Content uploaded by Andrew Newman
Author content
All content in this area was uploaded by Andrew Newman on Sep 18, 2014
Content may be subject to copyright.
Dissection of Prp8 protein defines multiple
interactions with crucial RNA sequences in
the catalytic core of the spliceosome
IAN A. TURNER, CHRISTINE M. NORMAN, MARK J. CHURCHER, and ANDREW J. NEWMAN
MRC Laboratory of Molecular Biology, Cambridge CB2 2QH, UK
ABSTRACT
Current models of the core of the spliceosome include a network of RNA–RNA interactions involving the pre-mRNA and the U2, U5,
and U6 snRNAs. The essential spliceosomal protein Prp8 interacts with U5 and U6 snRNAs and with specific pre-mRNA sequences
that participate in catalysis. This close association with crucial RNA sequences, together with extensive genetic evidence, suggests
that Prp8 could directly affect the function of the catalytic core, perhaps acting as a splicing cofactor. However, the sequence of Prp8
is almost entirely novel, and it offers few clues to the molecular basis of Prp8–RNA interactions. We have used an innovative
transposon-based strategy to establish that catalytic core RNAs make multiple contacts in the central region of Prp8, underscoring the
intimate relationship between this protein and the catalytic center of the spliceosome. Our analysis of RNA interactions identifies a
discrete, highly conserved region of Prp8 as a prime candidate for the role of cofactor for the spliceosome’s RNA core.
Keywords: spliceosome; Prp8; RNA–protein interaction; pre-mRNA splicing
INTRODUCTION
Pre-mRNA splicing in eukaryotes is catalyzed by the
spliceosome, a dynamic complex consisting of five small
nuclear RNAs (snRNAs) and multiple proteins. The chemi-
cal mechanism of pre-mRNA splicing is identical to that of
self-splicing Group II introns and involves two trans-ester-
ification reactions. In the first reaction the 2¢OH of a
specific adenosine in the intron, termed the branch point
(BP), attacks the 5¢splice site (SS), producing a branched or
‘‘lariat’’ intron intermediate and a 5¢exon intermediate with
a3¢OH group. In the second reaction this 3¢OH group
attacks the 3¢SS to produce lariat intron and spliced
mRNA products. The catalytic core of the spliceosome
consists of a highly structured RNA network formed
between U2, U6, and U5 snRNAs and the sites of chemistry
in the pre-mRNA (Parker et al. 1987; Wu and Manley 1989;
Newman and Norman 1992; Kandels-Lewis and Seraphin
1993; Lesser and Guthrie 1993; Sontheimer and Steitz
1993). Mechanistic and structural similarities between the
spliceosomal snRNAs and Group II autocatalytic introns
strongly support the hypothesis that spliceosomal snRNA
sequences are central to the catalysis of pre-mRNA splicing
(Moore and Sharp 1993; Padgett et al. 1994; Boulanger et al.
1995; Peebles et al. 1995; Sigel et al. 2000; Villa et al. 2002;
Hilliker and Staley 2004). In particular an RNA complex
between U2 and U6 snRNAs is believed to play a critical
role in the catalytic core of the spliceosome, acting as a
scaffold to juxtapose the reactive 5¢SS and BP sequences and
to position a bound metal ion that is essential for splicing
catalysis (Madhani and Guthrie 1992; Sun and Manley
1995; Yean et al. 2000; Huppler et al. 2002; Sashital et al.
2004). Indeed a synthetic, protein-free U2-U6 snRNA com-
plex formed in the presence of Mg
2+
ions is able to promote
a reaction similar to the first transesterification reaction of
splicing (Valadkhan and Manley 2001).
In contrast to the detailed structural and mechanistic
information now available for the RNA components of
the spliceosome’s catalytic core, there is much less informa-
tion about the possible contributions of protein factors to
catalytic core structure and activity. However, one spliceo-
somal protein—the U5 snRNP component Prp8—has
attracted attention because it has been shown to contact
multiple catalytic core RNA residues. Crucially, it has been
cross-linked to sequences at or near the 5¢SS, BP, and 3¢SS,
i.e., all three of the substrate sequences involved in the
Reprint requests to: Andrew J. Newman, MRC Laboratory of Molecular
Biology, Hills Road, Cambridge CB2 2QH, UK; e-mail: newman@mrc-
lmb.cam.ac.uk; fax: 44 1223 412142.
Article published online ahead of print. Article and publication date are
at http://www.rnajournal.org/cgi/doi/10.1261/rna.2229706.
RNA (2006), 12:375–386. Published by Cold Spring Harbor Laboratory Press. Copyright ª2006 RNA Society.
