Content uploaded by Balasubramanian Senthilkumaran
Author content
All content in this area was uploaded by Balasubramanian Senthilkumaran on Mar 25, 2015
Content may be subject to copyright.
AUTHOR COPY ONLY
Identification of multiple dmrt1s in catfish: localization,
dimorphic expression pattern, changes during testicular
cycle and after methyltestosterone treatment
K Raghuveer and B Senthilkumaran
Department of Animal Sciences, School of Life Sciences, University of Hyderabad, PO Central University, Gachibowli, Hyderabad 500 046, Andhra Pradesh, India
(Correspondence should be addressed to B Senthilkumaran; Email: bsksl@uohyd.ernet.in)
Abstract
The double sex and mab-3 related (DM) transcription factor 1 (dmrt1) plays an important role in testicular differentiation.
Here, we report cloning of multiple dmrt1s, a full-length and two alternative spliced forms from adult catfish (Clarias
gariepinus) testis, which encode predicted proteins of 287 (dmrt1a), 253 (dmrt1b) and 233 (dmrt1c) amino acid residues
respectively. Interestingly, dmrt1c lacks the majority of the DM domain. Multiple dmrt1s(dmrt1a and dmrt1c) were
obtained from Clarias batrachus as well. Tissue distribution (transcript and protein) of catfish dmrt1 revealed exclusive
expression in testis. Semi-quantitative RT-PCR revealed the presence of multiple dmrt1s with high levels of dmrt1ain
adult testis but not in ovary. Real-time RT-PCR analysis during testicular cycle showed higher levels of dmrt1 transcripts
in preparatory and pre-spawning when compared with spawning and post-spawning phases. Immunocytochemical and
immunofluorescence localization revealed the presence of catfish Dmrt1 protein in spermatogonia and spermatocytes,
which indicates plausible role in spermatogenesis. Histological analysis indicated initiation of gonadal sex differentiation
in catfish around 40–50 days after hatching. The potential role for dmrt1 in testicular differentiation is evident from its
stage-dependent elevated expression in developing testis. Furthermore, dimorphic expressions of dmrt1s were evident
at different stages of gonadal development or recrudescence in catfish. Treatment of methyl testosterone (MT) during
early stages of gonadal sex differentiation resulted in adult males. Interestingly, we also obtained MT-treated fishes
having ova-testis gonads. Analysis of dmrt1,sox9a,foxl2 and cyp19a1 expression patterns in MT-treated gonads
revealed tissue-specific pattern. These results together suggest that multiple dmrt1s are testis-specific markers in catfish.
Journal of Molecular Endocrinology (2009) 42, 437–448
Introduction
Several transcription factors like sry,dmy,sox9,
ad4BP/SF-1,dmrt1,dax1 and wt1 have been identified
to play an important role in sex determination and
differentiation of vertebrates including teleosts (Swain
& Lovell-Badge 1999,Hughes 2001,Matsuda et al. 2002,
Wang et al. 2002,Kobayashi et al. 2004). Molecular
similarity in sexual development across different phyla
found so far is among Drosophila doublesex,Caenorhabditis
mab-3 and vertebrate dmrt1 (Raymond et al. 1998). Dsx
and mab-3 related transcription factor 1 (dmrt1) belongs
to gene family of putative transcription factors that
share a highly conserved novel zinc finger DNA binding
domain (DM domain) across different phyla (Raymond
et al. 1998). Dmrt1 has been cloned from several
vertebrate species including mammals, birds, reptiles,
amphibians and fishes (Nanda et al. 1999,De Grandi
et al. 2000,Guan et al. 2000,Kettlewell et al. 2000,
Nagahama 2005,Osawa et al. 2005) and has been
implicated in testicular differentiation. Furthermore,
dmrt1 has been localized in 9p23.4 and monosomy
at this region in XY individuals and manifests
feminization and gonadal dysgenesis (Ottolenghi &
McElreavey 2000). In mice, Dmrt1 expresses in both
male and female embryonic genital ridges, but as the
differentiation proceeds, it is gradually lost from the
ovary and expressed only in the Sertoli and germ cells
of testis. High expression of Dmrt1 was observed in testis
at 13.5 days post coitum and its expression is
maintained throughout the adult after birth (Raymond
et al. 1999,De Grandi et al. 2000). Localization of Dmrt1
in the Z-chromosome of birds designated it as a male
master testis-determining gene (Nanda et al. 1999).
Dmrt1 knockout mice showed its dispensability in
females yet it is required in males for postnatal
testicular development by effecting the differentiation
of both Sertoli and germ cells (Raymond et al. 2000).
These expression patterns indicate that dmrt1 is likely to
have a conserved role in the early stages of testis
development. Studies from lower vertebrates are mostly
done in teleosts to specify the conserved role of dmrt1.
DMY, a Y-linked male sex-determination gene, similar to
sry discovered in medaka has been shown to be a
duplicate of autosomal gene dmrt1 (Matsuda et al. 2002,
Zhang 2004). Nevertheless, most of these reports are
437
Journal of Molecular Endocrinology (2009) 42, 437–448 DOI: 10.1677/JME-09-0011
0952–5041/09/042–437 q2009 Society for Endocrinology Printed in Great Britain Online version via http://www.endocrinology-journals.org
AUTHOR COPY ONLY
from daily or fortnight breeders like zebrafish, medaka
and tilapia (Guan et al. 2000,Kobayashi et al. 2004,Guo
et al. 2005). Research reports on this line using annual
breeders with a focus on seasonal reproductive cycle are
limited (Marchand et al. 2000,Huang et al. 2005). In this
regard, fish that undergo seasonal pattern of gonadal
attenuation and recrudescence rather than continu-
ously mature individuals may provide interesting high-
lights to understand the role of dmrt1 not only during
development but also during recrudescence. The fate
of dmrt1 transcripts after testicular differentiation is not
clear at present. Such an attempt may provide more
insights to understand its role in adult, if any. Although
tracking of dmrt1 may not provide a direct role to this
issue but may contribute to understanding whether
timing of dmrt1 expression coincides with the begin-
ning of testicular recrudescence vis-a`-vis spermatogen-
esis. Catfish, Clarias gariepinus is an annual breeder,
which takes 1 year to attain maturity. It is domesticated
in south India and interestingly it exhibits seasonal
pattern of reproductive cycle. Previously, we reported
cloning of partial cDNA fragments of dmrt1 from catfish
testis that indicated the presence of more than one
form of dmrt1 (Raghuveer et al. 2005). In the present
study, we aimed to clone full-length dmrt1 cDNA
from catfish testis and also explored the possibility of
multiple forms. In addition, we also aimed to study the
spatio-temporal expression pattern of dmrt1(s) during
early stages of gonadal development in juveniles as
well as at different phases of testicular recrudescence in
adult catfish. We also intend to confirm the presence of
dmrt1(s) from a closely related catfish species Clarias
batrachus to augment our findings. Furthermore, our
study was extended to localize dmrt1 in juvenile and
adult testis. Administration of methytestosterone (MT)
or ethynylestradiol (EE2) is a useful strategy to skew the
sex of the population in question to study testicular and
ovarian differentiation (Nagahama 2005). We used MT
treatment strategy to explicitly define the role of dmrt1
and endorse its importance as a candidate marker for
testicular development.
