorption.1 Although the etiological role of bac-

teria is indisputable, the understanding of the roles of specific

bacteria in the pathogenesis of periodontitis is changing.1,2 It has

been demonstrated that the inoculation of Porphyromonas gin-

givalis, a representative periodontopathic bacteria and a type of

red complex bacteria,3 into germ- free mice failed to induce alve-

olar bone resorption.4 However, the same treatment in specific

pathogen- free mice that harbor oral commensal bacteria resulted

Accepted: 18 March 2018

DOI : 10.1111 /jr e.12 56 4

ORIGINAL ARTICLE

The anti- inflammatory effect of 10- oxo- trans- 11- octadecenoic

acid (KetoC) on RAW 264.7 cells stimulated with Porphyromonas

gingivalis lipopolysaccharide

Y. Aoki-Nonaka2 | T. Nakajima5 | S. Kishino6 | J. Ogawa6 | K. Yamazaki1

1Research Unit for Oral-Systemic

Connec tion, D ivision of Oral Science for

Health P romotion, Niigata University

Gradu ate School of Medic al and Dental

Sciences, Niigata, Japan

2Division of Periodontology, Niigata

University Gr aduate School of Me dical and

Dental Science s, Niigata, Japa n

3Depar tment of Periodontology, Faculty of

Dentistry, Universitas Indonesia, Jakarta,

Indonesia

4Research Center for Advanced Oral

Science, Niigat a University Gr aduate School

of Medical and Dental Scie nces, Niigata,

Japan

5Divisio n of Denta l Educational Res earch

Development, Niigata University Graduate

School of Medica l and Dent al Sciences,

Niigata, Japan

6Divisio n of Applied Life Sciences, G raduate

School of Agriculture, Kyoto University,

Kyoto, Japan

Correspondence

Kazuhisa Yamazaki, Research Unit for

Oral-Systemic Connection, Division of

Oral Science for Health Promotion , Niigat a

University Gr aduate School of Me dical and

Dental Science s, Niigata, Japa n.

Email: kaz@dent.niigata-u.ac.jp

Funding information

Japan So ciety fo r the Prom otion of Sc ience,

Grant/Award Number: 15H 02578 and

16H05554; Nit to Pharmaceutical Industrie s

Ltd

Background: There is rapidly developing interest into the role of several anti-

inflammatory agents to resolve inflammation in periodontal disease. A bioactive pol-

yunsaturated fatty acid, 10- oxo- trans- 11- octadecenoic acid (KetoC), is known to

have various beneficial physiological effects; however, the effect of KetoC on inflam-

mation remains unclear. Here, we investigated the effect of KetoC on R AW 264.7

cells stimulated with Porphyromonas gingivalis lipopolysaccharide, and explored the

intracellular mechanism responsible for its anti- inflammatory effects.

Methods: RAW 264.7 cells were pre- treated with or without KetoC, and then stimu-

lated with or without P. gingivalis lipopolysaccharide. Levels of tumor necrosis factor

α (TNFα), interleukin (IL)- 6 and IL- 1β were determined by real- time polymerase chain

reaction and enzyme- linked immunosorbent ass ay. Specific antagonists for G protein-

coupled receptor (GPR)40 and GPR120 were used to clarify the receptor for KetoC.

The intracellular mechanism was investigated using western blotting analysis to sep-

arate nuclear and cytosolic NF- κB p65 protein.

Result: KetoC (5 μmol/L) was not toxic to R AW 264.7 cells, and significantly reduced

the expression of TNFα and IL- 6 mRNA and protein, and IL- 1β mRNA. No protein

production of IL- 1β was observed. Additionally, when bound to GPR120, KetoC

trended to downregulate nuclear NF- κB p65 protein levels. However, the antagonist

for GPR40 failed to diminish the action of KetoC.

Conclusion: KetoC suppressed the proinflammatory cytokines TNFα, IL- 6 and IL- 1β

via NF- κB p65, by binding to its receptor GPR120. KetoC is a promising candidate in

future studies as a bioactive anti- inflammatory agent in treating periodontal

disease.

KEYWORDS

10-oxo-trans-11-octadecenoic acid, inflammation, KetoC, macrophages, NF-κB

SULIJAYA e t AL.

in inflammatory alveolar bone resorption, and simultaneously in-

duced changes in oral microbiota composition.4 These results sug-

gest that P. gingivalis modulates the oral commensal bacteria and

resulting microflora may be responsible for inflammatory bone

resorption. In addition, it has been demonstrated that inflamma-

tion itself initiates dysbiosis, which suggests that controlling in-

flammation is important for suppressing infection.1, 2 Given the

importance of modulating the inflammatory response in prevent-

ing periodontal tissue destruction, targeted anti- inflammatory

therapeutics as an adjunctive therapy to mechanical debridement

has been explored, including resolvin E1,5 etanercept6 and anti-

inflammatory chemokine CCL22.7

Increasing evidence proposes that polyunsaturated fatty acids,

which contain more than one double bond, have various beneficial

physiological effects. Recently, we reported that gut bacteria could

generate hydroxyl fatty acids, oxo fatty acids, conjugated fatt y acids

and partially saturated fatty acids from food- derived polyunsatu-

rated fat ty acids via the bio- hydrogeneration pathway.8

10- oxo- trans- 11- octadecenoic acid (KetoC) is a long- chain

member of the oxo fatt y acid family, which also includes

10- oxo- cis- 12- octadecenoic acid (KetoA) and 10- oxo- octadecanoic

acid (KetoB).9,10 The oxo group in strain 10 and the double bond in

strain 11 are recognized in the chemical structure of KetoC. In the

gut, KetoC is produced by Lactobacillus plantarum via saturation pro-

cessing of linoleic acid into conjugated linoleic acid and oleic acid.9

Given that KetoC is a long- chain fatty acid, G protein- coupled re-

ceptor (GPR)40 and GPR120 are considered receptors for KetoC.11

However, receptors for KetoC remains to be clarified.

KetoC is reported to protect HepG2 cells from H2O2 cytotoxic-

ity by upregulating the nuclear factor erythroid 2- related factor 2

antioxidant- responsive elements (Nrf2- ARE) pathway, which results

in an elevation of antioxidative enzyme production.9 Oxidative stress

refers to elevated intracellular levels of reactive oxygen species,

or reduced antioxidant markers such as heme ox ygenase 1 (HO- 1),

NAD(P)H- quinone oxidoreductase, and superoxide dismutase 3.12

Oxidative stress contributes to a myriad of pathologies through the

increased production of proinflammatory cytokines.13 For example,

reactive oxygen species- dependent regulation has been demon-

strated to be involved in P. gingivalis- induced inflammatory cytokine

production in gingival epithelial cells.14 In addition, lipopolysaccha-

ride (LPS)- induced production of proinflammatory cytokines has

been shown to be suppressed by KetoC via the inhibition of nuclear

translocation of nuclear factor κB (NF- κB) and mitogen- ac tivated

protein kinases/activator protein- 1.15

Given that LPS of P. gingivalis is a major virulence factor of this

key bacterium in chronic periodontitis and can activate multiple cell

types comprising periodontium via the production of proinflam-

matory cy tokines,16 these anti- inflammatory effects of KetoC also

seem to be beneficial in periodontal disease. However, to the best of

our knowledge, there has been no report on the effects of functional

fatty acids, particularly KetoC , on inflammation induced by peri-

odontopathic bacteria. Therefore, the objectives of this study were

to investigate KetoC as an anti- inflammatory mediator in RAW 264.7

cells treated with P. gingivalis LPS, and to explore the intracellular

mechanism by which KetoC exerts the anti- inflammatory response.

2 | MATERIAL AND METHODS

2.1 | Reagents

KetoC was synthesized according to methods described previously.8

P. gingivalis LPS AT TCC33277 was purchased from Wako Pure

Chemical Industries (Osaka, Japan). A specific GPR120 antagonist

(AH7614) and GPR40 antagonist (GW1100) were obtained from

Tocris Bioscience (Ellisville, MO, USA) and Cayman Chemical (Ann

Arbor, MI, USA), respectively.

