![Alignments of ITS sequences in the regions used for primer design (boxed area) for (A) Fusarium solani, (B) Pythium ultimum, (C) Rhizoctonia solani, and (D) Verticillium species that cause tomato wilt. To illustrate primer specificity, sequences of the target pathogen are aligned with sequences of the most related fungi or oomycetes shown in Table 1. Identical nucleotides are marked with an asterisk and gaps are indicated by dashes. Selected forward primers that are combined with the universal reverse primer ITS4 [18] are underlined with a single line. Selected reverse primers (reverse complement sequence) that are combined with the fungalspecific forward primer ITS1-F [17] are double underlined.](https://www.researchgate.net/profile/Bart-Lievens/publication/222214350/figure/fig1/AS:378032251523072@1467141320115/Alignments-of-ITS-sequences-in-the-regions-used-for-primer-design-boxed-area-for-A_Q320.jpg)
Content uploaded by Bart Lievens
Author content
All content in this area was uploaded by Bart Lievens on Jun 28, 2016
Content may be subject to copyright.
A preview of the PDF is not available
Real-time PCR for detection and quantification of fungal and oomycete tomato pathogens in plant and soil samples
Abstract and Figures
Although new, rapid detection and identification technologies are becoming available more and more for various plant pathogens, pathogen quantification remains one of the main challenges in the disease management of many crops. Currently, real-time polymerase chain reaction (PCR) is the most straightforward technique to quantify pathogen presence. This manuscript describes the use of real-time PCR to quantitatively assess the presence of a number of economically important fungal and oomycete tomato pathogens in biological samples. We demonstrate that pathogen DNA can be accurately quantified over at least four orders of magnitude. Additionally, we demonstrate the feasibility of the technique to quantify pathogen biomass in complex biological samples.
Figures - uploaded by Bart Lievens
Author content
All figure content in this area was uploaded by Bart Lievens
Content may be subject to copyright.
... For plants inoculated with Vd71181 and the mCherry transformants, single spores were further obtained from the culture of stem sections on half-strength PDA. DNA was extracted from each isolate using a rapid extraction method [54] and PCR was performed using Verticillium specific ITS1 primers [55] to confirm their identity (Table S2). ...
... The following supporting information can be downloaded at: www.mdpi.com/xxx/s1, Figure S1: Anatomy of a cotton seedling approximately 10 -14 days after sowing; Table S1: Primers for yeast recombinantion-based cloning of to generate a plasmid for expression of mCherry in Verticillium dahliae; Table S2: Verticillium dahliae-specific primers [55] amplifying a 200 bp ITS product were used to confirm its identity; Table S3: Summary of rate of colonisation based on timing of initial observation at each infection stage throughout the confocal microscopy experiment; Table S4: mCherry transformant isolates selected for comparison against Verticillium dahliae VCG 1A parent, Vd71181, that originated from Gwydir Valley, NSW. ...
Verticillium wilt is a soil borne disease caused by distinct vegetative compatibility groups (VCG) of the fungus Verticillium dahliae. Two V. dahliae isolates were recovered from symptomatic cot-ton plants in Australian cotton fields and were assigned to two distinct vegetative compatibility groups (VCGs). One corresponding to the defoliating (VCG 1A) and the other non-defoliating (VCG 2A) pathotypes of Verticillium, have been transformed with Red and Green Fluorescent protein genes, respectively. The transformants maintained their ability to infect cotton and both strains were observed to colonise the xylem vessels of cotton plants. Moreover, we observed that the cotton V. dahliae strains could also infect some sampled non-Gossypium species found in the Australian landscape. The fluorescently labelled strains of V. dahliae will allow us to gain a thorough understanding of the infection processes of this important pathogen.
... For plants inoculated with VCG1A-WT and the mCherry transformants, single spores were further obtained from the culture of stem sections on half-strength PDA. DNA was extracted from each isolate using a rapid extraction method [30], and PCR was performed using Verticillium-specific ITS1 primers [31] to confirm their identity (Table S2). ...
... Figure S5: Colonies from stem reisolations confirmed under a confocal microscope to carry GFP or mCherry proteins. Table S1: Primers for yeast recombination-based cloning to generate a plasmid for the expression of mCherry in Verticillium dahliae; Table S2: Verticillium dahliae-specific primers [31] amplifying a 200 bp ITS product were used to confirm its identity; Table S3: Summary of rate of colonisation based on timing of initial observation at each infection stage throughout the confocal microscopy experiment; Table S4: mCherry transformant isolates selected for comparison against Verticillium dahliae VCG 1A parent, Vd71181, that originated from Gwydir Valley, NSW. ...