Materials and methods
Animals and sampling
Catfish (C.gariepinus) at different age groups were
reared in fresh water tanks under ambient photo-
thermal conditions. Mature spermiating male and
gravid female fishes were used for IVF to obtain catfish
fries at different age groups. The newly hatched catfish
fries were fed with live tube worms until 3 months.
Juvenile fishes of 3–8 months old were fed with live
tube worms and commercially available fish feed.
Adult catfish (1-year old) were reared in the outdoor
tanks of the laboratory and fed with minced goat liver in
addition to fish feed. Commonly referred to as the
African or air-breathing catfish, this species is abun-
dantly available in the ponds and lakes of Hyderabad.
The seasonal reproductive cycle of catfish is divided
into four phases (Swapna et al. 2006): preparatory
(February-March), prespawning (April–June), spawn-
ing (July–October) and post-spawning/regressed
phases (November–January). Adult gonads during the
reproductive cycle of catfish were collected and a part of
it was fixed in Bouin’s fixative while remaining tissue
was stored at K80 8C for total RNA extraction. Juvenile
catfish fries at different age groups (50, 100 and
150 days after hatching (dah)) were dissected and
gonads were removed using fine forceps under
stereozoom microscope (Leica, Wetzlar, Germany).
Number of gonads of similar age group and same sex
were pooled and stored at K80 8C for total RNA
extraction. Treatments of MT were given to catfish
fingerlings during the critical period of gonadal
differentiation as explained earlier (Raghuveer et al.
2005). In brief, about 250 catfish fries were treated with
MT in pulse (3 h) at a dose of 500 ug/l intermittently
(six durations) till 21 dah. We used high doses of MT as
low doses were found to be ineffective in our pilot
studies. The MT-treated fishes were reared until they
reach maturity and after (1 to 2 years). Then their
gonads were dissected out for histology and total RNA
extraction. Adult C.batrachus were obtained from local
fish markets of Hyderabad as well as from north India.
These were maintained and fed with minced goat liver
ad libitum during acclimation in the laboratory for a
fortnight before killing.
Cloning of full-length and alternatively spliced forms
of dmrt1
Primers for rapid amplification of cDNA ends (RACE)
were designed based on the sequence information of
partial cDNA fragment of catfish dmrt1 that was cloned
earlier. SMART 50and 30cDNA templates were made
from testis total RNA according to manufacturer’s
protocol using the SMART RACE cDNA amplification
kit (Clontech, Tokyo, Japan). 50RACE was performed
using the DM domain primer, DMr1: 50-GCTATCTC-
CACTGGGCATCTGCTGGT-3 0and universal primer A
mix (UPM): 50-CTAATACGACTCACTATAGGGCAAG-
CAGTGGTATCAACGCAGAGT-30. Touchdown PCR
cycling conditions were as follows: each at 94 8C (30 s)
and 72 8C (2 min) for 5 cycles, 94 8C (30 s) and 70 8C
(2 min) for 5 cycles, 94 8C (30 s), 68 8C (30 s) and 72 8C
(2 min) for 27 cycles, in a 20 ml reaction mix containing
1!PCR buffer, 100 mMdNTP mix, 1U PCR advantage
Taq DNA polymerase (Clontech), 0.1mM each primer,
and 1 ml of the cDNA. After the primary PCR, nested
PCR was performed using 50nested primer DMr2:
R KAVARTHAPU and B SENTHILKUMARAN .Dimorphic expression of multiple dmrt1s in catfish
438
Journal of Molecular Endocrinology (2009) 42, 437–448 www.endocrinology-journals.org
AUTHOR COPY ONLY
50-AATCATTTCCTGGCTCATCCTTCACC-30and nested
universal primer (NUP): 50-AAGCAGTGGTATCAACG-
CAGAGT-30. The nested PCR conditions were as follows:
94 8C (30 s), 65 8C (30 s) and 72 8C (2 min) for 35 cycles.
30RACE was performed using the DM domain primer
DMf1: 50-ATGCCGAAGTGCTCCC GGTGCAGG-30, and
UPM using the same PCR conditions mentioned above.
After 30RACE, nested PCR was performed using
30nested primer DMf2: 50-GTCCCGCCAGTTACA-
GAAGCGCTTG-30and NUP using the same PCR con-
ditions described above. All PCR amplifications were
done using thermal cycler (Applied Biosystems, Foster
City, CA, USA). All the amplified cDNA fragments were
gel-purified (Qiagen, Hamburg, Germany), cloned in
TOPO cloning vector (Invitrogen, Carlsbad, CA, USA)
and nucleotide sequenced. We aimed to amplify the
open reading frame (ORF) of dmrt1 using primers
dmrt1orfF and dmrt1orfR (Table 1) designed at ORF
flanking region of dmrt1 cDNA obtained by RACE. The
PCR conditions used for ORF amplification were as
follows: 94 8C (30 s), 60 8C (30 s) and 72 8C (1 min) for
35 cycles. The PCR amplified products were gel-purified,
cloned in TOPO cloning vector (Invitrogen) and
nucleotide sequenced.
Tissue distribution pattern of dmrt1 by reverse
transcription (RT)-PCR
RT-PCR was carried out to study expression pattern of
dmrt1 in different tissues of adult catfish. For this, total
RNA was extracted from different tissues (brain, spleen,
gill, heart, intestine, kidney, liver, testis and ovary) of
adult catfish using the Sigma TRI-reagent (Sigma)
method. Reverse transcription was carried out using
superscript-III reverse transcriptase (Invitrogen) with
oligo d(T)
18
primers and 5 mg of total RNA at 50 8C.
PCR amplification was done using thermal cycler
(Applied Biosystems) under the following conditions:
94 8C (1 min), 58 8C (30 s), 72 8C (1 min), for 35 cycles
using specific dmrt1aF and dmrt1aR primers (Table 1).
b-actin was used as an internal endogenous control to
test the quality of cDNA templates.
Expression pattern of multiple dmrt1s in developing
and adult gonads by semi-quantitative RT-PCR
Semi-quantitative RT-PCR as described by Kwon et al.
(2001) was carried out to study the expression patterns
of multiple dmrt1s in adult and developing gonads.
Total RNA was prepared from adult and developing
gonads collected from juvenile catfish at 50, 100 and
150 dah using the Sigma TRI-reagent method. Reverse
transcription was carried out using superscript-III
reverse transcriptase (Invitrogen) with oligo d(T)
18
primers and 5 mgoftotalRNAat508C. PCR
amplification was done using thermal cycler (Applied
Biosystems) under the following conditions: 94 8C
(1 min), 60 8C (30 s), 72 8C (1 min), for 30 cycles
using specific primers dmrt1aF,dmrt1aR,dmrt1bF,
dmrt1bR,dmrt1cF and dmrt1cR designed for amplifi-
cation of respective dmrt1 forms (Table 1). Catfish
b-actin was PCR amplified at 94 8C (1 min), 60 8C (30 s),
72 8C (1 min) for 28 cycles using specific b-actinF and
b-actinR primers (Table 1) as an internal control.
Real-time quantitative RT-PCR (qRT-PCR) for dmrt1s
Pilot experiments for multiple dmrt1sexpression
during testicular cycle was done by semi-quantitative
RT-PCR using ORF-specific primers. Later, expression
of multiple dmrt1s was analyzed by relative qRT-PCR
using SYBRGreen detection method. Total RNA was
extracted from the testis samples of four different
phases (preparatory, pre-spawning, spawning and post-
spawning phases) using the Sigma TRI-reagent method,
and RT was carried out using random hexamers in the
presence of superscript-III reverse transcriptase
(Invitrogen) according to manufacturer’s protocol.