2.2 | Cell culture

Dulbecco’s modified Eagle medium was purchased from Gibco

(Grand Island, NY, USA). RPMI- 1640 medium, fetal bovine serum

(FBS), phosphate- buffered saline and trypsin were purchased from

Sigma (St. Louis, MO, USA). EtOH was obt ained from Wako Pure

Chemical Industries. R AW 264.7 cells (mouse macrophages) were

cultured in Dulbecco’s modified Eagle medium containing 10%

FBS supplemented with 1% antibiotics, consisting of 100 units/mL

penicillin and 100 μg/mL streptomycin, as described previously.17,18

Human macrophages t hat were differentiated from THP- 1 cells using

10 nmol/L phorbol- 12- myristate- 13- acetate were grown in RPMI-

1640 medium containing 10% FBS supplemented with 1% penicillin/

streptomycin.19 Cells were cultured in 75 cm2 flasks at 37°C and 5%

CO2 in an incubator. Cells below 15 passages were used in these

experiments.

2.3 | Cell viability tests

The effect of KetoC on cell viability was evaluated using the 3- (4,5

- dimethylthiazol- 2- yl)- 2,5- diphenyltetrazolium bromide (MTT) assay

(Sigma- Aldrich, St . Louis, MO, USA). RAW 264.7 cells were plated

in 96- well plates (TPP, Trasadingen, Schaffhausen, Switzerland) at a

concentration of 5 × 104 cells/well and incubated overnight. Then,

KetoC was added to each well (0.5, 5 or 50 μmol/L) and maintained

for 0, 24, 48 and 72 hours. Control cells were treated with EtOH.

The plate was measured at 562 nm absorbance using the EMax® Plus

Microplate reader (Molecular Devices, Holliston, MA, USA).

2.4 | Polymerase chain reaction and electrophoresis

RAW 264.7 cells (0.2 × 106 cells/mL) were seeded in 24- well

plates (TPP), with or without pre- incubation with 5 μmol/L KetoC,

and in the presence or absence of P. gingivalis LPS (1 μg/mL) or

GPR antagonists. Total RNA was extracted using Tri Reagents

(Molecular Research Center Inc., Cincinnati, OH, USA) and cDNA

was synthesized using Transcriptor Universal cDNA Master (Roche

Diagnostics, Indianapolis, IN, USA). GoTaq polymerase (Promega

Corporation, Madison, WI, USA) was used for conventional

SULIJAYA et AL.

polymerase chain reaction (PCR; ie, 30 cycles of denaturation at

94°C for 15 seconds, annealing at 60°C for 15 seconds, and ex-

tension at 72°C for 30 seconds; followed by a final extension at

72°C for 10 minutes) using GeneAmp® PCR System 770 0 (Applied

Biosystems, Carlsbad, C A, USA). SYBR® Safe DNA (Invitrogen

Corporation, Carlsbad, CA, USA) was used to visualize PCR prod-

ucts on a 1.5% agarose gel. Glyceraldehyde- 3- phosphate dehydro-

genase (GAPDH) was used as a reference gene. Primers used in this

study are listed in Table 1.

2.5 | Immunostaining

RAW 264.7 cells (5 × 104 cells/well) were cultured on Lab- Tek™

Chamber Slides (Nunc, Rochester, NY, USA). The attached cells were

fixed in 4% paraformaldehyde, gently washed with Tris- buffered

saline, treated with 0.2% Triton® X- 100 (Promega Corporation,

Madison, WI, USA) and stained with anti- GPR120 (1:100) or

anti- GPR40 (1:100) primary antibodies, followed by Alexa Fluor

596/488- conjugated antirabbit secondar y antibody (1:1000; Abcam,

Cambridge, UK). Cell nuclei were stained with DAPI and mounted

using VECTASHIELD® Hardset™ Mounting Medium ( Vector

Laboratories, Burlingame, CA , USA). Slides were imaged using

fluorescence microscopy (Biozero BZ- 8000; Keyence Corporation,

Tokyo, Japan).

2.6 | Real- time polymerase chain reaction assay

cDNA samples were mixed with Fast Start Essential DNA Green

Master (Roche Diagnostics), and analyzed using the LightCycler®

96 real- time PCR machine (Roche, Mannheim, Germany). Relative

mRNA abundance was calculated using the ΔΔCt method described

previously.20 Ct values are defined as the fractional cycle number at

which fluorescence intensity reached the fixed threshold. GAPDH

was used as the reference gene.

2.7 | Enzyme- linked immunosorbent assay

The protein levels of tumor necrosis factor (TNF)α, interleukin (IL)-

6, and IL- 1β in the supernatant were measured using commercially

available Ready- SET- Go!® enzyme- linked immunosorbent assay kits

(eBioscience, Aff ymetrix Inc., San Diego, CA, USA) according to the

manufa cturer’s guide lines. Optica l density was mea sured at 540 nm ab-

sorbance using the EMax® Plus Microplate reader (Molecular Devices).

2.8 | Western blotting analysis

The western blot assay procedure used to determine the total pro-

tein expression of GPR120 and GPR40 is described in our previous

stud y.21 In addition, the abundance of cy toplasmic and nuclear NF- κB

p65 protein was investigated through western blot analysis. The NE-

PER® Nuclear and Cytoplasmic Extraction Reagent (Thermo Fisher

Scientific, Rock ford, IL , USA) and Halt Protease Inhibitor Cockt ail

(Pierce Biotechnology, Rockford, IL, USA) were used to extract and

separate the cytoplasmic and nuclear proteins. Proteins were resolved

by sodium dodecyl sulfate- polyacrylamide gel electrophoresis, trans-

ferred on to nitrocellulose membranes (EMD Millipore Corporation,

Tullagreen, Carrigtwohill Co Cork, Darmstadt, Germany) and probed

with the following primary antibodies: rabbit antihuman GAPDH

TABLE1 Oligonucleotide primers used

for conventional polymerase chain

reaction and real- time polymerase chain

reaction

Primer Sequence

Mouse GAPDH Forward5′-TCA ACAGCAACTCCCAC TCT T-3′

Reverse5′-ACCCTGTTGCTGTAGCCGTAT-3′

Human GAPDH Forward5′-ACCAAATCCGTTGACTCCGAC-3′

Reverse5′-TTCGACAG TCAGCCGCATCT-3′

Mouse GPR120 Forward5′-TCTGCCACCTGC TCT TCTAC-3′

Reverse5′-ATTTCTCCTATGCGGTTGGGC-3′

Human GPR120 Forward5′-CCTGCCACCTGCTCTTCTAC-3′

Reverse5′-GGGCCAAATCAGTGTGCAAAT-3′

Mouse GPR40 Forward5′-CACTTTGCTCCCCTCTACGC-3′

Reverse5′-GATGGCTTGGTACCCGAAGG-3′

Human GPR40 Forward5′-GCCCACTTCTTCCCACTCT-3′

Reverse5′-ACCAGACCCAGGTGAC ACA-3′

Mouse TNFαForward5′-GATCGGTCCCCA AAGGGATG-3′

Reverse5′-TTGACGGCAGAGAGGAG GTT-3′

Mouse IL- 6 Forward5-CCAGAGATACAAAGAAATGATGG-3′

Reverse5′-ACTCCSG AAGACCAGAGGAAAT-3′

Mouse IL- 1βForward5′-A ATCTGTACCTGTCCTGCGTGT T-3′

Reve rse5′-TG GGTA AT T T T TG G GAT CTAC AC TCT- 3′

GAPDH, glyceraldehyde- 3- phosphate dehydrogenase; GPR, G protein- coupled receptor; IL, inter-

leukin; TNF, tumor necrosis factor.

SULIJAYA e t AL.