375
a22297 Turner et al. Article RA
transesterification reactions (Wyatt et al. 1992; Teigelkamp
et al. 1995; Umen and Guthrie 1995b; Chiara et al. 1996,
1997; Reyes et al. 1996, 1999; Maroney et al. 2000; McPhe-
eters and Muhlenkamp 2003), and is also known to contact
critical residues in U5 and U6 snRNAs (Dix et al. 1998;
Vidal et al. 1999). Prp8 is intimately involved in the RNA
rearrangements that are required for formation of the cat-
alytic core RNA structures (Kuhn et al. 1999, 2002; Kuhn
and Brow 2000; van Nues and Beggs 2001). Genetic studies
have shown that multiple prp8 alleles give a complex pat-
tern of suppression of mutations in the 5¢SS, BP, and 3¢SS
sequences (Umen and Guthrie 1995a, 1996; Collins and
Guthrie 1999; Siatecka et al. 1999; Query and Konarska
2004). Clearly this protein occupies a pivotal position in
the core of the spliceosome, and this has led to speculation
that Prp8 might act as a splicing cofactor, perhaps by
stabilizing catalytic core RNA structures, or alternatively
Prp8 could itself contribute functional groups to the
spliceosome’s active site (Collins and Guthrie 2000).
The sequences of many Prp8 orthologs are now available,
but they have little obvious homology to other protein
domains, so they offer few clues to the protein’s possible
biochemical functions or domain organization. Overall
Prp8 is highly conserved in both size and sequence: Most
orthologs are 2400 residues long and there is 61% identity
between the yeast and human sequences (Hodges et al.
1995; Luo et al. 1999). With regard to Prp8’s RNA interac-
tions, the clearest feature to emerge from sequence analysis
is a putative RNA recognition motif (RRM) in the central
region of the protein (Grainger and Beggs 2005). The RRM
is a potential binding site for one or more of the protein’s
known RNA partners in the core of the spliceosome, but its
actual ligand has yet to be identified. The only Prp8-RNA
contact mapped so far is between the 5¢SS and the human
ortholog of Prp8, and lies near the C terminus of the pro-
tein, remote from the RRM (Reyes et al. 1999).
Here we have used site-specific RNA–protein photocross-
linking together with a novel proteolytic strategy to resolve
and physically map multiple contacts between Prp8 and
important catalytic core RNA sequences. The mapping strat-
egy involves the insertion of short peptide tags containing
protease sites into Prp8 using a custom-built Tn5-based
transposon. Insertion of peptide tags was tolerated at many
sites in Prp8 without compromising any of the protein’s
essential functions. The sites of RNA–protein cross-links on
Prp8 were then determined using this array of protease sites.
This approach has the power to dissect and resolve complex
patterns of cross-links. We show that three noncontiguous
regions of Prp8 contact both the 5¢SS and BP in spliceosomes.
The data highlight a short, highly conserved segment of Prp8
as a prime candidate for the role of promoting RNA catalysis
in the spliceosome. This new information about Prp8’s RNA
interactions will be invaluable for the design of experiments
aimed at reconstituting the spliceosome’s catalytic center for
structural and functional analysis.
RESULTS
Insertion of TEV protease sites into Prp8
Transposon mutagenesis of PRP8 produced a library of
genes, each containing a single copy of the 69-bp insert
containing a TEV protease site. Analysis of the library by
restriction enzyme digestion (data not shown) revealed
that, prior to screening for function, the transposons were
broadly distributed throughout the gene without obvious
clustering. This is consistent with earlier data on Tn5 indi-
cating that transposition is highly random (Shevchenko et
al. 2002). An initial small-scale plasmid shuffle screen iso-
lated the genes for 25 functional TEV site-tagged Prp8
proteins, and in this cohort the TEV inserts mapped to six
main clusters arranged nonrandomly across the gene
(Fig. 1A). In view of the highly random nature of the primary
transposon library, this clustering of the survivors of the
screen probably reflects selection against TEV inserts in
specific regions of the protein: for example, the transpo-
son-free interval 1503–1673. Indeed extensive screening for
transposon inserts in this region produced no survivors,
and several TEV inserts introduced into the 1503–1673
interval by site-directed mutagenesis proved to be lethal in
every case (data not shown). This suggests that the 1503–
1673 interval and perhaps other regions of Prp8 are partic-
ularly sensitive to foreign sequence insertions.
Analysis of several splicing extracts made from strains with
TEV sites in Prp8 showed that these extracts displayed nor-
mal splicing activity, and that incubation with TEV protease
in native conditions resulted in highly specific cleavage of
Prp8 at inserted TEV sites. Initial mapping suggested that
Prp8–RNA cross-links were present in the central region of
the protein, where there were extensive transposon-free
areas. To facilitate the characterization and mapping of
RNA interactions in Prp8, we therefore searched for addi-
tional prp8 alleles with TEV inserts in the central part of the
gene. This entailed new transposon screens focused on this
region and targeted mutagenesis of regions expected to form
exposed surface loops (by secondary structure prediction
using Predict Protein) or sites known to harbor inserts in
other Prp8 orthologs (Grainger and Beggs 2005). Together
these approaches produced an extensive collection of func-
tional prp8 alleles with protease cleavage sites in the central
region of the protein (Fig. 1A). We have used these engi-
neered proteins to analyze contacts between Prp8 and impor-
tant residues in the pre-mRNA, U5 snRNA, and U6 snRNA.