Successful RT was confirmed for all samples by
performing PCR amplification of internal control
b-actin.Dmrt1 and b-actin specific primers were
designed such that one primer spanned the junction
of two exons, giving a single cDNA PCR product and
precluding amplification of genomic DNA. Similarly,
catfish specific b-actinF and b-actinR primers (Table 1)
were designed for use as normalization controls. One
set of specific primers dmrt1abRTF and dmrt1abRTR
(Table 1) were used to amplify the DM domain region,
which will give both dmrt1a and b transcripts of same
Table 1 List of primers used for PCR amplification
Nucleotide sequence (50–30)
Primers
Dmrt1orfF GAAGCACGAGGCCGCGCAGAG
Dmrt1orfR GTTGGTATACTCTCTGAGACTT
b-actinF ACCGGAGTCCATCACAATACCAGT
b-actinR GAGCTGCGTGTTGCCCCTGAG
Dmrt1abRTF ATGGCCGCTCAGGTGGCTCTGCGG
Dmrt1abRTR GCGGCTCCCAGAGGCAGCAGGAGA
Dmrt1cRTF CCAGGGCCAGGTGGCTCTGCG
Dmrt1cRTR GCGGCTCCCAGAGGCAGCAGGAGA
Dmrt1aF ATGCCGAAGTGCTCCCGGTGC
Dmrt1aR AGCGGCTCCCAGAGGCAGC
Dmrt1bF AAGGATGAGCACCAGGGGACA
Dmrt1bR TTACTTAGCAGCTCCCTCTAT
Dmrt1cF CCAGGGCCAGGTGGCTCTGCG
Dmrt1cR TTACTTAGCAGCTCCCTCTAT
Sox9aF GCAGAGCTCAGCAAAACCCGG
Sox9aR GCTGGAAGCGGGAGAGTCGG
Foxl2F TGCGAGGACATGTTTGAGAAGGG
Foxl2R TCCCAGTATGAGCAGTGCATCAT
Cyp19a1F TTGGATCGGGAATTGGGACAGC
Cyp19a1R AGCTTTAGCGAAGTAGCTGCG
Dimorphic expression of multiple dmrt1s in catfish .R KAVARTHAPU and B SENTHILKUMARAN 439
www.endocrinology-journals.org Journal of Molecular Endocrinology (2009) 42, 437–448
AUTHOR COPY ONLY
size except dmrt1c form. Another set of specific primers
dmrt1cRTF and dmrt1cRTR (Table 1) were used to
amplify exclusively dmrt1c (DM-less form) only. Specific
cDNA amplification was then carried out in triplicate
using power SYBRGreen PCR Mastermix (Applied
Biosystems) in a 7500 Fast Real-time PCR machine
(Applied Biosystems) at 60 8C annealing temperature
for 40 cycles according to the manufacturer’s protocol.
Melting-curve analysis was performed for each sample
to check single amplification. During PCR, fluor-
escence accumulation resulting from DNA amplification
was recorded using the sequence detector software
(Applied Biosystems). Cycle threshold (CT) values were
obtained from the exponential phase of PCR amplifi-
cation, and dmrt1 expression was normalizedagainst
b-actin expression, generating a DCT value (DCTZ
dmrt1 CTKb-actin CT). Relative expression was then
expressed according to the Default 2
KDCT
.
Production of polyclonal antibody against Dmrt1
protein
Polyclonal anti-catfish Dmrt1 antibody was raised in
rabbit using catfish partial Dmrt1 recombinant protein
of the conserved DM-domain as antigen. The partial
Dmrt1 protein was expressed in Escherichia coli DE3 LacI
host using 0.5 M IPTG by cloning the partial dmrt1
cDNA fragment of 340 bp into bacterial pET BLUE2
vector system (Novagen, Madison, WI, USA). The
expressed fusion protein with the histidine tag (His-
tag) was then purified using Ni-NTA Agarose column
(Qiagen) according to the manufacturer’s protocol.
This purified recombinant protein was used to raise
polyclonal antibody in rabbit after confirming by
immunoblot using the monoclonal His-tag antibody.
For raising polyclonal antibody against the purified
protein, rabbit was first injected with Freund’s complete
adjuvant (Bangalore Genei Pvt Ltd, Bangalura, India) at
the vola. Later after 1 week, 500 mg of the purified
protein emulsified in Freund’s complete adjuvant was
injected into the swollen lymphoid node. Then two
booster injections were given with the same antigen
amount but using Freund’s incomplete adjuvant
(Bangalore Genei Pvt Ltd) for each week. After the last
booster dose the rabbit was bled 2 weeks later and the
serum sample was stored at K80 8C until use. Rabbit pre-
immune serum was obtained by collecting 2 ml blood
before antigen injection. All the rabbits in the present
study were used following the guidelines of Institutional
Animal Ethics Committee and Committee for the
Purpose of Control and Supervision of Experiments
on Animals and also after obtaining prior permission.
Western blot analysis was carried out to verify the
specificity of the polyclonal Dmrt1 antibody raised in
the rabbit. For this, different tissues (testis, ovary, gut,
spleen, liver, muscle, heart, brain) of catfish were
homogenized in 250 ml homogenization buffer
containing 50 mM Tris–HCl (pH 7.4), 150 mM NaCl,
1 mM DTT, 0.1% TritonX-100 and 0.1 mM phenyl-
methylsulphonyl fluoride using a Sigma hand
homogenizer. Of each sample 50 mg with a pre-stained
marker was electrophoresed through a 15% SDS-
polyacrylamide gel and transferred onto nitrocellulose
membrane (Pall-Life Sciences, NY, USA). Membrane
was blocked in 5% skimmed milkpowder in Tris-
buffered saline with 0.1% Tween 20 (TBST) for 1 h at
room temperature. After blocking, membrane was
washed three times for 15 min each in TBST solution
and incubated with purified anti-catfish Dmrt1
antibody at 4 8C overnight in 0.5% skimmed milk
powder/TBST solution. Blot was washed and incubated
with secondary antibody alkaline phosphatase conju-
gated goat anti-rabbit IgG (Bangalore Genei Pvt Ltd)
for 1 h. After washing, blot was developed using BCIP-
NBT (Bangalore Genei Pvt Ltd).
Immunocytochemical and immunofluorescence
localization of dmrt1
Testis sections from adult male catfish were deparafin-
nised in xylene, rehydrated in successively lower graded
concentrations of ethanol and then treated with 0.1%
H
2
O
2
for 10 mins to prevent endogenous peroxidase
reaction. The sections were washed in 0.1 M PBS with
0.1% Tween 20 (PBST) and then blocked with 10%
normal goat serum in 0.1 M PBS for 10 min at room
temperature. Sections were then incubated overnight at
48C in 1:1000 dilution of anti-catfish dmrt1 antiserum
or antiserum pre-absorbed with excess of peptide used
for immunization. Later sections were washed thrice
with PBST and incubated with biotin conjugated
secondary antibody at room temperature for 1 h. The
sections were incubated with 1:500 dilution of strepta-
vidin labelled HRP conjugate for 15 min at room
temperature. The sections were washed with PBS
and colour was developed using commercially supplied
3030-diaminobenzidine as chromogen and H
2
O
2
as
substrate for HRP. The sections were washed, dehy-
drated in graded ethanol, cleared in xylene and
mounted using distrene-plasticizer-xylene mountant.