(Abcam, Cambridge, UK ) at 1:1000, rabbit antihuman histone deacety-

lase (GeneTex, Irvine, CA, USA) at 1:1000 and rabbit antihuman NF-

κB p65 (Cell Signaling Technology Inc., Danvers, MA, USA) at 1:400.

Horseradish peroxidase- antirabbit (Cell Signaling Technology Inc.)

1:10 000 was used as the secondary antibody. Chemiluminescent sign-

aling was de tected using ECL Se lect™ detection reagent (GE Healthcare,

Little Chalfont, Buckinghamshire, UK) and analyzed using ImageQuant

LAS 4000 mini (GE Life Sciences, Thermo Scientific, Rockford, IL, USA).

2.9 | Statistical analyses

All data represented are mean ± standard deviation (SD). GraphPad

Prism ver. 5 (GraphPad Software, Inc., La Jolla, CA, USA) was used

for statistical analysis. One- way analysis of variance with Bonferroni

post hoc analysis was used as stated. The level of statistical signifi-

cance was set at P < .05.

3 | RESULTS

3.1 | Effects of KetoC on cell viability

According to the MTT assay, incubation with 0.5 and 5 μmol/L

KetoC did not have any cytotoxic effects compared to the control

FIGURE1 Effect of KetoC on the viability of RAW 264.7

cells (ATCC TIB- 71™) at 0, 24, 48 and 72 h. Percentage of cellular

metabolic activity was measured by the optical densit y at 562 nm

(MTT assay) in the presence of EtOH (control) or KetoC (0.5, 5

and 50 μmol/L). Data are presented as mean ± SD (n = 4 samples/

group). **P < .01, one- way ANOVA with Bonferroni’s multiple

comparisons test, compared with the control group

FIGURE2 Effect of KetoC on the

expression of proinflammatory cytokines

(TNFα, IL- 6 and IL- 1β). RAW 264.7 cells

were pre- treated with 5 μmol/L KetoC

(30 min previously) and stimulated

with 1 μg/mL P. gingivalis LPS for 8 h to

investigate mRNA levels (A), and 48 h to

investigate protein levels (B) of TNFα,

IL- 6 a nd I L- 1 β. Data are presented as

mean ± SD (n = 4 samples/group). IL ,

interleukin; LPS, lipopolysaccharide;

ND, not detected; TNF, tumor necrosis

fa ctor. **P < .01, one- way ANOVA with

Bonferroni’s multiple comparisons test

FIGURE3 Dose- dependent effect of KetoC on TNFα expression.

RAW 264.7 cells were pre- treated with 0.5, 1.25, 2.5 and 5 μmol/L

KetoC (30 min before) and stimulated with 1 μg/m L P. gingivalis

LPS for 48 h to investigate protein levels of TNFα. Enzyme-linked

immunosorbent assay with analysis of optical density at 540 nm

was used. Data are presented as mean ± SD (n = 4 samples/group).

**P < .01, one- way ANOVA with Bonferroni’s multiple comparisons

test, compared to the control group. LPS, lipopolysaccharide; TNF,

tumor necrosis factor.

SULIJAYA et AL.

group for the duration of the experiment. However, 50 μmol/L

KetoC appeared to be cytotoxic and significantly suppressed

cell viability at 48 and 72 hours; therefore, 5 μmol/L KetoC was

selected as the optimal concentration for further in vitro experi-

ments (Figure 1).

3.2 | KetoC inhibits tumor necrosis factor alpha

production in P. gingivalis lipopolysaccharide- treated

RAW cells

The production of proinflammatory cytokines was induced in the

in vitro model using 1 μg/mL P. gingivalis LPS. As expected, P. gi n-

givalis LPS significantly increased the mRNA for TNFα, IL- 6 and

IL- 1β (Figure 2A) and protein levels of TNFα and IL- 6 (Figure 2B).

Interestingly, 5 μmol/L KetoC significantly suppressed both the

mRNA for TNFα, IL- 6 and IL- 1β and protein levels of TNFα and

IL- 6. The protein of IL- 1β was not detected. Furthermore, in-

creasing concentrations of KetoC (0.5, 1.25, 2.5 and 5 μmol/L)

gradually reduced TNFα expression (P < .01; Figure 3), suggesting

that KetoC demonstrated anti- inflammatory effects in a dose-

dependent manner.

3.3 | KetoC suppresses the P. gingivalis

lipopolysaccharide- induced inflammatory response

through GPR120, not GPR40

To confirm the mechanism by which KetoC suppressed TNFα ex-

pression, we investigated the receptor for KetoC in RAW 264.7

cells. KetoC is classified as a long- chain fatty acid, and we focused

on GPR40 and GPR120 as they have been reported as the receptors

for medium- long chain fatty acids.11 We determined the mRNA and

protein expression of GPR40 and GPR120 in RAW 264.7 cells, using

a human monocytic cell line ( THP- 1) for comparison. GPR40 and

GPR120 were detected on both cell lines at mRNA and protein lev-

els. The expression of mRNA for both GPRs seems to be lower while

the protein expression of both GPRs seems to be higher in THP- 1

cells. In addition, it is demonstrated that GPR40 and GPR120 were

expressed on the cell surface by immunostaining assay (Figure 4).

We also used AH7614 (a GPR120 antagonist) to confirm the in-

volvement of GPR120 in the anti- inflammatory effect of KetoC. As

previously stated, the P. gingivalis LPS- treated group showed higher

TNFα production, which was suppressed by KetoC. The addition

of AH7614, but not GW1100 (a GPR40 antagonist), significantly

cancelled the suppressive ef fect of KetoC on TNFα production by

P. gingivalis LPS in RAW 264.7 cells (Figure 5). This result suggests

that GPR120 is the receptor for KetoC, and that blocking GPR120 by

adding AH7614 diminishes the effect of KetoC.

3.4 | KetoC mediates the anti- inflammatory

effect through the intracellular nuclear factor- κB

signaling pathway

Several studies reported that NF- κB signaling is implicated in im-

mune responses, particularly inflammation.22-24 To elucidate the

intracellular mechanism by which KetoC exhibits anti- inflammatory

effects, we investigated the abundance of cytoplasmic and nuclear

NF- κB p65 protein by western blotting analysis. Nuclear NF- κB p65

was increased in the P. gingivalis LPS- treated group and tended to

be decreased in the P. gingivalis LPS+KetoC group. The addition of

AH7614 (GPR120 antagonist) resulted in some abrogation of the ef-

fect of KetoC but it was not statistically significant (Figure 6; right

panel). Taken together, it may be assumed that suppression of NF- κB

p65 brings about the anti- inflammatory effec ts of KetoC on RAW

264.7 cells via the NF- κB signaling pathway.

4 | DISCUSSION

Periodontitis is being increasingly recognized as an inflammatory

disease and not just an ordinary infectious disease, which was solely

caused by periodontal bacteria.1,25 Dental plaque has been reported

FIGURE4 Expression of GPR120 and GPR40 in RAW 264.7

cells and THP- 1 cells. (A) mRNA and (B) protein expressions

of GPR120 and GPR40 in RAW 264.7 and THP- 1 cells were

investigated. GAPDH was used as a reference. (C) GPR120 (green),

GPR40 (red) and their isotypes were visualized. Nuclei were

stained with DAPI (blue). Conventional polymerase chain reaction,

western blotting and immunostaining assays were used for mRNA

detection, protein detection and cell staining, respectively. GAPDH,

glyceraldehyde- 3- phosphate dehydrogenase; GPR, G protein-

coupled receptor

SULIJAYA e t AL.

to contribute to only 20% of the risk of developing periodontitis1;

therefore, periodontal pathogens appear to be a peripheral conse-

quence, rather than a cause, of the disease. Moreover, it is becoming

evident that periodontitis arises from an unregulated inflammatory

reaction to normal microbiota that is exacerbated by the overgrow th

of some disease- associated bacterial species.1, 2 Anti- inflammatory

therapeutics developed based on these concepts has demonstrated

some promising results, including resolvin E1,5 etanercept6 and anti-

inflammatory chemokine CCL22.7

The metabolites produced by gut commensal bacteria have re-

cently drawn a great amount of attention, because their levels are

greatly changed in pathophysiological conditions such as obesity,

FIGURE5 Influence of AH7614

(GPR120 antagonist) and GW1100

(GPR40 antagonist) on the inhibitory

effect of KetoC on TNFα production.