Verticillium wilt is a soil-borne disease caused by distinct vegetative compatibility groups (VCG) of the fungus Verticillium dahliae. Defoliating (VCG 1A) and non-defoliating (VCG 2A) patho-types of V. dahliae have contributed to yield losses of cotton production in Australia. To study the virulence and the infection process of V. dahliae on cotton, two isolates, one representing each VCG, have been transformed with fluorescent protein genes. The transformants maintained their ability to infect the host, and both strains were observed to move through the plant vasculature to induce wilt symptoms. Furthermore, virulence testing suggests that the cotton V. dahliae strains can endo-phytically colonise common weed plant species found in the Australian landscape, and that is contrasted by their ability to infect and colonise native tobacco plants. The fluorescently labelled strains of V. dahliae not only allowed us to gain a thorough understanding of the infection process but also provided a method to rapidly identify recovered isolates from host colonisation studies.
... In recent years, real time PCR based techniques have emerged as robust tools for diagnosis and quantification of seed borne pathogens and have contributed greatly to plant disease management (Guillemette et al, 2004;Lievens et al, 2006;Alaei et al, 2009;Debode et al, 2009). Real time PCR offers several advantages compared to conventional PCR based detection of plant disease diagnosis: increased sensitivity, no post PCR processing and allows quantification of target DNA (Schena et al, 2004). ...
... The lower detection limit by real-time PCR assays was possible due to less inhibition by plant inhibitors in real time PCR assays than that of conventional PCR. Real-time PCR assays have been used for the detection of fungal plant pathogens in seeds (Guillemette et al, 2004;Lievens et al, 2006;Alaei et al, 2009;Debode et al, 2009) and this technique would be useful for seed health testing. Thus, the results showed that real time PCR assay is a highly specific and sensitive technique that can be used in routine quarantine inspections to screen the seeds and transplants for the diagnosis of A. solani. ...
A conventional and real-time PCR assays using SYBR Green for the detection and quantification of A. solanihave been developed and validated. A primer set (ALP and ITS4) designed from the ITS region of A. linicola/ A. solani complex, yielded a 536 bp product when DNA from 38 isolates of A. solani were amplified. No product was amplified from A. alternata, A. brassicae, A. brassicicola, A.helianthi, A. porri, A. sesami, A.carthami, A.ricini, Colletotrichum gloeosporioides, C. capsici, C. falcatum, Cercospora canescens, C. capsici, Phytophthora infestans, Sclerotium rolfsii, Fusarium equiseti, F. oxysporum, Rhizoctonia solani, Phoma exigua, Curvularia spp and Drechslera. In addition, ALP/ITS4 primers were successfully utilized in real-time PCR assays of A. solani. The efficiency of conventional and real-time PCR assays was compared. The conventional PCR was able to detect the pathogen on symptomatic artificially infected tomato plants 5 days after pathogen inoculation. The detection limit was 100 conidia and 10 pg of DNA in the case of conventional PCR. Real-time PCR exhibited a detection limit 10 times lower (10 conidia, 10fg of DNA). The application of real time PCR assay for rapid detection of A.solani in infected tomato plant material is discussed.
... V případě kvantifikace patogenů ve vzorcích z půdy, je do vzorků přidáno stejné množství jakékoli jiné DNA (např. DNA kvasinek) (Lievens et al., 2006). V této metodice byla použita DNA izolovaná z rostlin tabáku (Nicotiana tabacum). ...
... As an example of the combination of a direct method with metabolomics analysis, after a primary metabolomics approach, discriminant metabolites can be identified and mapped in metabolic pathways, and genes coding for key enzymes involved in their biosynthesis/catalysis can be selected [71,75,103]. A combined transcriptomics and metabolomics approach was used in rose plant (Rosa chinensis) after the infection with powdery mildew (Podosphaera pannosa) and after the treatment with exogenous salicylic acid in order to explore the resistance mechanisms of rose plant [134]. ...