Photomicrographs were taken using Olympus light
microscope (Olympus, Japan). For immunofluores-
cence studies, testis sections were processed in the
same way as mentioned above up to primary antibody
incubation step except for 0.1% H
2
O
2
treatment. The
sections were then in PBST and incubated with FITC
fluorescent-labelled secondary antibody at room
temperature for 1 h. After that the sections were washed
and mounted using 90% glycerol. Photomicrographs
were taken immediately using Olympus fluorescence
microscope (Olympus). Hematoxylin and propidium
iodide (PI) was used as a counter stain for better clarity.
R KAVARTHAPU and B SENTHILKUMARAN .Dimorphic expression of multiple dmrt1s in catfish
440
Journal of Molecular Endocrinology (2009) 42, 437–448 www.endocrinology-journals.org
AUTHOR COPY ONLY
All reagents and secondary antibodies to perform
immunocytochemistry were obtained from Bangalore
Genei Pvt Ltd.
Expression patterns of dmrt1,sox9a,foxl2 and
cyp19a1 in gonads of adult MT-treated fishes
Total RNA was extracted from gonadal tissues of adult
MT-treated catfish using the Sigma TRI-reagent
method. Reverse transcription was carried out using
superscript-III reverse transcriptase (Invitrogen) with
oligo d(T)
18
primers and 5 mg of total RNA at 50 8C.
PCR amplification was done using thermal cycler
(Applied Biosystems) under the following conditions:
94 8C (1 min), 55 8C (30 s), 72 8C (1 min), for 35 cycles
using specific primers (Table 1) designed for dmrt1a,
sox9a,foxl2 (Sridevi & Senthilkumaran, unpublished
observations) and cyp19a1 (Rasheeda et al. 2005) genes
of C.gariepinus.b-actin was used as an internal control to
test the quality of cDNA templates.
Histology
The trunk region of catfish fries at different stages (30,
50, 75, 100, 150 dah) and gonads of adult MT-treated
fishes were fixed in Bouin’s solution, dehydrated and
embedded in paraplast (Sigma). For light microscopy,
4 mm thick sections were cut and stained with
hematxylin-eosin. All the photomicrographs for
histological analysis were taken using Olympus light
microscope.
Results
cDNA cloning of multiple alternative transcripts of
catfish dmrt1
To isola te cDNA o f dmrt1 from catfish testis we
performed 50and 30RACE using the partial dmrt11
cDNA sequence data that was previously obtained from
C.gariepinus (Raghuveer et al. 2005). After aligning the 50
and 30end regions of dmrt1 sequence that overlap in
the DM-domain region, we obtained 1.1 kb full-length
cDNA sequence of dmrt1 (hereafter referred as dmrt1a)
which encodes a putative protein of 287 amino acids
(Fig. 1A). The amino acid sequence comparison of
catfish dmrt1a with other vertebrate dmrt1 proteins
revealed considerable homology with other teleosts like
zebrafish (61%), rainbow trout (59%), the eel (57%)
and the Nile tilapia (54%). The phylogenetic analysis of
Figure 1 (A) Nucleotide sequence of catfish full-length dmrt1a cDNA and its deduced
amino acid sequence. Nucleotides are numbered to the left. The DM domain is shaded,
putative SY domain is underlined, *indicates stop codon. (B) Phylogenetic tree showing the
evolutionary status of catfish dmrt1. Bootstrap analysis with 100 replicates was used to
assess the strength of nodes in the tree. Phylogenetic analysis was done using CLC bio:
CLC Main workbench software (accession numbers: Human NM_015826; Mice
NM_021951.2; Rat NM_053706; Pig NM_214111; Zebrafish AY157562; Medaka
AF319994; Rainbow trout NM_001124269; Eel AF421347; Fugu NM_001037949; Tilapia
AF209095; Pufferfish AY135175; Catfish (dmrt1a) FJ596554). (C) Representative gel
image showing multiple alternative spliced forms of catfish dmrt1 amplified from adult testis
by RT-PCR using ORF flanking primers.
Dimorphic expression of multiple dmrt1s in catfish .R KAVARTHAPU and B SENTHILKUMARAN 441
www.endocrinology-journals.org Journal of Molecular Endocrinology (2009) 42, 437–448
AUTHOR COPY ONLY
vertebrate Dmrt1 proteins (Fig. 1B) showed the
existence of two main clades. The first clade represents
mammalian Dmrt1 sequences while the second one is
for teleost Dmrt1 sequences. Interestingly, we obtained
multiple dmrt1 transcripts (Fig. 1C) when we attempted
to amplify the ORF region of dmrt1 using specific
primers designed at ORF flanking region of full-length
dmrt1a cDNA. Sequence information of these multiple
bands revealed that these products represented dmrt1
transcripts generated by multiple alternative splicing.
Two alternative spliced forms dmrt1b and dmrt1c were
obtained in catfish along with dmrt1a, which encodes
different size predicted proteins with 253, 233 and
287 amino acids respectively (Fig. 2). The nucleotide
sequence data of multiple dmrt1s have been submitted to
the GenBank and the accession numbers are dmrt1a
(FJ596554), dmrt1b (FJ596555) and dmrt1c (FJ596556).
The entire alternative splicing events of the dmrt1 in
catfish occurred within the ORF towards the 50end
region. Interestingly, the dmrt1c isoform is lacking
most of the DM-domain region at 50end. Cloning of
dmrt1a and dmrt1c ORFs from a closely related species,
C. batrachus confirmed our findings in C.gariepinus. The
GenBank accession numbers of C.batrachus dmrt1s are
FJ596557 and FJ596558.
Tissue distribution and expression pattern of dmrt1 in
adult and developing gonads
Tissue distribution pattern of dmrt1 revealed exclusive
expression in testis (Fig. 3A). Semi-quantitative RT-PCR
analysis showed that dmrt1 spliced forms a, b and c were
detectable only in adult testis (Fig. 3B). Further the
expression of dmrt1a was higher than those of dmrt1b
and dmrt1c. Stage-dependent increase in dmrt1a
expression was observed in testis at different age groups
of catfish (50, 100 and 150 dah). Expression of dmrt1b
and dmrt1c were also evident in developing male
gonads. By contrast, dmrt1a could not be detected in
developing female gonads (Fig. 3C).
Dmrt1 expression in different phases of testicular
cycle
Real-time qRT-PCR analysis showed that dmrt1a and
dmrt1b expression was high during pre-spawning when
compared with preparatory, spawning and post-spawn-
ing phases. A similar kind of expression pattern was true
for dmrt1c which lacks the majority of the DM-domain
(Fig. 4). This indicates that dmrt1 transcripts are
abundantly expressed during active spermatogenesis
i.e. in preparatory and pre-spawning phases where
spermatogonia and spermatocytes are more in number
(Swapna et al. 2006). In addition, dmrt1a transcript is
abundantly expressed in testis when compared with
dmrt1banddmrt1c transcripts. Studies from semi-
quantitative RT-PCR pilot experiments revealed similar
patterns of expression for multiple dmrt1s (densito-
metric quantification data not shown). Representative
gel image was shown in the inlet of Fig. 4.