RAW 264.7 cells were pre- treated

with 10 μmol/L AH7614 or 15 μmol/L

GW1100 (1 h before), pre- treated with

5 μmol/L KetoC (30 min before), and then

stimulated with 1 μg /mL P. gingivalis LPS

for 8 h to investigate mRNA levels (A),

and 48 h to investigate protein levels (B).

Data are presented as mean ± SD (n = 3

samples/group). *P < .05, one- way ANOVA

with Bonferroni’s multiple comparisons

test. LPS, lipopolysaccharide; TNF, tumor

necrosis factor

FIGURE6 Cytoplasmic and nuclear NF- κB p65 protein expression. Cytoplasmic (A) and nuclear (B) proteins were separated and

measured by western blotting analysis to compare the four treatment groups; control, P. gingivalis LPS, P. gingivalis LPS+KetoC and

P. gingivalis LPS+KetoC+AH7614. GAPDH and HDAC were used as references in for the cytoplasmic and nuclear fractions, respectively. Data

in the bar graph are presented as mean ± SD (n = 3 samples/group). *P < .05, one- way ANOVA with Bonferroni’s multiple comparisons test.

GAPDH, glyceraldehyde- 3- phosphate dehydrogenase; HDAC, histone deacetylase; LPS, lipopolysaccharide

SULIJAYA et AL.

metabolic disorders,19 oxidative stress- related disease26 and car-

diovascular disease.27 In fact, 10- hydroxy- cis- 12- octadecenoic

acid, a bioactive metabolite generated by probiotic microorganisms

from fatty acid metabolism, is shown to have a protective effect

on Helicobacter infection in mice.28 KetoC is another metabolic by-

product of the same reaction process by Lactobacillus that generates

10- hydroxy- cis- 12- octadecenoic acid from linoleic acid.8 Therefore,

investigation into the effect of KetoC on infection and inflammation

is warranted.

The pres ent study demons trated that ≤5μmol/L KetoC has a

significant anti- inflammatory effect on P. gingivalis LPS- stimulated

RAW 264.7 cells without any effect on cell viability. The suppressive

effect on TNF- α was dose- dependent, which suggests a direct ac-

tion of KetoC . However, a higher concentration of KetoC (50 μmol/L)

seemed to b e cytotoxic to R AW 26 4.7 cells (Figure 1). Based on these

results,weusedKetoCat≤5μmol/L in subsequent experiments.

Interestingly, we found that 5 μmol/L KetoC significantly inhib-

ited the mRNA expression of TNFα, IL- 6 and IL- 1β (Figure 3), and

suppressed the production of TNFα and IL- 6 protein. However, we

could not detect IL- 1β protein in all experimental conditions tested.

Similarly, a previous in vitro study showed that IL- 1β protein was

not detected in LPS- stimulated bone marrow macrophages and

human THP- 1 cells. Additional compounds such as nigericin and ATP

are required for the detection of IL- 1β protein levels;19 however, in

consideration of possible bias resulting from the cross- reaction to

KetoC, we decided not to use these compounds in our experiments.

Nevertheless, KetoC inhibits the expression of the IL- 1β gene and

eventually it suppresses inflammatory response.

The role of both TNFα and IL- 6 in the pathogenesis of periodon-

tal disease is well documented in in vitro, in vivo and clinic al studies.

Compared to non- disease subjects, the level of both cytokines is el-

evated in the gingival crevicular fluid and gingival tissue of patients

with periodontitis.25 In addition, an in vivo study using a ligation

model on a specific pathogen- free Wistar rat demonstrated that the

periodontitis group exhibited higher TNFα and prostaglandin E2 lev-

els.29 TNFα stimulates the production of collagenases, prostaglandin

E2, chemokines, cytokines and bone resorption- related factors,25,30

while IL- 6 stimulates secretion of the receptor activator of the NF- κB

ligand.31 In addition, anti- TNFα treatment is reported to ameliorate

periodontal symptoms in patients with rheumatoid arthritis and with

periodontitis.32,33 An animal study also demonstrated that pentoxi-

fylline, an anti- TNFα drug, significantly suppressed ligature- induced

alveolar bone resorption compared with a placebo.34 Thus, TNFα

could be a major therapeutic target for periodontal disease; though,

compared to KetoC, use of an anti- TNFα drug (pentoxifylline), is

highly unlikely because anti- TNFα antibody likely increases the risk

of infectious diseases and is highly expensive. Therefore, the use of

this kind of drugs is not realistic for the management of periodontal

diseases from a risk- benefit point of view.

To clarify the intracellular signaling pathway by which KetoC

suppressed proinflammator y cytokines, we analyzed the signaling

receptor for KetoC and its intracellular signaling pathway in RAW

264.7 cells. KetoC is well documented as a medium- long chain fatty

acid; therefore, GPR40 and GPR120 are its two main receptor candi-

dates.11,3 5 mRNA and p rotein expression of both GPR40 and GPR120

were detected in mouse and human macrophages. Furthermore, a

previous study has revealed the involvement of GPR120, GPR40

and its potential therapeutic agent in metabolic and inflammation

processes.36 GW1100 and AH7614, the respective antagonist s for

GPR40 and GPR120, were used to clarif y which receptor mediates

KetoC function. Our study revealed for the first time that GPR120

is a functional receptor for KetoC , and suppressing the binding of

KetoC to GPR120 resulted in inhibition of the NF- κB activation.

In conclusion, KetoC, a bioactive metabolite generated by pro-

biotic microorganisms that can be detected from human gut micro-

biota, demonstrated strong anti- inflammatory activity in in vitro

experiments. Considering the paradigm shif t in the understanding

of the pathogenesis of periodontitis and the adverse effects of the

use of antimicrobials for periodontal treatment, the application of

novel bioac tive agent s with high safety levels is expected. KetoC is

a candidate for such a therapeutic agent. Therefore, further studies

that include in vivo experiments are warranted.

ACKNOWLEDGEMENTS

This work was supported in par t by JSPS K AKENHI (grant numbers

15H02578 [K.Y.] and 16H05554 [T. N.]) and Nitto Pharmaceutical

Industries Ltd.

AUTHOR CONTRIBUTION

B.S. and N.T. designed the research under the supervision of T.N.

and K.Y. S.K. and J.O. synthesized KetoC. B.S., N.T., M.Ya., M.Yo.

and K.S. performed the experiments. B.S., N.T., Y.M., H.M. and

Y.A. analyzed the statistical data. B.S., N.T. and K.Y. wrote the

manuscript.

CONFLICT OF INTEREST

K.Y. received a grant from Nitto Pharmaceutical Industries Ltd.

(Kyoto, Japan), but they did not have any additional role in the

study design, data collection and analysis, decision to publish, or

preparation of the manuscript. No other author has any competing

interests.

ORCID

K. Yamazaki http://orcid.org/0000-0002-1893-4202

REFERENCES

1. Bartold PM, Van Dyke TE. Host modulation: controlling the inflam-

mation to control the infection. Periodontol 2000. 2017;75:317-329.

2. Bartold PM, Van Dyke TE. Periodontitis: a host- mediate d disruption

of microbial homeostasis. Unlearning learned concepts. Periodontol

2000. 2013;62:203-217.

SULIJAYA e t AL.

3. Socransky SS , Haffajee AD, Cugini MA, Smith C, Kent RL Jr.

Microbial complexes in subgingival plaque. J Clin Periodontol.

1998;25:134-144.