Within the different omics sciences, metabolomics is the newest and one of the most eminent. Plants are metabolically complex organisms, and plant-pathogen interactions are even more biochemically complex as both change within it, and during their interaction, they produce new metabolites. The application of metabolomics to study plant-pathogen interactions is still in the beginning and presents many challenges, but its potential is enormous. Metabolomics may be applied to identify metabolites involved in host susceptibility or tolerance, determine metabolic biomarkers, and unveil virulence mechanisms. Finally, its integration with other omics sciences brings the potential to decipher these complex interactions pushing forward our knowledge in the pathology field.
Here, we present the state of the art on metabolomics applications for plant-pathogen interactions, focusing on technical advances and omics data analysis. Lastly, metabolomics impact on breeding for resistance programs is discussed.
... The counting of colony forming units (CFU) generated on selective media, as well as chemical, biological, and immunological assays, are traditional methods for monitoring fungi (Lievens et al., 2006). CFUs were measured in the current study to examine T. harzianum growth in various green manures for its mass production. ...
Several plant diseases can be controlled biologically using Trichoderma spp. However, the mass production and storage of Trichoderma spp. is highly expensive. Therefore, this research was carried out at Fruit Crop and Development Center, Horana, Sri Lanka to screen the effects of leaves of four different crops and another 13 underutilized wild plant species on their suitability in the mass production of Trichoderma harzianum L. Seventeen different media were prepared using green leaves (5g) of individual plant species comprised with glucose (5g/L) and distilled water (50ml). Treatments were arranged in Complete Randomized Design (CRD) with five replications. Spore counts of fungus were recorded using hemocytometer at 1 st , 2 nd , 3 rd and 4 th week after inoculation. Different treatments showed significant variations in spore counting of T. harzianum after 1 st , 2 nd , 3 rd and 4 th week of inoculation (p<0.05). Castor (9.8x10 7 CFU/ml), gadapana (9.64x10 7 CFU/ml) and erabadu (9.64x10 7 CFU/ml) had significantly higher spore count at the 1 st week while kappettiya (25.31x10 7 CFU/ml) and habarala (25.21x10 7 CFU/ml) had the highest values at 2 nd week. Significantly increased spore count of 61.5x10 7 CFU/ml and 61.2x10 7 CFU/ml were resulted from castor and kappettiya during 3 rd week after inoculation. However, a sharp increase in spore count was found at 4 th week, particularly in wal sooriya kantha (157.17x10 7 CFU/ml) while in contrary, the lemon, rambutan, bovitiya, jack and mango leaves showed poor performances in the mass production of T. harzianum. Based on these results, wal sooriya kantha can be successfully used as growing media for T. harzianum.
... Primers Sequence (5 -3 ) Reference bacteria Eub338-F CCTACGGGAGGCAGCAG [28] Eub518-R ATTACCGCGGCTGCTGG [29] fungi ITS1-F CTTGGTCATTTAGAGGAAGTAA [30] ITS2-R GCTGCGTTCTTCATCGATGC [31] F. oxysporum ITS1-F CTTGGTCATTTAGAGGAAGTAA [30] AFP308-R CGAATTAACGCGAGTCCCAAC [32] narG 1960m2-F TAYGTSGGGCAGGARAAACTG ...
Reductive soil disinfestation (RSD) and chemical soil fumigation (CSF) comprise the most popular pre-planting soil management strategies. Their efficiency in suppressing several plant diseases in agricultural production systems has been compared. However, the disease-control effect of these methods on Fusarium wilt disease in Dioscorea batatas Decne (D. batatas) remains unclear. Importantly, dissimilarities in the impact of their bio-predictors on plant health have not been well characterized. Herein, four treatments, including no treatment (CK), RSD with gran chaff (GC-RSD) and molasses (MO-RSD), and CSF with dazomet (DA-CSF), were performed in a pot experiment using D. batatas-diseased soil. Compared with the CK treatment, the Fusarium oxysporum population significantly decreased by 88.89–97.78% following the DA-CSF, GC-RSD, and MO-RSD treatments. The bacterial community and functional composition of the soil were considerably altered by these treatments. However, the incidence of Fusarium wilt disease in D. batatas was significantly decreased in the two RSD-treated soils, rather than in DA-CSF-treated soils. Bacterial α-diversity and population as well as some key nitrogen-related functional gene expressions as bio-predictors were significantly lower in DA-CSF-treated soil than in RSD-treated soil. In particular, the core (e.g., Azotobacter, Phenylobacterium, Clostridium, Bradyrhizobium, Microvirga, and Caulobacter) and unique (e.g., Pseudomonas, Brevundimonas, Flavobacterium, Ochrobactrum, and Sphingobacterium) functional microbiomes in RSD-treated soil exerted a positive impact on soil functional composition of the soil and plant growth. Taken together, our results indicate that RSD outperformed CSF in promoting plant health by regulating the bacterial community and functional composition.