Immunocytochemical and immunoflouresence
detection of dmrt1 in testis
The polyclonal catfish dmrt1 antibody raised in rabbit
revealed an expected band of w31 kDa by western
blotting in testis but not in other tissues. This band
Figure 2 Amino acid sequence alignment of multiple dmrt1s from Clarias gariepinus and
C.batrachus using EBI clustalW software. GenBank accession numbers (C.gariepinus:
dmrt1a (FJ596554), dmrt1b (FJ596555), dmrt1c (FJ596556) and C.batrachus:dmrt1a
(FJ596557), dmrt1c (FJ596558)). DM-domain is underlined. Box indicates loss of
DM-domain due to alternative splicing in dmrt1c. Arrows showing splicing sites of the
dmrt1 intron–exon junctions.
R KAVARTHAPU and B SENTHILKUMARAN .Dimorphic expression of multiple dmrt1s in catfish
442
Journal of Molecular Endocrinology (2009) 42, 437–448 www.endocrinology-journals.org
AUTHOR COPY ONLY
corresponds to the dmrt1a form which encodes a 31 kDa
putative protein (Fig. 5). However, we could not detect
the other two variants of dmrt1 by western blot which may
be due to their low expression levels as mentioned in the
real-time PCR results. Absence of immunoreactivity using
pre-absorbed antiserum confirms that the primary
antibody of dmrt1 is specific for catfish (Fig. 6A). Our
immunocytochemical data revealed that dmrt1
expression was observed in the surrounding regions of
the testicular lumens filled with spermatozoa (Fig. 6B). At
higher magnification, dmrt1 immunoreactivity was
detected in primary spermatogonia (SG1), secondary
spermatogonia (SG2) and spermatocytes (SC), while
spermatids/sperm (SP) did not show any immunoreac-
tivity in both mature testis (Fig. 6C and D) and juvenile
testis at 200 dah (Fig. 6E). We also carried out
immunofluoresence studies, where dmrt1 specific immu-
nofluorescence signal (green) was detected in spermato-
genic cells surrounding the lumens of adult testis except
SP (Fig. 6F and G). But no dmrt1 signal was detected in the
pre-vitellogenic oocytes (PO) of ovary (Fig. 6H). Red
fluorescence is due to PI indicating SP.
Histological observation of gonadal development in
catfish and gonads of MT-treated fishes
Conventional histological methods were used to study
the onset of gonadal sex differentiation in catfish.
Figure 3 (A) RT-PCR analysis in different tissues of adult catfish. (B) Semi-
quantitative RT-PCR analysis (nZ3) of multiple dmrt1s in adult testis and ovary.
(C) Semi-quantitative RT-PCR (nZ3) amplification of multiple dmrt1s in testis and
ovary at different age groups of juvenile catfish (50, 100 and 150 days after hatching).
b-actin was used as an internal endogenous control.
Figure 4 Real-time quantitative RT-PCR analysis of multiple
dmrt1s during different phases of testicular cycle in catfish.
The relative expression of multiple dmrt1stob-actin in gonads
was analyzed by the Applied Biosystems software. Data from
real-time PCR were expressed as meanGS.E.M.(nZ3).
Common letters/numbers indicate means that are not signi-
ficantly different. Means with different letters/numbers differ
significantly (P!0.05). Significance between groups was tested
by ANOVA followed by Student’s–Newman–Keuls0test using
Sigma stat 3.5 software. Inlet of Fig. 4: Representative gel
image showing semi-quantitative RT-PCR expression of
multiple dmrt1s during different phases of testicular cycle
(i. preparatory, ii. pre-spawning, iii. spawning and iv.
post-spawning phases; nZ3).
Dimorphic expression of multiple dmrt1s in catfish .R KAVARTHAPU and B SENTHILKUMARAN 443
www.endocrinology-journals.org Journal of Molecular Endocrinology (2009) 42, 437–448
AUTHOR COPY ONLY
A primitive gonad with primordial germ cells
surrounded by supporting cells was observed in the
abdomenregionnearcoelomiccavityat30dah
(Fig. 7A). Histological observations of gonadal
development in catfish revealed that ovarian differen-
tiation precedes testicular differentiation. Female gonad
at 50 dah (Fig. 7B) showed signs of development of
ovarian cavity (OC) and few growing oocytes (Goc)
already. The ovarian differentiation is completed at 75
dah showing PO (Fig. 7C) while testicular differen-
tiation in catfish started around 50–75 dah wherein
developing germ cells were observed (Fig. 7D and E).
Differentiated gonads can be isolated from 75-day-old
fingerlings and the proliferation of spermatogonia (SG)
and oogonia (OG) can be observed at this age. The
testicular development was clearly evident in 100 dah
gonadal sections showing developing SG1, and SG2
(Fig. 7F). In male gonad at 200 dah, the lumens are
filled with few SP indicating the progress of spermato-
genesis (Fig. 7G). Female gonad at 150 dah showed PO
(Fig. 7H). These observations indicated that morpho-
logical gonadal sex differentiation occurs around
40–50 dah as determined by the formation of an OC
and the proliferation of OG. These events began earlier
than the proliferation of SG.
Figure 5 Western blot analysis (top panel) of Dmrt1 protein
expression in various tissues, such as heart (H), muscle (Mu),
liver (L), kidney (K), spleen (S), brain (B), ovary (O) and testis
(T) which revealed an w31 kDa Dmrt1 protein band in testis,
which is consistent with the size calculated from the sequence
(31 224 kDa) using Lasergene software.
SP SP
SP
SP
SP
SP
SG
PO
SC
SC
SC
SR SG1
SG1
SG2
Figure 6 Immunocytochemical localization of dmrt1 in adult and juvenile testis using anti-
catfish dmrt1 serum. (A) Adult testis section incubated with pre-absorbed antiserum,
which was used as a negative control. (B) Adult testis section showing dmrt1
immunoreactivity in boundaries of lumens filled with spermatids/sperm (SP); arrow heads
show DAB staining. (C) and (D) Adult testis section at higher magnifications. (E) Juvenile
catfish testis section at 200 dah. Arrows indicate the position of the cell types: primary
spermatogonia (SG1), secondary spermatogonia (SG2), spermatocytes (SC), sperma-
tid/sperm (SP), counter stained with hematoxylin. Immunofluoresence localization of
dmrt1 in adult testis using anti-catfish dmrt1 serum. (F) and (G) Adult testis section:
arrows indicate the position of the spermatogenic cells. (H) Ovary section: previtellogenic
oocyte (PO), counter stained with propidium iodide. All scale bars represent 50 mm. Full
colour version of this figure available via http://dx.doi.org/10.1677/JME-09-0011.
R KAVARTHAPU and B SENTHILKUMARAN .Dimorphic expression of multiple dmrt1s in catfish
444
Journal of Molecular Endocrinology (2009) 42, 437–448 www.endocrinology-journals.org
AUTHOR COPY ONLY
Histological examination of gonads of MT-treated
fishes (80%) revealed development of mature males
with testes. However, 20% of the fish population
appeared as intersex/bisexual, which is evident by the
presence of ova-testis and ovary (Fig. 8A). In the same
group, few fish had testis and ovary. On further
evaluation, the cross-section of ova-testis showed the
presence of spermatogenic cells, sperm and oocytes
(Fig. 8B). Histological section of the mature ovary
showed full grown vitellogenic follicles as well as pre-
vitellogenic follicles (Fig. 8C). Representative histo-
logical examination of testis section from 80% of the
group of mature males revealed the presence of various
types of spermatogenic cells (Fig. 8D).