4. Hajishengallis G, Liang S, Payne MA, et al. Low- abundance biofilm

species orchestrates inflammatory periodontal disease through

the commensal microbiota and complement. Cell Host Microbe.

2011;10:497-506.

5. Hastur k H, Kantarci A , Goguet-Surmenian E, et al. Resolvin E1 regu-

lates inflammation at the cellular and tissue level and restores tissue

homeostasis in vivo. J Immunol. 2007;179:7021-7029.

6. Di Paola R, Mazzon E, Muia C, et al. Effect s of etanercept, a tumour

necrosis factor- α antagonist, in an experimental model of periodon-

titis in rats. Br J Pharmacol. 2007;150:286-297.

7. Glowacki AJ, Yoshizawa S, Jhunjhunwala S, et al. Prevention of

inflammation- mediated bone loss in murine and canine periodontal

disease via recruitment of regulator y lymphocytes. Proc Natl Acad

Sci U S A. 2013;110:18525-1853 0.

8. Kishino S, Takeuchi M , Park SB, et al. Polyunsaturated fatty acid

saturation by gut lactic acid bacteria affecting host lipid composi-

tion. Proc Natl Acad Sci U S A. 2013;110:17808-17813.

9. Furumoto H, Nanthirudjanar T, Kume T, et al. 10- Oxo- trans- 11-

octadecenoic acid generated from linoleic acid by a gut lactic acid

bacterium Lactobacillus plantarum is cytoprotective against oxida-

tive stress. Toxicol Appl Pharmacol. 2016;296:1-9.

10. Galli C, Calder PC . Effec ts of fat and fatt y acid intake on inflam-

matory and immune responses: a critical review. Ann Nutr Metab.

2009;55:123-139.

11. Hirasawa A, Hara T, Katsuma S, Adachi T, Tsujimoto G. Free

fatty acid receptors and drug discovery. Biol Pharm Bull.

2008;31:1847-1851.

12. Li N, Alam J, Venkatesan MI, et al. Nrf2 is a key transcription

factor that regulates antioxidant defense in macrophages

and epithelial cells: protec ting against the proinflammatory

and oxidizing effects of diesel exhaust chemicals. J Immunol.

2004;173:3467-3481.

13. Schieber M , Chandel NS. ROS function in redox signaling and oxida-

tive stress. Curr Biol. 2014;24:R453-R462.

14. Wang H, Zhou H, Duan X, et al. Porphyromonas gingivalis- induced

reactive oxygen species activate JAK2 and regulate produc-

tion of inflammator y cytokines through c- Jun. Infect Immun.

2014 ;82:411 8- 4126 .

15. Yang HE, Li Y, Nishimura A , et al. Synt hesized enone fat ty acids re-

sembling metabolites from gut microbiota suppress macrophage-

mediated inflammation in adipocytes. Mol Nutr Foo d Res.

20 17 ;6 1: 1-13 .

16 . Gibson FC 3rd, Genco CA. Porphyromonas gingivalis mediated

periodontal disease and atherosclerosis: disparate diseases with

commonalities in pathogenesis through TLRs. Curr Phar m Des.

2007;13:3665-3675.

17. Bognar E, Sarszegi Z, Szabo A, et al. Antioxidant and anti-

inflammatory ef fect s in RAW264.7 macrophages of malvidin, a

major red wine polyphenol. PLoS ONE. 2013;8:e65355.

18. Lee SY, Kim HJ, Han JS. Anti- inflammatory effect of oyster shell

extract in LPS- stimulated Raw 264.7 cells. Prev Nutr Food Sci

2013;18:23-29.

19. Yan Y, Jiang W, Spinetti T, et al. Om ega- 3 fat ty acids prevent inflam-

mation and metabolic disorder through inhibition of NLRP3 inflam-

masome activation. Immunity. 2013 ;38 :1154-1163.

20. Livak K J, Schmittgen TD. Analysis of relative gene expression data

using real- time quantitative PCR and the 2-ΔΔCT method. Methods.

2001;25:402-408.

21. Takahashi N, Honda T, Domon H, Nakajima T, Tabeta K, Yamazaki

K. Interleukin- 1 receptor- associated kinase- M in gingival epi-

thelial cells attenuates the inflammatory response elicited by

Porphyromonas gingivalis. J Periodontal Res. 20 10 ;45:512-519.

22. Sakurai H, Suzuki S, Kawasaki N, et al. Tumor necrosis factor- α-

induced IKK phosphorylation of NF- κB p65 on serine 536 is medi-

ated through the TR AF2, TRAF5, an d TAK1 signaling pathway. J Biol

Chem. 2003;278:36916-36923.

23. Smal e ST. Hierarchies of N F- κB ta rget- ge ne regulation . Nat Immunol.

2011;12:689-694.

24. Wardyn JD, Ponsford AH, Sanderson CM. Dissecting molecular

cross- talk between Nrf2 and NF- κB response pathways. Biochem

Soc Trans. 2015;43:621-626.

25. Cekici A, Kantarci A, Has turk H, Van Dyke TE. Inflammatory and

immune pathways in the pathogenesis of periodont al disease.

Periodontol 2000. 2014; 64:57- 80 .

26. Bergamo P, Luongo D, Miyamoto J, et al. Immunomodulatory

activity of a gut microbial metabolite of dietary linoleic acid,

10- hydroxy- cis- 12- oct adecenoic acid, associated with improved

antioxidant/detoxifying defences. J Funct Foods. 2014;11:192-202.

27. Nanthirudjanar T, Furumoto H , Zheng J, et al. Gut microbial fatty

acid metabolites reduce triacylglycerol levels in hepatocytes. Lipids.

2015;50:1093-1102.

28. Matsui H, Takahashi T, Murayama SY, Kawaguchi M, Mat suo K,

Nakamura M. Protective ef ficacy of a hydrox y fatt y acid against

gastric Helicobacter infections. Helicobacter. 2017;22:1-11.

29. Liao CH, Fei W, Shen ZH, Yin MP, Lu C. Expression and dis tribution

of TNF- α and PGE2 of periodontal tissues in rat periodontitis model.

Asian Pac J Trop Med. 2014;7:412-416.

30. Bastos MF, Lima JA, Vieira PM, Mes tnik MJ, Faveri M, Duar te PM.

TNF- α and IL- 4 levels in generalized aggressive periodontitis sub-

jects. Oral Dis. 2009;15:82-87.

31. Fe ng X, Shi Y, Xu L, et al. Modulation of IL- 6 indu ced RANKL exp res-

sion in arthritic synovium by a transcription factor SOX5. Sci Rep.

2016;6:32001.

32. Kobayashi T, Yoshie H. Host responses in the link between peri-

odontitis and rheumatoid ar thritis. Curr O ral Health Rep. 2015;2:1-8.

33. Mayer Y, Balbir-Gurman A, Machtei EE. Anti- tumor necrosis fac-

to r- α ther apy and periodont al parameters in patients with rheuma-

toid art hritis. J Periodontol. 200 9;80:1414-1420 .

34. Lima V, Vidal FD, Rocha FA, Brito GA , Ribeiro RA . Effects of tumor

necrosis factor- α inhibitors pentoxifylline and thalidomide on al-

veolar bone loss in short- term experimental periodont al disease in

rats. J Periodontol. 20 04;75:162-168.

35. Hara T, Hirasawa A, Ichimura A, Kimura I, Tsujimoto G. Free fatty

acid receptors FFAR1 and GPR120 as novel therapeutic targets for

metabolic disorders. J Pharm Sci. 2011;100:3594-3601 .

36. Milligan G, Alvarez-Cur to E, Watterson KR , Ulven T, Hudson

BD. Characterizing pharmacological ligands to study the long-

chain fat ty acid receptor s GPR40/FFA1 and GPR120/FFA4. Br J

Pharmacol. 2015;172:3254-3265.