U6 snRNA contacts the highly conserved domain
3.2 of Prp8
Contact between Prp8 and U6 snRNA in U4/U6.U5 tri-
snRNPs was originally demonstrated (Vidal et al. 1999) by
incorporating a 4-thiouridine (4-thioU) photocross-linker
at position 54 in U6. This nucleotide is immediately
376 RNA, Vol. 12, No. 3
Turner et al.
downstream of the conserved ACAGAG motif that con-
tacts the 5¢splice site in the spliceosome and also lies at
the end of one of the U4-U6 helices in the U4/U6.U5
tri-snRNP. U6 snRNA with a single
32
P-labeled phos-
phate upstream of a 4-thioU at position 54 was synthe-
sized by ligation and demonstrated to reconstitute func-
tional snRNP particles by splicing activity assay (data not
shown). As shown previously (Vidal et al. 1999) we de-
tected cross-links from U54 in U6 snRNA to two large
polypeptides, both with apparent molecular weights >200
kDa, after UV irradiation, affinity capture, and SDS-PAGE
(Fig. 2A). Mobility shifts according to the presence or
absence of epitope tags (data not shown) confirmed that
the upper of these proteins is Prp8 and the lower is Brr2,
which, like Prp8, is a component of U5
snRNP and the U4/U6.U5 tri-snRNP.
Brr2 is involved in unwinding U4-U6
base pairing prior to catalytic activation
of the spliceosome (Laggerbauer et al.
1998; Raghunathan and Guthrie 1998;
Kim and Rossi 1999; Kuhn and Brow
2000). The formation of these RNA–pro-
tein cross-links is strictly dependent on
the presence of the 4-thioU photocross-
linker, demonstrating that they are in-
deed site specific (data not shown).
When cross-linked samples from extracts
with TEV sites at various positions in
Prp8 are split into two aliquots, incu-
bated in the absence and presence of
TEV protease, and fractionated by SDS-
PAGE, a single novel labeled species
appears in each +TEV protease lane, cor-
responding to the predicted mobility of
one of the TEV digestion products (Fig.
2A). For TEV sites at positions 1281,
1471, and 1503, it is the C-terminal frag-
ment that is labeled, while for TEV sites
at 1673, 1688, and 1726, the N-terminal
fragment is labeled. These results show
that U6 [U54] makes contact(s) between
amino acids 1503 and 1673 in the Prp8
sequence, an interval that overlaps exten-
sively with domain 3.2 of Prp8, a region
of exceptional sequence conservation
(Grainger and Beggs 2005).
U5 snRNA contacts two discrete
segments of Prp8
Prp8 has been shown to make extensive
contacts with U5 snRNA in reconstituted
yeast U5 snRNPs (Dix et al. 1998) and
cross-linked strongly to a 4-thioU photo-
cross-linker at nucleotide 97 in the invar-
iant Loop 1 sequence. This loop is known to contact the 5¢
and 3¢exon sequences adjacent to the splice sites in active
spliceosomes (Newman and Norman 1992; Wyatt et al. 1992;
Cortes et al. 1993; Sontheimer and Steitz 1993; Newman et al.
1995). Using U5 snRNA with a single
32
P-labeled phosphate
and 4-thioU at position 97 in Loop 1, we assembled U5
snRNPs in several splicing extracts with TEV sites at different
positions in Prp8 (Fig. 2B). The U5 snRNP reconstitution
procedure used here does not support U4/U6.U5 tri-snRNP
formation, so our analysis is aimed at U5 snRNA-Prp8 cross-
links formed solely in U5 snRNPs (see Materials and Meth-
ods). After UVirradiation, affinity capture, and SDS-PAGE, a
closely spaced doublet of labeled proteins of apparent molec-
ular weight >200 kDa is visible in each extract. Formation of
FIGURE 1. Positions of TEV protease sites in Prp8 and 4-thioU residues in U5 snRNA, U6
snRNA, and the pre-mRNA. (A) TEV sites are numbered according to the Prp8 amino acid
immediately upstream of the peptide insert. The locations of conserved RNA recognition motif
(RRM) and Mpr-1, Pad1, N-terminal (MPN) domains and the N-terminal proline-rich region
(Grainger and Beggs 2005) are also shown. (B) Predicted RNA secondary structures in U4/
U6.U5 tri-snRNPs (left) and spliceosomes (right). The positions of 4-thioU photocross-linkers
in U5 snRNA (nucleotide 97 in Loop 1), U6 snRNA (nucleotide 54), and the pre-mRNA (5¢SS-
1 and BP+2) are indicated.
www.rnajournal.org 377
RNA interactions of splicing factor Prp8
Fig.1 live 4/c
these RNA–protein cross-links is strictly
dependent on the presence of the 4-thioU
photocross-linker, demonstrating that
they are genuinely site specific. The
upper band is full-length Prp8 and the
lower component (open arrowhead) re-
sults from cleavage by an endogenous
protease in the vicinity of amino acids
2100–2200 (Fig. 2B; data not shown).