Expression of dmrt1,sox9a,foxl2 and cyp19a1 in
gonads of MT-treated fishes
Ova-testis gonad of MT-treated fish showed expre-
ssion of all the genes tested, i.e. dmrt1,sox9a,foxl2,
cyp19a1 (Fig. 9) as it contained both ovarian follicles
and spermatogenic cells. On the other hand,
MT-treated fishes with mature testes showed the
expression of dmrt1 and sox9a only (Fig. 9). Foxl2 and
cyp19a1 expression are restricted to mature ovary of
MT-treated fish, which possess pre-vitellogenic and
mature vitellogenic follicles (Fig. 9). The quality of
first strand cDNA templates obtained from MT-treated
gonads was tested using b-actin (data not shown).
PGCs
SG1 SG1
SG1
SG2
SG2 PO
SG1
IC
OC
OC PO
OG
Goc
Figure 7 The development and differentiation of catfish gonads (hematoxylin-eosin
staining). (A) 30 dah primitive gonad showing primordial germ cells (PGCs). Inlet
showing another area where two PGCs are surrounded by supporting cells. (B) and
(C) 50 dah and 75 dah female gonads. (D) and (E) 50 dah and 75 dah male gonads.
(F) and (G) 100 dah and 200 dah male gonads. (H) 150 dah female gonad. Arrows
indicate the position of the cells: primordial germ cells (PGCs), primary spermatogonia
(SG1), secondary spermatogonia (SG2), spermatocytes (SC), spermatid/sperm (SP),
interstitial cells (IC), oogonia (OG), growing oocyte (Goc), pre-vitellogenic occyte (PO)
and ovarian cavity (OC); broken circles indicate group of SG2 in Fig. 7G. All scale bars
represent 50 mm. Full colour version of this figure available via http://dx.doi.org/10.
1677/JME-09-0011.
Ovatestis Ovary
SP
Goc
VTF SG
SG
Figure 8 (A) Representative photograph of MT-treated fish
showing morphology of ova-testis and ovary. Histology of
MT-treated fish gonads (hematoxylin-eosin staining): (B) Ova-
testis, (C) Mature ovary, (D) Mature testis. Arrows indicate the
position of the cells: spermatogonia (SG), spermatocytes (SC),
spermatid/sperm (SP) growing oocyte (Goc) and Vitellogenic
follicle (VTF). All scale bars represent 50 mm. Full colour version of
this figure available via http://dx.doi.org/10.1677/JME-09-0011.
Dimorphic expression of multiple dmrt1s in catfish .R KAVARTHAPU and B SENTHILKUMARAN 445
www.endocrinology-journals.org Journal of Molecular Endocrinology (2009) 42, 437–448
AUTHOR COPY ONLY
Discussion
This report depicts cloning of multiple forms of dmrt1
in C.gariepinus. We observed the expression pattern of
dmrt1 in developing testis and ovary by semi-quantitative
RT-PCR and also during different phases of testicular
cycle by real-time qRT-PCR. Among multiple dmrt1s,
dmrt1a, the dominant form, was obtained using RACE.
It showed a high degree of homology with other
vertebrate species at the amino acid level in the DM
domain region which is conserved across different
phyla (Raymond et al. 1998). In addition to dmrt1a, we
report the isolation of two different alternative spliced
forms, dmrt1b and dmrt1c from adult catfish testis using
RT-PCR amplification with ORF flanking primers.
All splicing events occurred within the ORF region at
the 50end. Interestingly, dmrt1c lacks a major part of the
DM-domain region. Multiple alternative splicing in
dmrt1 gene was familiar in diverse species (Burtis &
Baker 1989,Sreenivasulu et al. 2002,Guo et al. 2005,
Cheng et al. 2006,Lu et al. 2007,Zhao et al. 2007). To
our knowledge, 50end spliced variants were shown for
the first time in a lower vertebrate species in this study.
Similar kinds of splicing events were also reported in
the gonads of mouse, where four different forms of
Dmrt1 exist and one of the forms is lacking the entire
DM-domain region (Lu et al. 2007). This shows that the
multiple alternative splicing, which give rise to different
isoforms, is a common feature of the Dmrt1 gene in
vertebrates. The functional significance of alternative
splicing events is unclear at present. Alternative spliced
isoforms may provide various targets for different
upstream and downstream interacting factors in sexual
differentiation. Few targets that are regulated by
DM-factors have been identified, for example, yolk
protein genes in Drosophila and Caenorhabditis elgans,
which is regulated by DSX and MAB-3 respectively (Yi &
Zarkower 1999,Yi et al. 2000). The alternative spliced
forms of dmrt1bordmrt1c may regulate the activity of
dmrt1a which is dominant. Although the isoform dmrt1c
is lacking most of the DM domain region, the presence
of other regions (SY domain) may prevent the DNA
binding of dominant isoform especially dmrt1a, thus
acting as a negative regulator. Further identification of
new targets associated with dmrt1 will provide more
information on how these spliced forms operate and
regulate each other.
Tissue distribution pattern indicated exclusive
expression of dmrt1a in testis. This was also true
when analyzed for Dmrt1 protein by western blot.
Semi-quantitative RT-PCR analysis of multiple dmrt1s
further confirmed sexual dimorphism. Histological
studies from our laboratory revealed that the gonadal
sex differentiation in catfish starts around 40–50 dah.
Based on this, we analyzed multiple dmrt1s expression
pattern in developing gonads between 50 and 150 dah.
Multiple forms of dmrt1 exist in developing testis but
not in developing ovary of catfish. Male-specific
expression of Dmrt1 was noticed in some species like
human (Moniot et al. 2000), chicken (Nanda et al.
1999), frog (Osawa et al. 2005), garden lizard
(Sreenivasulu et al. 2002) and some fish species
(Fernandino et al. 2006,Ijiri et al. 2008,Xia et al.
2007,Kobayashi et al. 2008). In our study, we observed
male-specific expression of multiple dmrt1s in devel-
oping and adult catfish. Taken together, these results
indicate an important role for dmrt1s in an early
testicular development and recrudescence (see below).
By contrast, reports from zebrafish (Guo et al. 2005)
and rice field eel (Huang et al. 2005) showed the
expression of dmrt1 in both male and female gonads.
Nevertheless, the role of dmrt1 in ovarian differen-
tiation has not been defined properly in vertebrates.
The fate of dmrt1 after testicular differentiation i.e. in
adult testis has not been studied in detail so far in any of
the lower vertebrates. In the present study, we
quantified multiple dmrt1satdifferentphasesof
testicular cycle of catfish. Our real-time PCR data
showed that dmrt1a and b was expressed abundantly
during preparatory and pre-spawning phases where
spermatogonia and spermatocytes are dominant
(Swapna et al. 2006), when compared with other phases
of catfish testicular cycle. This indicates that in catfish,
expression of dmrt1 is higher during the period of
spermatogenesis and its expression decreases gradually
thereafter during spawning/spermiation and post-
spawning phases. In rainbow trout (Marchand et al.
2000) and pejerrey (Fernandino et al. 2006), dmrt1
expression was found to be high throughout sperma-
togenesis but decreased at spermiation. Seasonal
changes in dmrt1 expression may contribute to the
maintenance of testicular cycle. Furthermore, immuno-
cytochemical and immunofluorescence data revealed
that dmrt1 was localized in primary spermatogonia,
secondary spermatogonia and spermatocytes, while
spermatid/spermatozoa did not show any immunore-
activity. Similar expression profile of dmrt1 was
Figure 9 Representative gel image showing expressions of
dmrt1a, sox9a,foxl2 and cyp19a1 in ova-testis, mature ovary and
mature testis of MT-treated fishes.