... The counting of colony forming units (CFU) generated on selective media, as well as chemical, biological, and immunological assays, are traditional methods for monitoring fungi (Lievens et al., 2006). CFUs were measured in the current study to examine T. harzianum growth in various green manures for its mass production. ...
Several plant diseases can be controlled biologically using Trichoderma spp. However, the mass production and storage of Trichoderma spp. is highly expensive. Therefore, this research was carried out at Fruit Crop and Development Center, Horana, Sri Lanka to screen the effects of leaves of four different crops and another 13 underutilized wild plant species on their suitability in the mass production of Trichoderma harzianum L. Seventeen different media were prepared using green leaves (5g) of individual plant species comprised with glucose (5g/L) and distilled water (50ml). Treatments were arranged in Complete Randomized Design (CRD) with five replications. Spore counts of fungus were recorded using hemocytometer at 1st, 2nd, 3rd and 4th week after inoculation. Different treatments showed significant variations in spore counting of T. harzianum after 1st, 2nd, 3rd and 4th week of inoculation (p<0.05). Castor (9.8x107 CFU/ml), gadapana (9.64x107 CFU/ml) and erabadu (9.64x107 CFU/ml) had significantly higher spore count at the 1st week while kappettiya (25.31x107 CFU/ml) and habarala (25.21x107 CFU/ml) had the highest values at 2nd week. Significantly increased spore count of 61.5x107 CFU/ml and 61.2x107 CFU/ml were resulted from castor and kappettiya during 3rd week after inoculation. However, a sharp increase in spore count was found at 4th week, particularly in wal sooriya kantha (157.17x107 CFU/ml) while in contrary, the lemon, rambutan, bovitiya, jack and mango leaves showed poor performances in the mass production of T. harzianum. Based on these results, wal sooriya kantha can be successfully used as growing media for T. harzianum. SAARC J. Agric., 21(1): 79-87 (2023)
... To quantify the population density of F. solani in the rhizosphere (Fig. S8), a quantitative PCR (qPCR) assay was performed using the SYBR green real-time PCR master mix (Toyobo, Osaka, Japan) and CFX Connect (Bio-Rad, CA, USA). The primer set used was ITS1F (59-CTTGGTCATTTAGAGGAAGTAA-39) as the forward primer and AFP346 (59-GGTATGTTCACAGGGTTGATG-39) as the reverse primer, as described previously by Lievens et al. (27). Standard DNA was extracted from an F. solani sand stock at a concentration of 10 7 CFU/mL. ...
Ginseng is a popular medicinal herb with established therapeutic effects such as cardiovascular disease prevention, anticancer effects, and anti-inflammatory effects. However, the slow growth of ginseng due to soilborne pathogens has been a challenge for establishing new plantations. In this study, we investigated root rot disease associated with the microbiota in a ginseng monoculture model system. Our results showed that a collapse of the early microbiota community inhibiting root rot disease was observed before the disease became severe, and nitrogen fixation was necessary to support the initial microbiota community structure. Furthermore, changes in the nitrogen composition were essential for the suppression of pathogen activity in early monoculture soils. We hypothesize that Pseudomonadaceae, a population built up by aspartic acid, can inhibit the occurrence of root rot disease in ginseng and that specific management practices that maintain a healthy microbiome can be implemented to prevent and mitigate the disease. Our findings provide insights into the potential use of specific members of the microbiota for controlling root rot disease in ginseng cultivation.
IMPORTANCE Understanding the initial soil microbiota and community shifts in a monoculture system is critical for developing disease-suppressive soils for crop production. The lack of resistance genes against soilborne pathogens in plants highlights the need for effective management strategies. Our investigation of root rot disease and initial microbiota community shifts in a ginseng monoculture model system provides valuable insight into the development of conducive soil into specific suppressive soil. With a thorough understanding of the microbiota in disease-conducive soil, we can work toward the development of disease-suppressive soil to prevent outbreaks and ensure sustainable crop production.