Incubation with TEV protease results
in the appearance of one or more novel
labeled protein bands (Fig. 2B). The pat-
tern is complicated by endogenous pro-
tease cleavage of Prp8 that can produce a
secondary fragment by C-terminal trun-
cation (open arrowheads in +TEV lanes;
see Fig. 2 legend). Taking this complica-
tion into account, cleavage at 770, 1413,
and 1471 in each case produces a single
labeled fragment: 770–2413, 1–1413, and
1–1471, respectively. In contrast, after cleav-
age at 871, 970, 1096, and 1281, both of
the fragments are labeled.
These results indicate that the major
cross-links from nucleotide 97 in U5
Loop 1 lie between 770 and 1413 in Prp8.
In addition they reveal that there are at
least two sites of contact on Prp8: One
site maps between 770 and 871 and the
other between 1281 and 1413. Clearly,
cleavage of Prp8 at any position between
871 and 1281 will result in both polypep-
tides being labeled and cannot directly
address the possibility that additional
cross-links might lie in the 871–1281
interval. To address this issue—which is
of particular interest in view of the pre-
sence of a conserved RRM at residues
1059–1151 of Prp8 (Grainger and Beggs
2005)—we made an additional prp8 allele
encoding a protein with a site for TEV
protease at 871 and a site for PreScission
(PreS) protease (which recognizes the
sequence LEVLFQ/GP) at 1281. Cleavage
of Prp8 with TEV and PreS proteases
separately and in combination gives rise
to the predicted labeled polypeptides
(Fig. 2C). In particular, the double digest
produces labeled 1–871 and 1281–2413
fragments, but the central fragment
871–1281 (predicted molecular weight
51 kDa) is not detectable on either gel
type. In conclusion, these results are con-
sistent with a model in which there are
two discrete regions of Prp8 in contact
FIGURE 2. Prp8 interactions with U5 and U6 snRNAs. (A) Analysis of cross-links between Prp8
and nucleotide 54 of U6 snRNA in U4/U6.U5 tri-snRNPs by cleavage at TEV protease sites (at
the amino acid indicated below each pair of lanes) in Prp8. After cross-linking and capture, the
samples were divided into two aliquots and incubated with or without TEV protease before
fractionation by SDS-PAGE and visualization by phosphorimaging.
32
P-labeled Prp8 fragments
released by TEV protease cleavage are indicated by arrowheads (1–6) and identified on the right.
It is clear that the TEV sites at 1503–1688 are partially resistant to protease cleavage. Therefore we
cannot exclude the possibility that additional cross-link(s) might be present outside the 1503–
1673 region (but between 1281 and 1726) in a subpopulation of Prp8 that is wholly resistant to
TEV protease digestion. (B) Analysis of cross-links between Prp8 and nucleotide 97 of U5 snRNA
by cleavage at TEV protease sites in Prp8. Samples were divided into two aliquots and incubated
with or without TEV protease before fractionation by SDS-PAGE and visualization by phosphor-
imaging.
32
P-labeled Prp8 fragments released by TEV protease cleavage are indicated by arrow-
heads (1–12) and identified on the right. Open arrowheads indicate
32
P-labeled Prp8 fragments
truncated near the C terminus (in the vicinity of position 2100–2200) by an endogenous protease
(see Results). (C) Analysis of cross-links between Prp8 and nucleotide 97 of U5 snRNA using
Prp8 with a TEV protease site at 871 and a PreScission (PreS) protease site at 1281. After cross-
linking and capture, the sample was divided into four aliquots and incubated in the presence of
proteases as indicated before fractionation by SDS-PAGE and visualization by phosphorimaging.
The positions and sizes (in kilodaltons) of unlabeled molecular weight markers are shown to the
left of each gel.
32
P-labeled Prp8 fragments released by TEV and/or PreS protease cleavage are
indicated by arrowheads (1–4) and identified on the right. Open arrowheads indicate
32
P-labeled
Prp8 fragments truncated near the C terminus by an endogenous protease (see Results). (Inset)
Cartoon of the Prp8 protein, showing the array of TEV sites and summarizing the cross-link
mapping data presented in A–C.
378 RNA, Vol. 12, No. 3
Turner et al.
with position 97 in U5 Loop 1 (770–871
and 1281–1413). However there is no
sign of additional cross-links in the inter-
vening region (871–1281) that includes
the conserved Prp8 RRM.
Interactions between Prp8
and the pre-mRNA
In addition toits contacts with important
residues in U5 and U6 snRNAs, Prp8
(and its mammalian ortholog hPrp8) is
unique among spliceosomal proteins in
that it has been shown to cross-link to all
three sequences in the pre-mRNA that
participate directly in the chemistry of
splicing: the 5¢splice site, branch site,
and 3¢splice site (Wyatt et al. 1992; Tei-
gelkamp et al. 1995; Umen and Guthrie
1995a; Chiara et al. 1996, 1997; Reyes
et al. 1996, 1999; Maroney et al. 2000;
McPheeters and Muhlenkamp 2003). We
have used the TEV protease mapping tech-
nique to analyze cross-links between Prp8
and several nucleotides in the vicinity of
the splice sites and branch site, with the
aim of identifying the regions of this pro-
tein that may be associated with splicing
reaction chemistry.