How to cite this article: Sulijaya B, Takahashi N, Yamada M,

et al. The anti- inflammatory effec t of 10- oxo- trans- 11-

octadecenoic acid (KetoC) on R AW 264.7 cells stimulated

with Porphyromonas gingivalis lipopolysaccharide. J Periodont

Res. 2018;00:1–8. http s://doi.o rg /10.1111/jre.12564

The gut lactic acid bacteria metabolite, 10-oxo-cis-6,trans-11-octadecadienoic acid, suppresses inflammatory bowel disease in mice by modulating the NRF2 pathway and GPCR-signaling

Article

Full-text available

Apr 2024

Various gut bacteria, including Lactobacillus plantarum, possess several enzymes that produce hydroxy fatty acids (FAs), oxo FAs, conjugated FAs, and partially saturated FAs from polyunsaturated FAs as secondary metabolites. Among these derivatives, we identified 10-oxo-cis-6,trans-11-octadecadienoic acid (γKetoC), a γ-linolenic acid (GLA)-derived enon FA, as the most effective immunomodulator, which inhibited the antigen-induced immunoactivation and LPS-induced production of inflammatory cytokines. The treatment with γKetoC significantly suppressed proliferation of CD4⁺ T cells, LPS-induced activation of bone marrow-derived dendritic cells (BMDCs), and LPS-induced IL-6 release from peritoneal cells, splenocytes, and CD11c⁺ cells isolated from the spleen. γKetoC also inhibited the release of inflammatory cytokines from BMDCs stimulated with poly-I:C, R-848, or CpG. Further in vitro experiments using an agonist of GPR40/120 suggested the involvement of these GPCRs in the effects of γKetoC on DCs. We also found that γKetoC stimulated the NRF2 pathway in DCs, and the suppressive effects of γKetoC and agonist of GPR40/120 on the release of IL-6 and IL-12 were reduced in Nrf2-/- BMDCs. We evaluated the role of NRF2 in the anti-inflammatory effects of γKetoC in a dextran sodium sulfate-induced colitis model. The oral administration of γKetoC significantly reduced body weight loss, improved stool scores, and attenuated atrophy of the colon, in wild-type C57BL/6 and Nrf2+/- mice with colitis. In contrast, the pathology of colitis was deteriorated in Nrf2-/- mice even with the administration of γKetoC. Collectively, the present results demonstrated the involvement of the NRF2 pathway and GPCRs in γKetoC-mediated anti-inflammatory responses.

Polyunsaturated Fatty Acids as Prebiotics: Innovation or Confirmation?

Article

Full-text available

Jan 2022

The International Scientific Association for Probiotics and Prebiotics (ISAPP), in its last consensus statement about prebiotics, defined polyunsaturated fatty acids (PUFAs) as “candidate prebiotics” due to a lack of complete scientific evidence. Previous studies have demonstrated the ability of microbiota to metabolize PUFAs, although the role of the resulting metabolites in the host is less known. Recent partial evidence shows that these metabolites can have important health effects in the host, reinforcing the concept of the prebiotic action of PUFAs, despite the data being mostly related to omega-6 linoleic acid and to lactobacilli taxon. However, considering that the symbionts in our gut benefit from the nutritional molecules that we include in our diet, and that bacteria, like all living organisms, cannot benefit from a single nutritional molecule, the concept of the “correct prebiotic diet” should be the new frontier in the field of gut microbiota research.

Recent Advance in Regulatory Effect of GRP120 on Bone Metabolism

Article

Full-text available

Oct 2023

The link between fatty acids and bone metabolism is complex and can be direct and indirect. This link has been reported in different types of bone cells and various stages of bone metabolism. G-protein coupled receptor 120 (GPR120), also called free fatty acid receptor 4 (FFAR4), is a member of the recently discovered G protein-coupled receptor family that can interact with both long-chain saturated fatty acids (C14-C18) and long-chain unsaturated fatty acids (C16-C22). Research shows that GPR120 regulates processes in different types of bone cells, directly or indirectly affecting bone metabolism. Our research reviewed the literature on the effects of GPR120 on bone marrow mesenchymal stem cells (BMMSCs), osteoblasts, osteoclasts, and chondrocytes, focusing on the research findings regarding the mechanism by which GPR120 alters specific bone metabolic diseases-osteoporosis and osteoarthritis. The data reviewed here provide a basis for clinical and basic research into the role of GPR120 on bone metabolic diseases.

Role of G-protein Coupled receptor (GPCRs)/(GPR120) as an Agonists in Diabetic wound healing

Article

Nov 2022

Type 2 diabetes (T2D) or Obesity has been gradually rising throughout the globe. It is a major cause of noncommunicable illnesses such as cardiovascular disease type 2 diabetes (T2D), Nonalcoholic Steatohepatitis (NASH), nonalcoholic fatty liver disease (NAFLD), and numerous malignancies, all of which have a negative effect on quality of natural life and life expectancy. Diabetic wound healing is hampered by a complicated pathophysiology combining immunological, metabolic factors and neuropathic. There are more than thirty GPCRs that have been occupied in the expansion or development of β-cell disfunction, insulin resistance, obesity, and T2DM Still, at current, only the GLP-1R has been effectively battered therapeutically. They play major function in gut hormone Secretion and appetite control adipogenesis, anti-inflammatory functions, antidiabetic functions. Diabeties is current treated by dressings, antidiabetic Drugs, growth factors such as (TGF1, FGF, EGF, VEGF and PDGF). Future therapeutic strategies will be based on single growth factor, multiple growth factor, skin, cytokine enhancer, cytokine antagonist, matrix metalloproteinase a

Systematic evaluation of irinotecan-induced intestinal mucositis based on metabolomics analysis

Article

Full-text available

Sep 2022

Chemotherapy-induced intestinal mucositis (CIM) is a major dose-limiting side effect of chemotherapy, especially in regimens containing irinotecan (CPT-11). Several studies on the pathologic mechanisms of CIM focused on both the genomics and molecular pathways triggered by chemotherapy. However, systematic evaluation of metabolomic analysis in irinotecan-induced intestinal mucositis (IIM) has not been investigated. This study aimed to comprehensively analyze metabolite changes in main tissues of IIM mouse models. Male ICR mice were assigned to two groups: the model group (n = 11) treated with CPT-11 (20 mg/kg daily; i.p.) and the control group (n= 11) with solvent for 9 days. Gas chromatography-mass spectrometry (GC-MS) was used to investigate the metabolic alterations in the serum, intestinal, colonic, hepatic, and splenic samples of mice between two groups by multivariate statistical analyses, including GC–MS data processing, pattern recognition analysis, and pathway analysis. Forty-six metabolites, including hydrocarbons, amino acids, lipids, benzenoids, hydroxy acids, and amines, had significant changes in levels in tissues and sera of IIM mouse models. The most important pathways related to the identified metabolites were the glycerolipid metabolism in the colon and aminoacyl-tRNA biosynthesis; glycine, serine, and threonine metabolism; and glyoxylate and dicarboxylate metabolism in the liver. Our study firstly provided a comprehensive and systematic view of metabolic alterations of IIM using GC-MS analysis. The characterizations of metabolic changes could offer profound and theoretical insight into exploring new biomarkers for diagnosis and treatment of IIM.

Dietary Fatty Acids, Gut Microbiome, and Gut–Brain Communication: A Current Perspective

Chapter

Aug 2022

Globally, the significance of gut microbial composition in alleviating several intestinal complications has gained tremendous clinical consideration. Increasing lines support the evidence that, healthy lipids such as omega fatty acids and short-chain fatty acids play a pivotal role in orchestrating the composition and shaping the host microbial population in the gastrointestinal system by producing protective derivatives, restoring intestinal gut barrier, modulating gut microbial community, nervous, and immune system, attenuating inflammation, insulin resistance, and fat accumulation. In the above context, the present chapter uncovers the recent advancements carried out in the recent past on the impact of long- and short-chain fatty acids on gut microbiome–brain communication.