R KAVARTHAPU and B SENTHILKUMARAN .Dimorphic expression of multiple dmrt1s in catfish
446
Journal of Molecular Endocrinology (2009) 42, 437–448 www.endocrinology-journals.org
AUTHOR COPY ONLY
observed in zebrafish (Guo et al. 2005), red-spotted
grouper (Xia et al. 2007). Localization pattern and
up-regulation of dmrt1 expression during testicular
recrudescence indicates plausible role in spermatogen-
esis but not in spermiation/spawning.
This study also aimed to find out whether treatment
of MT induces testis-specific expression pattern of dmrt1
as observed in genetic female sex population of the Nile
tilapia (Kobayashi et al. 2008). Exogenous hormone
treatments during the critical period of sex differen-
tiation resulted in complete sex change in the Nile
tilapia (Nagahama 2005). Treatment of MT (1000 ng/l)
in zebrafish and long term exposure to EE2 (5 ng/l) in
eel during gonadal development resulted in intersex
fish (Orn et al. 2003,Nash et al. 2004). A previous report
(Raghuveer et al. 2005) from our laboratory showed that
exogenous MT treatments given to catfish fries skewed
the catfish population completely towards male
development during the course of gonadal differen-
tiation. However, in the present study, we obtained both
masculanized and intersex/bisexual fish. The apparent
discrepancy may be due to large sample size and also
follow-up until adult. The dosage of MT used in the
present study might also contribute to this effect.
Expression of both male (dmrt1 and sox9a) and female
(foxl2 and cyp19a1) sex-specific genes was observed in
ova-testis gonad of MT-treated fish. On the contrary,
dimorphic expression pattern of male and female sex-
specific genes were observed in completely developed
testis and ovary. Such dimorphic expression pattern was
also reported during gonadal sex differentiation and/
or hormone-induced sex reversal (Alam et al. 2008,
Kobayashi et al. 2008,Ijiri et al. 2008). By contrast, in
rainbow trout oestrogen treatment up-regulates female
specific genes but does not suppress all male specific
genes during male-to-female gonadal trans-differen-
tiation (Vizziano-Cantonnet et al. 2008). These results
together warrant a role for dmrt1 in testicular differen-
tiation/spermatogenesis.
In conclusion, we identified multiple forms of dmrt1
from adult catfish testis. Stage-dependent elevation of
dmrt1s expression in juveniles authenticates a pivotal
role for dmrt1 in testicular differentiation. MT-treat-
ment studies further endorse dmrt1 as a testis-specific
gene. Dmrt1 could be localized in SG and SC but not in
SP. High expression of dmrt1 during testicular recrudes-
cence indicates its importance in the entraining of
testicular cycle.
Declaration of interest
We declare that there is no conflict of interest that could be perceived
as prejudicing the impartiality of the research reported.
Funding
A Grant-in-Aid (BT/PR4567/AAQ/03/219/2003) to B Senthilku-
maran from Department of Biotechnology, India supported this
work completely.
Acknowledgements
We also acknowledge DST-FIST and UGC-SAP programs. KR acknowl-
edges Council of Scientific and Industrial Research, India for a Senior
Research Fellowship. We sincerely thank Dr J Bogerd, Department of
Endocrinology, Utrecht University, The Netherlands and Prof. Y
Nagahama, National Institute for Basic Biology, Japan for their
technical help during early stages of work. We also acknowledge
Prof. Aparna Dutta-Gupta for lending her laboratory facilities at
various stages of the work. Dr K C Majumdar and Dr K Thangaraj,
Centre for Cellular and Molecular Biology, Hyderabad is gratefully
acknowledged for their technical help. We thank our Vice-Chancellor,
Prof. Seyed E Hasnain and the Dean, Prof. A S Raghavendra, for
allowing us to use the genomics and microarray facility of School of
Life Sciences, University of Hyderabad. We sincerely thank the
reviewer for his invaluable suggestions in improving the manuscript
considerably during revision.
References
Alam MA, Kobayashi Y, Horiguchi R, Hirai T & Nakamura M 2008
Molecular cloning and quantitative expression of sexually
dimorphic markers Dmrt1 and Foxl2 during female-to-male sex
change in Epinephelus merra.General and Comparative Endocrinology
157 75–85.
Burtis KC & Baker BS 1989 Drosophila double sex gene controls somatic
sexual differentiation by producing alternatively spliced mRNAs
encoding related sex-specific polypeptides. Cell 56 997–1010.
Cheng HH, Ying M, Tian YH, Guo Y, McElreavey K & Zhou RJ 2006
Transcriptional diversity of DMRT1 (dsx- and mab3-related
transcription factor 1) in human testis. Cell Research 16 389–393.
Fernandino JI, Guilgur LG & Somoza GM 2006 Dmrt1 expression
analysis during spermatogenesis in pejerrey, Odontesthes bonariensis.
Fish Physiology and Biochemistry 32 231–240.
De Grandi A, Calvari V, Bertini V, Bulfone A, Peverali G, Camerino G,
Borsani G & Guioli S 2000 The expression pattern of a mouse
doublesex-related gene is consistent with a role in gonadal
differentiation. Mechanism of Development 90 323–326.
Guan G, Kobayashi T & Nagahama Y 2000 Sexually dimorphic
expression of two types of DM (Doublesex/Mab-3)-domain genes in
a teleost fish, the tilapia (Oreochromis niloticus). Biochemical and
Biophysical Research Communications 272 662–666.
Guo Y, Cheng H, Huang X, Gao S, Yu H & Zhou R 2005 Gene
structure, multiple alternative splicing, and expression in gonads of
zebrafish Dmrt1. Biochemical and Biophysical Research Communications
330 950–957.
Huang X, Guo Y, Shui Y, Gao S, Yu H, Cheng H & Zhou R 2005
Multiple alternative splicing and differential expression of dmrt1
during gonad transformation of the rice field eel. Biology of
Reproduction 73 1017–1024.
Hughes IA 2001 Minireview: sex differentiation. Endocrinology 142
3281–3287.
Ijiri S, Kaneko H, Kobayshi T, Wang DS, Sakai F, Paul-Prasanth B,
Nakamura M & Nagahama Y 2008 Sexual dimorphic expression of
genes during early differentiation of a teleost fish, the Nile tilapia
Oreochromis niloticus.Biology of Reproduction 78 333–341.
Kettlewell JR, Raymond CS & Zarkower D 2000 Temperature-
dependent expression of turtle Dmrt1 before sexual differentiation.
Genesis 26 174–178.
Dimorphic expression of multiple dmrt1s in catfish .R KAVARTHAPU and B SENTHILKUMARAN 447
www.endocrinology-journals.org Journal of Molecular Endocrinology (2009) 42, 437–448
AUTHOR COPY ONLY
Kobayashi T, Matsuda M, Kajiura-Kobayashi H, Suzuki A, Saito N,
Nakamoto M, Shibata N & Nagahama Y 2004 Two DM domain
genes, DMY and DMRT1, involved in testicular differentiation and
development in the medaka, Oryzias latipes.Developmental Dynamics
231 518–526.