We have focused on the 5¢splice site
and branch point—the two pre-mRNA
sequences that the spliceosome must jux-
tapose in order to catalyze the first trans-
esterification reaction. By incorporating
4-thioU photocross-linkers immediately
upstream of the 5¢splice site (position
5¢SS-1) or 2 nt downstream of the branch
point (BP+2) in actin pre-mRNAs, we
detected cross-links to Prp8 in active
spliceosomes as shown previously (Wyatt
et al. 1992; Teigelkamp et al. 1995; Reyes et
al. 1996, 1999; Maroney et al. 2000). In
each case substrate-Prp8 cross-link for-
mation was strictly dependent on the
4-thioU photocross-linker, and therefore
genuinely site-specific (data not shown).
Kinetic analysis showed that Prp8 labeling
using the 5¢SS-1 and BP+2 photocross-
linkers followed similar time courses,
peaking after 5 min of incubation at
23C, and coinciding with rapid ac-
cumulation of the intermediates and
products of splicing (data not shown).
In the experiments shown in Figures 3
and 4, cross-linking was performed after
FIGURE 3. Prp8 interactions with the 5¢splice site. (A)Analysisofcross-linksbetween
Prp8 and the 5¢SS in actin pre-mRNA, using a photocross-linker at position 5¢SS-1. The
position of the TEV protease site in Prp8 is indicated below each pair of lanes. After
cross-linking and capture, the samples were divided into two aliquots and incubated with
or without TEV protease before fractionation by SDS-PAGE and visualization by phos-
phorimaging. In A–C,
32
P-labeled Prp8 fragments released by TEV protease cleavage are
annotated following the same scheme as in Figure 2C. (B) Visualization of the cross-link
between the 5¢SS and the central region of Prp8 (residues 1281–1471) using Prp8 with a
PreS protease site at 1281 and a TEV protease site at 1471. After cross-linking and
capture, the sample was divided into four aliquots and incubated in the presence of
proteases as indicated before fractionation by SDS-PAGE and visualization by phosphor-
imaging (left,3%–8%polyacrylamide;right, 4%–12% polyacrylamide). The positions of
unlabeled molecular weight markers are shown to the left of each gel. (C)Additional
mapping data for cross-links between 5¢SS-1 and Prp8, and comparison with cross-links
betweenU5snRNA(nucleotide97)andPrp8.ThepositionoftheTEVproteasesitein
Prp8 is indicated below each pair of lanes. After cross-linking and capture, the samples
were divided into two aliquots and incubated with or without TEV protease before
fractionation by SDS-PAGE and visualization by phosphorimaging. (Inset)Cartoonof
the Prp8 protein, showing the array of TEV sites and summarizing the cross-link mapping
data presented in A–C.
www.rnajournal.org 379
RNA interactions of splicing factor Prp8
incubating splicing reactions for 5 min at
23C, and the cross-links in radiolabeled
Prp8 were then resolved using the pro-
teolytic cleavage technique.
Multiple interactions between
Prp8 and the 5¢splice site
After incubating radiolabeled Prp8
from 5¢SS-1 cross-linking reactions with
TEV protease, one or more novel
labeled protein bands appear (Fig.
3A,C). Cleavage at 518, 770, 871, 1673,
1726, and 2106 in each case generates a
single labeled polypeptide, indicating
that the major cross-links lie between
871 and 1673. Cleavage at any of the
sites between 871 and 1673 (970, 1281,
1413, 1471, 1503) results in both cleav-
age products being labeled, so this
region of Prp8 contains at least two
cross-links (Fig. 3A,C). Closer inspec-
tion of the labeling pattern produced
by cleavage at 1281, 1413, 1471, and
1503 suggests that there may in fact be
three cross-linking sites in the central
region of Prp8. The upstream site is
relatively weak, but is clearly visualized
by cleavage at 1281, releasing labeled 1–
1281 (minor band) and 1281–2413
(major band). It is striking that after
cleavage at 1413 or 1471, however,
most of the radiolabel is now in the N-
terminal fragment (1–1413/1471) and
the C-terminal fragment becomes the
minor band. This suggests that there
must be a strong cross-link in the region
1281–1413. In addition, since cleavage
at 1503 labels both polypeptides, but
cleavage at 1673 labels only 1–1673, a
third cross-link must lie in this interval
(1503–1673). This is the same region
that cross-linked to nucleotide 54 of
U6 snRNA (Fig. 2A).
We have confirmed the presence of a
cross-link between 1281 and 1471 by
creating an additional prp8 allele with
a site for PreS at 1281 and a site for TEV
protease at 1471. Cleavage with PreS
alone gave rise to labeled 1–1281 and
1281–2413 products, as expected (Fig.