THE OCCURRENCE OF INDIGENOUS EDIBLE MUSHROOMS IN KAYA CHIVARA FOREST IN KILIFI, KENYA

Article

Full-text available

Jul 2022

GPR120/FFAR4 Pharmacology: Focus on Agonists in Type 2 Diabetes Mellitus Drug Discovery

Article

Full-text available

Apr 2021
J MED CHEM

The G-protein coupled receptors (GPCRs) activated by free fatty acids (FFAs) have emerged as new and exciting drug targets, due to their plausible translation from pharmacology to medicines. This perspective aims to report recent research about GPR120/FFAR4 and its involvement in several diseases, including cancer, inflammatory conditions, and central nervous system disorders. The focus is to highlight the importance of GPR120 in Type 2 diabetes mellitus (T2DM). GPR120 agonists, useful in T2DM drug discovery, have been widely explored from a structure-activity relationship point of view. Since the identification of the first reported synthetic agonist TUG-891, the research has paved the way for the development of TUG-based molecules as well as new and different chemical entities. These molecules might represent the starting point for the future discovery of GPR120 agonists as antidiabetic drugs.

Recent trends in the field of lipid engineering

Article

Mar 2022
J BIOSCI BIOENG

Lipid engineering related to biological functions has made remarkable progress in the fields of microbial production of functional lipids, metabolic engineering of microorganisms, elucidation of physiological functions of rare lipids, lipid-related enzyme engineering, and lipid analysis techniques. Various rare lipids are produced by utilizing microorganisms and their enzymes. It is also becoming clear that the rare lipids produced by intestinal bacteria contribute significantly to human health. Technological advances related to identification of lipid structures and quantification of lipids have led to such discoveries in the field of lipid engineering. This article reviews the latest findings that are attracting attention in the field of lipid engineering related to biological functions.

Probiotics-Mediated Bioconversion and Periodontitis

Article

Full-text available

Oct 2021

Novel bioactive metabolites have been developed through a bioconversion of dairy products or other foods using probiotics isolated from dairy products or other fermented foods. These probiotics-mediated bioconversion (PMB) metabolites show antioxidant, anti-inflammatory, antimicrobial, epithelial barrier, and anticancer activities. In addition, the effect of PMB metabolites in periodontitis is recently reported in several studies. Periodontitis is a chronic inflammatory disease caused by infections, and the tooth support tissue is destroyed. Common treatments for periodontitis include scaling and root planning with systemic antibiotics. However, the overuse of antibiotics has led to the emergence of drug-resistant microorganisms and disturbs the beneficial bacteria, including lactobacilli in the oral cavity. For this reason, PMB metabolites, such as fermented milk, have been suggested as substitutes for antibiotics to reduce periodontitis. This paper reviews the recent studies on the correlation between periodontitis and PMB metabolites and classifies the efficacy of major PMB metabolites for periodontitis. The review suggests that PMB is effective for periodontitis, and further studies are needed to confirm the therapeutic effect of PMB metabolites on periodontitis.

Modulation of IL-6 induced RANKL expression in arthritic synovium by a transcription factor SOX5

Article

Full-text available

Aug 2016

Receptor activator of nuclear factor κB ligand (RANKL) is critically involved in bone erosion of rheumatoid arthritis (RA). We previously reported association between younger age at onset of RA and a RANKL promoter SNP that conferred an elevated promoter activity via binding to a transcription factor SOX5. Here we study the regulation of SOX5 levels in relation to RANKL expression in RA synovial fibroblasts (SF) and the development of bone erosion in the collagen-induced arthritis (CIA) mouse. Our data indicated SOX5 levels were higher in synovium and synovial fluid from RA compared to osteoarthritis patients. Pro-inflammatory cytokines upregulated SOX5 and RANKL expression in both primary RA SF and the rheumatoid synovial fibroblast cell line, MH7A. Overexpression of SOX5 resulted in significantly increased RANKL levels, while knockdown of SOX5 resulted in diminished IL-6 mediated RANKL upregulation in MH7A cells. Chromatin immunoprecipitation (ChIP) showed approximately 3-fold enrichment of RANKL-specific DNA in anti-SOX5 immunoprecipitate in IL-6 treated MH7A cells as compared to untreated cells. Locally silencing SOX5 gene significantly diminished RANKL positive cells and bone erosion in CIA mice. These findings suggest SOX5 is an important regulator of IL-6-induced RANKL expression in RA SF.

The Keap1/Nrf2 pathway in health and disease Dissecting molecular cross-talk between Nrf2 and NF-κB response pathways

Article

Full-text available

Aug 2015

In most tissues, cells are exposed to frequent changes in levels of oxidative stress and inflammation. Nuclear factor (erythroid-derived 2)-like 2 (Nrf2) and nuclear factor-κB (NF-κB) are the two key transcription factors that regulate cellular responses to oxidative stress and inflammation respectively. Pharmacological and genetic studies suggest that there is functional cross-talk between these two important pathways. The absence of Nrf2 can exacerbate NF-κB activity leading to increased cytokine production, whereas NF-κB can modulate Nrf2 transcription and activity, having both positive and negative effects on the target gene expression. This review focuses on the potentially complex molecular mechanisms that link the Nrf2 and NF-κB pathways and the importance of designing more effective therapeutic strategies to prevent or treat a broad range of neurological disorders.

Host Responses in the Link Between Periodontitis and Rheumatoid Arthritis

Article

Full-text available

Mar 2015

Periodontitis and rheumatoid arthritis (RA) are common chronic inflammatory conditions and share many clinical and pathologic features. There is evidence to suggest that similar profiles of cytokine genotypes and their coding proteins are involved in the pathogenesis of periodontitis and RA. In particular, constitutive overproduction of pro-inflammatory cytokines, including tumor necrosis factor-alpha (TNF-α) and interleukin-6 (IL-6), has been implicated to play a pathologic role in the two inflammatory diseases. Results from studies with animal and human subjects have suggested an improvement of periodontal inflammatory condition after treatment with TNF-α inhibitors. Likewise, IL-6 receptor inhibition therapy has been suggested to have an effect on control of periodontal inflammation in patients with RA. In the present review, we provide an overview of studies showing the pathological role of cytokines in the linkage between periodontitis and RA, and further summarize the current studies assessing the effect of cytokine targeted therapy on periodontal condition.

Protective efficacy of a hydroxy fatty acid against gastric Helicobacter infections

Article

Aug 2017
HELICOBACTER

Background: We have previously revealed that omega-3 polyunsaturated fatty acids can prevent Helicobacter pylori infection by blocking the futalosine pathway, an alternative route for menaquinone (MK) biosynthesis. Materials and methods: 1, Different H. pylori strains were grown in liquid media supplemented with linoleic acid, an omega-6 fatty acid, or its 10-hydroxy derivative, 10-hydroxy-cis-12-octadecenoic acid (HYA), in the presence or absence of MK. The bacterial numbers in the media were estimated by plating; 2, C57BL/6NCrl mice received drinking water supplemented with different fatty acids starting from 1 week before infection with H. pylori or Helicobacter suis until the end of the experiment. The gastric colonization levels of H. pylori or H. suis were determined 2 weeks after infection by plating or quantitative PCR, respectively; 3, Mice were given HYA, starting 1 week before infection with H. suis and continuing until 6 months after infection, for analysis of the gastric conditions. Results: 1, A low concentration (20 μmol/L) of HYA in culture broth suppressed the growth of H. pylori, and this inhibition was reduced by MK supplementation; 2, HYA treatment protected mice against H. pylori or H. suis infection; 3, HYA treatment suppressed the formation of lymphoid follicles in the gastric mucus layer after H. suis infection. Conclusions: HYA prevents gastric Helicobacter infections by blocking their futalosine pathways. Daily HYA supplementation is effective for the prevention of gastric mucosa-associated lymphoid tissue lymphoma induced by persistent infection with H. suis.