Kobayashi T, Kajiura-Kobayashi H, Guan G & Nagahama Y 2008 Sexual
dimorphic expression of DMRT1 and Sox9a during gonadal
differentiation and hormone-induced sex reversal in the teleost
fish Nile tilapia (Oreochromis niloticus). Developmental Dynamics 237
297–306.
Kwon JY, McAndrew BJ & Penman DJ 2001 Cloning of brain aromatase
gene and expression of brain and ovarian aromatase genes during
sexual differentiation in genetic male and female Nile tilapia
Oreochromis niloticus.Molecular Reproduction and Development 59
359–370.
Lu H, Huang X, Zhang L, Guo Y, Cheng H & Zhou R 2007 Multiple
alternative splicing of mouse Dmrt1 during gonadal differentiation.
Biochemical and Biophysical Research Communications 352 630–634.
Marchand O, Govoroun M, D’Cotta H, McMeel O, Lareyre J, Bernot
A, Laudet V & Guiguen Y 2000 DMRT1 expression during
gonadal differentiation and spermatogenesis in the rainbow trout,
Oncorhynchus mykiss.Biochemica et Biophysica Acta 1493 180–187.
Matsuda M, Nagahama Y, Shinomiya A, Sato T, Matsuda C, Kobayashi T,
Morrey CE, Shibata N, Asakawa S, Shimizu N et al. 2002 DMY is a
Y-specific DM-domain gene required for male development in the
medaka fish. Nature 417 559–563.
Moniot B, Berta P, Scherer G, Sudbeck P & Poulat F 2000 Male specific
expression suggests role of DMRT1 in human sex determination.
Mechanism of Development 91 323–325.
Nagahama Y 2005 Molecular mechanisms of sex determination and
gonadal sex differentiation in fish. Fish Physiology and Biochemistry 31
105–109.
Nanda I, Shan Z, Schartl M, Burt DW, Koehler M, Nothwang H,
Grutzner F, Paton IR, Windsor D, Dunn I et al. 1999 Three hundred
million years of conserved synteny between chicken Z and human
chromosome 9. Nature Genetics 21 258–259.
Nash JP, Kime DE, Van der Ven LT, Wester PW, Brion F, Maack G,
Stahlschmidt-Allner P & Tyler CR 2004 Long-term exposure to
environmental concentrations of the pharmaceutical ethynylestra-
diol causes reproductive failure in fish. Environmental Health
Perspectives 112 1725–1733.
Orn S, Holbech H, Madsen TH, Norrgren L & Petersen GI 2003
Gonad development and vitellogenin production in zebrafish
(Danio rerio) exposed to ethinylestradiol and methyltestosterone.
Aquatic Toxicology 65 397–411.
Osawa N, Oshima Y & Nakamura M 2005 Molecular cloning of
Dmrt1 and its expression in the gonad of Xenopus.Zoological Science
22 681–687.
Ottolenghi C & McElreavey K 2000 Deletion of 9p and quest for a
conserved mechanism of sex determination. Molecular Genetics and
Metabolism 71 397–404.
Raghuveer K, Rahul G, Wang DS, Bogerd J, Kirubagaran R, Rasheeda
MK, Sreenivasulu G, Bhattachar ya N, Tarangini S, Nagahama Y et al.
2005 Effect of methyl testosterone and ethynyl estradiol-induced
sex differentiation on catfish, Clarias gariepinus: Expression profiles
of Dmrt1, cytochrome P450aromatases and 3b-hydroxysteroid
dehydrogenase. Fish Physiology and Biochemistry 31 143–147.
Rasheeda MK, Sreenivasulu G, Swapna I, Raghuveer K, Wang DS,
Thangaraj K, Dutta-Gupta A & Senthilkumaran B 2005
Thiourea-induced alteration in the expression patterns of some
steroidogenic enzymes in the air-breathing catfish Clarias gariepinus.
Fish Physiology and Biochemistry 31 275–279.
Raymond CS, Shamu CE, Shen MM, Seifert KJ, Hirsch B, Hodgkin J &
Zarkower D 1998 Evidence for evolutionary conservation of sex-
determining genes. Nature 391 691–695.
Raymond CS, Parker ED, Kettlewell JR, Brown LG, Page DC, Kusz K,
Jaruzelska J, Reinberg Y, Flejter WL, Bardwell VJ et al. 1999 A region
of human chromosome 9p required for testis development contains
two genes related to known sexual regulators. Human Molecular
Genetics 8989–996.
Raymond CS, Murphy MW, O’Sullivan MG, Bardwell VJ & Zarkower D
2000 Dmrt1, a gene related to warm and fly sexual regulators, is
required for mammalian testis differentiation. Genes and Development
14 2587–2595.
Sreenivasulu K, Ganesh S & Raman R 2002 Evolutionarily conserved,
DMRT1, encodes alternatively spliced transcripts and shows
dimorphic expression during gonadal differentiation in the lizard,
Calotes versicolor.Gene Expression Patterns 251–60.
Swain A & Lovell-Badge R 1999 Mammalian sex determination: a
molecular drama. Genes and Development 13 755–767.
Swapna I, Rajasekhar M, Supriya A, Raghuveer K, Sreenivasulu G,
Rasheeda MK, Majumdar KC, Kagawa H, Tanaka H, Dutta-Gupta
Aet al. 2006 Thiourea-induced thyroid hormone depletion
impairs testicular recrudescence in the air-breathing catfish,
Clarias gariepinus.Comparative Biochemistry and Physiology 144 1–10.
Vizziano-Cantonnet D, Baron D, Mahe S, Cauty C, Fostier A & Guiguen
Y 2008 Estrogen treatment up-regulates female genes but does
not suppress all early testicular markers during rainbow trout
male-to-female gonadal trans-differentiation. Journal of Molecular
Endocrinology 41 277–288.
Wang DS, Kobayashi T, Senthilkumaran B, Sakai F, Sudhakumari CC,
Suzuki T, Yoshikuni M, Matsuda M, Morohashi K & Nagahama Y
2002 Molecular cloning of DAX-1 and SHP cDNAs and their
expression patterns in the Nile tilapia, Oreochromis niloticus.
Biochemical and Biophysical Research Communications 297 632–640.
Xia W, Zhou L, Yao B, Li CJ & Gui JF 2007 Differential and
spermatogenic cell-specific expression of DMRT1 during sex
reversal in protogynous hermaphroditic groupers. Molecular and
Cellular Endocrinology 263 156–172.
Yi W & Zarkower D 1999 Similarity of DNA binding and transcriptional
regulation by Caenorhabditis elegans MAB-3 and Drosophila melanogaster
DSX suggests conservation of sex determining mechanisms.
Development 126 873–881.
Yi W, Ross JM & Zarkower D 2000 Mab-3 is a direct tra-1 target gene
regulating diverse aspects of C. elegans male sexual development
and behavior. Development 127 4469–4480.
Zhang J 2004 Evolution of DMY, a newly emergent male sex-
determination gene of medaka fish. Genetics 166 1887–1895.
Zhao Y, Lu H, Yu H, Cheng H & Zhou R 2007 Multiple alternative
splicing in gonads of chicken DMRT1. Development Genes and
Evolution 217 119–126.
Received in final form 10 February 2009
Accepted 24 February 2009
Made available online as an Accepted Preprint 24 February 2009
R KAVARTHAPU and B SENTHILKUMARAN .Dimorphic expression of multiple dmrt1s in catfish
448
Journal of Molecular Endocrinology (2009) 42, 437–448 www.endocrinology-journals.org