3B; cf. Fig. 3A for cleavage by TEV at
the same position). Cleavage with TEV
alone produced 1–1471 and 1471–2413
products (Fig. 3B; cf. Fig. 3A). Signifi-
FIGURE 4. Prp8 interactions with the intron branch point. (A) Analysis of cross-links
between Prp8 and the intron branch point in actin pre-mRNA, using a photocross-linker
at position BP+2. The position of the TEV protease site in Prp8 is indicated below each
pair of lanes. After cross-linking and capture, the samples were divided into two aliquots
and incubated with or without TEV protease before fractionation by SDS-PAGE and
visualization by phosphorimaging. In A–C
32
P-labeled Prp8 fragments released by TEV
proteasecleavageareannotatedfollowingthesameschemeasinFigure2C.(B)Com-
parison between 5¢SS and BP cross-linking patterns visualized by cleavage at TEV
protease sites in the central region of Prp8. The position of the TEV protease site in
Prp8 is indicated below each pair of lanes. After cross-linking and capture, the samples
were divided into two aliquots and incubated with or without TEV protease before
fractionation by SDS-PAGE and visualization by phosphorimaging. (C)Comparison
between 5¢SS and BP cross-linking in the central region of Prp8 (residues 1281–1471)
using Prp8 with a PreS protease site at 1281 and a TEV protease site at 1471. After cross-
linking and capture, the sample was divided into four aliquots and incubated in the
presence of proteases as indicated before fractionation by SDS-PAGE and visualization by
phosphorimaging. The positions of unlabeled molecular weight markers are shown to the
left of each gel. The identities of the labeled proteins of 80 kDa and 115 kDa (BP gel) are
unknown. (Inset) Cartoon of the Prp8 protein, showing the array of TEV sites and
summarizing the cross-link mapping data presented in A–C.
380 RNA, Vol. 12, No. 3
Turner et al.
cantly, when TEV and PreS proteases were used together a
novel, labeled product appears: This is the 22-kDa 1281–
1471 polypeptide, confirming that the 5¢SS-1 4-thioU resi-
due cross-links with three discrete regions of Prp8. Inter-
estingly, the central 5¢SS-1 cross-link maps to the same
region of Prp8 as one of the U5 Loop 1 (97) cross-links.
The position of the cross-link mapped upstream of 1281
(Fig. 3A) has been the most difficult to ascertain more
precisely, in part because it is relatively weak. Comparison
of the patterns of labeled proteins produced by cleavage at
871 after cross-linking with U5 Loop 1 [97] and 5¢SS-1 (Fig.
3C) clearly shows that all 5¢SS-1 cross-links lie downstream
of 871 whereas U5 Loop 1 [97] cross-links lie both
upstream and downstream of 871. Cleavage at 970 (Fig.
3C) and several other positions between 970 and 1281
(data not shown) in every case produces a poorly labeled
N-terminal fragment and a strongly labeled downstream
fragment, indicating that the minor upstream 5¢SS-1
cross-link lies between 871 and 970.
In summary we have detected and mapped contacts be-
tween the 5¢SS and three noncontiguous regions of the
Prp8 sequence: 871–970, 1281–1413, and 1503–1673. The
last two of these regions also contact the U5 snRNA Loop 1
[97] and U6 snRNA [54], respectively. None of these cross-
links maps within the conserved Prp8 RRM (residues 1059–
1151).
Interactions of the branch site with Prp8 mirror
those of the 5¢splice site
Proteolytic mapping data for radiolabeled Prp8 generated
using actin pre-mRNA with a 4-thioU residue 2 nucleotides
downstream of the intron branch site (BP+2) are presented
in Figure 4A–C. Interestingly, the results reveal a pattern of
cross-links that closely parallels that produced by the 5¢SS-1
photocross-linker. Cleavage at 770 or 871 releases a single
labeled fragment (770–2413 or 871–2413) and so does
cleavage at 1673 (producing 1–1673). Also, after cleavage
in the central region of Prp8 at sites from 1281 to 1503 both
of the digestion products are labeled (Fig. 4A,B) as shown
for Prp8 labeled by the 5¢SS cross-linker (see above).
The close similarity between the 5¢SS-1 and BP+2 cross-
link patterns is illustrated in the data shown in Figure 4B.
After cleavage of 5¢SS and BP-labeled Prp8 at 1281 both the
N- and C-terminal Prp8 fragments are labeled, the C-term-
inal fragment more strongly. Following cleavage of the BP-
labeled Prp8 at 1413 or 1471, however, the 5¢SS-labeled and
BP-labeled Prp8 give different patterns: For BP the C-term-
inal fragment is still strongly labeled, whereas for 5¢SS it is
the N-terminal fragment that is strongly labeled. This sug-
gests that the strong 5¢SS cross-link in the 1281–1471 region
is absent or less abundant in BP-labeled Prp8. Consistent
with this, when the putative central cross-link (1281–1471)
from BP+2 is displayed by simultaneous cleavage with PreS
and TEV proteases at 1281 and 1471, respectively, the re-
sulting 22-kDa polypeptide is only barely labeled (Fig. 4C).