Food security is an emerging problem that is faced by our civilization. There are millions of people around the world suffering from various kinds of malnutrition. The number of people that starve will only increase considering the continuous growth of the world’s population. The problem of food security can be addressed by timely detection and identification biotic and abiotic stresses in plants that drastically reduce the crop yield. A growing body of evidence suggests that Raman spectroscopy (RS), an emerging analytical technique, can be used for the confirmatory and non-invasive diagnostics of plant stresses. However, it remains unclear whether RS can efficiently disentangle biotic and abiotic stresses, as well as detect both of them simultaneously in plants. In this work, we modeled a stalk rot disease in corn by inoculating the plant stalks with Colletotrichum graminicola. In parallel, we subjected plants to salt stress, as well as challenging plants with both stalk rot disease and salinity stress simultaneously. After the stresses were introduced, Raman spectra were collected from the stalks to reveal stress-specific changes in the plant biochemistry. We found that RS was able to differentiate between stalk rot disease and salinity stresses with 100% accuracy, as well as predict presence of both of those stresses in plants on early and late stages. These results demonstrate that RS is a robust and reliable approach that can be used for confirmatory, non-destructive and label-free diagnostics of biotic and abiotic stresses in plants.
Alternaria brassicae is an important seedborne pathogenic fungus responsible for the black spot disease of crucifers. Sanitary control of commercial seed is necessary to limit the spread of this pathogen. Current detection methods, based on culture and morphological identification of I the fungus, are time consuming, laborious, and not always reliable. Therefore. a polymerase chain reaction (PCR)-based assay was developed with A. brassicae-specific primers designed on the basis of the sequence of two clustered genes potentially involved in pathogenicity. Two sets of primers were selected for conventional and real-time PCR, respectively. In both cases, A. brassicae was specifically detected using DNA extracted from seed. The real-time PCR-based method presented here can be automated easily and preliminary results indicate that it is efficient for quantitative estimation of seed infection.
Two primer pairs specific for Rosellinia necatrix, designed from the internal transcribed space (ITS) regions, were utilised to develop a molecular detection method suitable for large-scale analyses of soils and plant materials. One primer (R15) was modified to obtain a Scorpion primer for detecting a specific 71 bp amplicon by fluorescence emitted from a fluorophore through a self-probing PCR assay. Primer R15 Scorpion in combination with a reverse conventional primer (R18) produced a more intense fluorescent signal compared to a previously reported pair of Scorpion primers. Primer specificity was assessed both by means of BLAST (Basic Local Alignment Search Tool) analyses to exclude the presence of similar sequences in other microrganisms among available DNA databases (Gen-Bank) and by using genomic DNA from a large number of R. necatrix isolates and other fungi from several hosts and different geographic areas. Simple, rapid, and effective procedures for direct DNA extraction from soil and plant materials were developed to yield DNA of purity and quality suitable for PCR assays. Combining these protocols and a single amplification with primer R15 Scorpion-R18 it was possible to detect the pathogen in naturally and artificially infected host tissues. To detect the pathogen from infested soils, and to improve the sensitivity on host tissue, a nested Scorpion-PCR with conventional (R3-R8) and Scorpion (R15 Scorpion-R18) primers was utilised. The reliability of the entire procedure was assessed using both artificially and naturally infested soils and plant materials from 26 different woody species. Compared to traditional detection methods based on baiting and fungal isolation on agar media, the molecular approach proved to be more rapid, sensitive, reliable, and enabled large scale analyses.
The use of the polymerase chain reaction (PCR) in molecular diagnostics has increased to the point where it is now accepted
as the gold standard for detecting nucleic acids from a number of origins and it has become an essential tool in the research
laboratory. Real-time PCR has engendered wider acceptance of the PCR due to its improved rapidity, sensitivity, reproducibility
and the reduced risk of carry-over contamination. There are currently five main chemistries used for the detection of PCR
product during real-time PCR. These are the DNA binding fluorophores, the 5′ endonuclease, adjacent linear and hairpin oligoprobes
and the self-fluorescing amplicons, which are described in detail. We also discuss factors that have restricted the development
of multiplex real-time PCR as well as the role of real-time PCR in quantitating nucleic acids. Both amplification hardware
and the fluorogenic detection chemistries have evolved rapidly as the understanding of real-time PCR has developed and this
review aims to update the scientist on the current state of the art. We describe the background, advantages and limitations
of real-time PCR and we review the literature as it applies to virus detection in the routine and research laboratory in order
to focus on one of the many areas in which the application of real-time PCR has provided significant methodological benefits
and improved patient outcomes. However, the technology discussed has been applied to other areas of microbiology as well as
studies of gene expression and genetic disease.