Host modulation: controlling the inflammation to control the infection

Article

Oct 2017
PERIODONTOL 2000

Historically, periodontal disease (gingivitis and periodontitis) has been recognized as being primarily of bacterial origin. However, recent evidence indicates that while bacteria are necessary for disease development they are not sufficient for the clinical manifestation of the many and varied forms of periodontal disease. It is becoming increasingly apparent that it is the host inflammatory response to the subgingival bacteria that is responsible for the tissue damage and, most likely, progression of the disease. We explore the concept that it is the subgingival microenvironment modified by the inflammatory response that leads to a change from a commensal to pathogenic microbiota. In this review, we examine the evidence for the emerging paradigm supporting the central role of inflammation rather than specific microbiota in the pathogenesis of periodontitis, and that by controlling the inflammation, it is possible to control the infection. As an extension of this, we propose a working model for the ongoing monitoring of periodontal patients using the medical model of ‘treat to target’.

Synthesized enone fatty acids resembling metabolites from gut microbiota suppress macrophage-mediated inflammation in adipocytes

Article

May 2017
MOL NUTR FOOD RES

Scope: Recent reports indicate that gut microbiota and their metabolite may regulate inflammatory conditions, including the chronic inflammation of obese adipose tissues, in the host. In this study, we investigated whether specific synthesized fatty acids, identical to the metabolites generated by gut microbiota, act as anti-inflammatory factors in inflammation-induced obesity. Methods and results: We first used lipopolysaccharide-stimulated RAW 264.7 macrophages to examine the anti-inflammatory effect of fatty acids synthesized to resemble representative polyunsaturated fatty acid metabolites from gut microbiota. Fatty acids containing an enone structure showed the most potent anti-inflammatory activity. Enone fatty acids also displayed anti-inflammatory effects on macrophages co-cultured with hypertrophied 3T3-L1 or immortalized primary adipocytes; and macrophages stimulated with 3T3-L1 adipocyte conditioned medium. Consistently, the beneficial outcome was revealed in the case of LPS- and obesity-induced inflammatory cytokine stimulation in ex vivo adipose tissues. Furthermore, these fatty acids recovered the suppression of β-adrenergic receptor-stimulated uncoupling protein 1 expression and secretion of adiponectin in C3H10T1/2 and 3T3-L1 adipocytes respectively, under inflammatory conditions, suggesting that enone fatty acids can ameliorate dysfunctions of adipocytes induced by inflammation. Conclusion: These findings indicate that synthesized enone fatty acids show potent anti-inflammatory effects, leading to the improvement of inflammation-induced dysfunctions in adipocytes. This article is protected by copyright. All rights reserved.

Microbial complexes in subgingival plaque

Article

Feb 1998

It has been recognized for some time that bacterial species exist in complexes in subgingival plaque. The purpose of the present investigation was to attempt to define such communities using data from large numbers of plaque samples and different clustering and ordination techniques. Subgingival plaque samples were taken from the mesial aspect of each tooth in 185 subjects (mean age 51 +/- 16 years) with (n = 160) or without (n = 25) periodontitis. The presence and levels of 40 subgingival taxa were determined in 13,261 plaque samples using whole genomic DNA probes and checkerboard DNA-DNA hybridization. Clinical assessments were made at 6 sites per tooth at each visit. Similarities between pairs of species were computed using phi coefficients and species clustered using an averaged unweighted linkage sort. Community ordination was performed using principal components analysis and correspondence analysis. 5 major complexes were consistently observed using any of the analytical methods. One complex consisted of the tightly related group: Bacteroides forsythus, Porphyromonas gingivalis and Treponema denticola. The 2nd complex consisted of a tightly related core group including members of the Fusobacterium nucleatum/periodonticum subspecies, Prevotella intermedia, Prevotella nigrescens and Peptostreptococcus micros. Species associated with this group included: Eubacterium nodatum, Campylobacter rectus, Campylobacter showae, Streptococcus constellatus and Campylobacter gracilis. The 3rd complex consisted of Streptococcus sanguis, S. oralis, S. mitis, S. gordonii and S. intermedius. The 4th complex was comprised of 3 Capnocytophaga species, Campylobacter concisus, Eikenella corrodens and Actinobacillus actinomycetemcomitans serotype a. The 5th complex consisted of Veillonella parvula and Actinomyces odontolyticus. A. actinomycetemcomitans serotype b, Selenomonas noxia and Actinomyces naeslundii genospecies 2 (A. viscosus) were outliers with little relation to each other and the 5 major complexes. The 1st complex related strikingly to clinical measures of periodontal disease particularly pocket depth and bleeding on probing.

10-Oxo-trans-11-octadecenoic acid generated from linoleic acid by a gut lactic acid bacterium Lactobacillus plantarum is cytoprotective against oxidative stress

Article

Feb 2016

Unlabelled: Oxidative stress is a well-known cause of multiple diseases. The nuclear factor erythroid 2-related factor 2 (Nrf2)-antioxidant response element (ARE) pathway plays a central role in cellular antioxidative responses. In this study, we investigated the effects of novel fatty acid metabolite derivatives of linoleic acid generated by the gut lactic acid bacteria Lactobacillus plantarum on the Nrf2-ARE pathway. 10-Oxo-trans-11-octadecenoic acid (KetoC) protected HepG2 cells from cytotoxicity induced by hydrogen peroxide. KetoC also significantly increased cellular Nrf2 protein levels, ARE-dependent transcription, and the gene expression of antioxidative enzymes such as heme oxygenase-1 (HO-1), glutamate-cysteine ligase modifier subunit (GCLM), and Nad(p)h: quinone oxidoreductase 1 (NQO1) in HepG2 cells. Additionally, a single oral dose administration of KetoC also increased antioxidative gene expression and protein levels of Nrf2 and HO-1 in mouse organs. Since other fatty acid metabolites and linoleic acid did not affect cellular antioxidative responses, the cytoprotective effect of KetoC may be because of its α,β-unsaturated carbonyl moiety. Collectively, our data suggested that KetoC activated the Nrf2-ARE pathway to enhance cellular antioxidative responses in vitro and in vivo, which further suggests that KetoC may prevent multiple diseases induced by oxidative stress.

Gut Microbial Fatty Acid Metabolites Reduce Triacylglycerol Levels in Hepatocytes

Article

Sep 2015
LIPIDS

Hydroxy and oxo fatty acids were recently found to be produced as intermediates during gut microbial fatty acid metabolism. Lactobacillus plantarum produces these fatty acids from unsaturated fatty acids such as linoleic acid. In this study, we investigated the effects of these gut microbial fatty acid metabolites on the lipogenesis in liver cells. We screened their effect on sterol regulatory element binding protein-1c (SREBP-1c) expression in HepG2 cells treated with a synthetic liver X receptor α (LXRα) agonist (T0901317). The results showed that 10-hydroxy-12(Z)-octadecenoic acid (18:1) (HYA), 10-hydroxy-6(Z),12(Z)-octadecadienoic acid (18:2) (γHYA), 10-oxo-12(Z)-18:1 (KetoA), and 10-oxo-6(Z),12(Z)-18:2 (γKetoA) significantly decreased SREBP-1c mRNA expression induced by T0901317. These fatty acids also downregulated the mRNA expression of lipogenic genes by suppressing LXRα activity and inhibiting SREBP-1 maturation. Oral administration of KetoA, which effectively reduced triacylglycerol accumulation and acetyl-CoA carboxylase 2 (ACC2) expression in HepG2 cells, for 2 weeks significantly decreased Srebp-1c, Scd-1, and Acc2 expression in the liver of mice fed a high-sucrose diet. Our findings suggest that the hypolipidemic effect of the fatty acid metabolites produced by L. plantarum can be exploited in the treatment of cardiovascular diseases or dyslipidemia.

Immunomodulatory activity of a gut microbial metabolite of dietary linoleic acid, 10-hydroxy-cis-12-octadecenoic acid, associated with improved antioxidant/detoxifying defences

Article