Precisely echoing the situation for 5¢SS-1, cross-linking
with the BP+2 pre-mRNA also results in formation of a
minor cross-link upstream of 1281 (Fig. 4A) and, given that
cleavage at 871 produces only a single labeled fragment
(871–2413), this cross-link must lie between 871 and
1281. Echoing the situation for 5¢SS-1 cross-links, cleavage
at 970 and other positions between 970 and 1281 (data not
shown) yields a minor N-terminal product and a strongly
labeled C-terminal product, mapping this minor BP+2
cross-link between 871 and 970. In summary the contacts
between Prp8 and BP+2 map to three distinct regions of the
protein, essentially identical to the 5¢SS-1 cross-linking
pattern: 871–970, 1281–1471, and 1503–1673. However the
relative intensities of labeling of the three regions differ be-
tween 5¢SS- and BP-derived cross-links.
DISCUSSION
The proteolytic mapping analysis presented here gives us a
detailed picture of multiple Prp8–RNA contacts in snRNPs
and spliceosomes (summarized in Fig. 5). The RNA con-
tacts that we have mapped are restricted to the central
region of Prp8. This contrasts neatly with existing protein
interaction data for Prp8 that indicate multiple protein
binding sites concentrated near the N and C termini (for
review, see Grainger and Beggs 2005). It is striking that the
5¢SS and BP both make contacts with the same set of three
noncontiguous segments of Prp8. This makes sense in func-
tional terms, given that the 5¢SS and BP must necessarily be
juxtaposed for catalysis; a cross-linker in either sequence
might therefore be expected to target similar sites in a
protein closely associated with the catalytic core. In princi-
ple, these three regions of Prp8 could contact the pre-
mRNA simultaneously, or they might do so sequentially
in different functional states of the spliceosome. Our anal-
ysis of the chronology of splicing reactions showed that
5¢SS cross-link formation correlates well with the catalytic
steps of splicing (data not shown) but has not revealed clear
differences in cross-linking kinetics between the three
regions of Prp8. Therefore 5¢SS contacts with a triad of
discrete segments of Prp8 may instead reflect the tertiary
fold of the protein around the spliceosome’s RNA core.
Further analysis of 5¢SS and BP cross-links to Prp8 will be
essential to demonstrate the functional significance of the
Prp8–RNA interactions underlying the complex pattern of
cross-links. In particular it will be crucial to establish the
relationship between individual Prp8–substrate contacts
and the catalytic steps of splicing. In any case it is interest-
ing to note that two of the segments of Prp8 that harbor
5¢SS/BP cross-links also contact invariant residues in U5
and U6 snRNAs in reconstituted snRNP and tri-snRNP
particles, respectively (Fig. 5). This is potentially significant
since these U5 and U6 residues—U97 in the U5 snRNA
Loop 1 and U54 in U6 snRNA—are believed to be close to
www.rnajournal.org 381
RNA interactions of splicing factor Prp8
the 5¢SS (and BP) in active spliceosomes (Newman and
Norman 1992; Kandels-Lewis and Seraphin 1993; Lesser
and Guthrie 1993; Sontheimer and Steitz 1993). This may
indicate that some Prp8 interactions with U5 and U6 resi-
dues in tri-snRNPs survive the conformational changes that
accompany spliceosome activation.
There is a discrepancy between the cross-link mapping
data presented here and the result of an earlier study of the
RNA interactions of hPrp8 (Reyes et al. 1999). These
authors used a classical chemical and enzymatic fragmenta-
tion strategy to precisely map a cross-link between hPrp8
and the conserved 5¢SS GU within splicing complex B in
HeLa cell extract. The data placed the
cross-link near the C terminus of hPrp8,
in a five-residue sequence correspond-
ing to amino acids 1966–1970 in yeast
Prp8; surprisingly this sequence is not
conserved from human to yeast. As dis-
cussed above, in yeast spliceosomes all
the cross-links generated using the 5¢SS-
1 and BP+2 cross-linkers mapped up-
stream of 1673 in Prp8. Furthermore
all the cross-links from a photocross-
linker placed at 5¢SS+2 (position 2 of
the intron) also mapped upstream of
1673, including one in the 1503–1673
region colocalized with cross-links to
5¢SS-1, BP+2, and U6 [U54] (data not
shown). In addition preliminary map-
ping of cross-links from a photocross-
linker placed at the 3¢SS also showed
that all detectable cross-links were up-
stream of position 1726 in Prp8 (data
not shown). Given that a great deal
of evidence (for review, see Collins and
Guthrie 2000) suggests that the orga-
nization of the yeast and human cata-
lytic cores is substantially similar, and
that the hPrp8 and yPrp8 orthologs are
so closely related (Grainger and Beggs
2005), it seems unlikely that there
would be major differences between
Prp8–spliceosomal core interactions in
the two systems. It is possible that the
Prp8–5¢SS contact mapped in the Hela
system (Reyes et al. 1999) derives from
a conformation of the spliceosome that
is not prevalent in the yeast system. It
will be interesting to see if blocking
yeast spliceosomes at specific points in
the process traps additional contacts
between the 5¢SS and Prp8.
Three recognized functional domains
have so far been identified in Prp8 by
bio-informatic analysis (Grainger and
Beggs 2005): a nuclear localization signal (NLS) sequence
near the N terminus, an RRM (residues 1059–1151), and an
Mpr1 Pad1 N-terminal domain (MPN; residues 2173–
2310) that is related to Jab1/MPN domains found in some
de-ubiquitinating enzymes. Unexpectedly we isolated func-
tional prp8 alleles with TEV protease site insertions at
1096 and 1102 within the RRM. However, closer examina-
tion of the RRM and its secondary structure shows that
these inserts fall within loop 3 of the RRM fold, which is
highly variable in known RNA-binding RRM domains
(Varani and Nagai 1998). Therefore these insertions
do not rule out an RNA-binding function for Prp8’s
FIGURE 5. TEV protease mapping data for Prp8, showing the regions of the protein that
cross-link to crucial snRNA and pre-mRNA residues. The TEV protease sites used for mapping
RNA cross-links in Prp8 are indicated. Colored bars indicate regions where RNA cross-links
reside, connected to the originating 4-thioU cross-linker by colored lines. U5 cross-links
originate in U5 snRNPs, U6 cross-links from U4/U6.U5 tri-snRNPs, and the 5¢SS and BS
cross-links originate in spliceosomes. U5 snRNA is omitted from the spliceosome structure
(shown below the Prp8 primary structure cartoon) for clarity. (RRM) putative RNA recogni-
tion motif (Grainger and Beggs 2005). (MPN) Mpr-1, Pad-1, N-terminal domain. The 5¢SS
cross-link mapped in hPrp8 is also indicated (5¢SS XL; residues 1966–1970). Region 3.2 is
linked genetically to 3¢SS suppression (Umen and Guthrie 1996), and the region labeled 5¢SS/
3¢SS/BP is linked genetically to the transition between first and second catalytic step conforma-
tions of the spliceosome (Query and Konarska 2004).
382 RNA, Vol. 12, No. 3
Turner et al.
Fig.5 live 4/c
RRM; the nine-residue Loop 3 predicted in Prp8 may
simply be extended without compromising RRM function.
A similar situation may apply to the MPN domain (2173–
2310): Three TEV insertions fall within this domain, but
again they map to a variable region (Tran et al. 2003;
Grainger and Beggs 2005) and therefore may not affect
the domain’s structure or function. At present it is not
possible to ascribe specific functions to the MPN and
RRM domains in Prp8. It is clear that all the RNA contacts
that we have characterized so far lie outside the RRM, so
perhaps this domain binds other RNA sequences or simply
fails to cross-link to the pre-mRNA and snRNA positions
that we have surveyed so far. Some RRM domains have
been shown to bind proteins (Kielkopf et al. 2001; Selenko
et al. 2003), but the Prp8 RRM does not appear to match
the features that are proposed to define protein-binding
RRM domains (Kielkopf et al. 2004).
Prp8 has been widely studied using a variety of genetic
approaches and the sequence is now extensively annotated
(Grainger and Beggs 2005). In addition to genetic interac-
tions with U4 and U6 snRNAs (Kuhn et al. 1999, 2002; Kuhn
and Brow 2000) multiple prp8 alleles can suppress the effects
of both 5¢SS and 3¢SS mutations (Collins and Guthrie 1999;
Siatecka et al. 1999), suggesting that Prp8 affects the function
of the spliceosome’s catalytic center. In fact the same SS
suppressor alleles can also act as suppressors of BP muta-
tions, so all three substrate sequences involved in the catalysis
of splicing interact genetically with PRP8 (Query and
Konarska 2004). In principle, suppression of SS/BP muta-
tions could reflect altered direct contacts between Prp8 and
SS or BP nucleotides. However, the large number and scat-
tered distribution of SS/BP suppressor alleles of prp8 and the
broad spectrum of mutations that are suppressed are more
compatible with a model of suppression in which the sec-
ond-step core catalytic structure is selectively stabilized,
resulting in enhanced catalysis of the second step of splicing
(Query and Konarska 2004). In this scenario the sites of prp8
SS/BP suppressor mutations may be more or less remote
from the Prp8 sequences that actually contact the catalytic
core RNAs. This would place a premium on biochemical
data of the sort we have presented here for 5¢SS and BP RNA
interactions with Prp8 in spliceosomes: Such information
may identify regions of Prp8 that directly contact the sites
of chemistry (Collins and Guthrie 2000). Currently the best
candidate ‘‘domain’’ for splicing cofactor activity is the
region defined by the TEV protease sites at 1503 and 1673.
This interval is the site of cross-links from nucleotide U54 in
U6 snRNA, as well as 5¢SS-1, 5¢SS+2 and BP+2 cross-linkers
in the pre-mRNA (Figs. 2–4; data not shown). It also corre-
sponds closely to a region of exceptional sequence conserva-
tion (region 3.2, 1547–1660; Grainger and Beggs 2005) that
includes a dense cluster of 3¢SS suppressor mutations (Umen
and Guthrie 1996). It will be interesting to analyze the inter-
actions of catalytic core RNAs with this crucial segment of
Prp8 in more detail.
MATERIALS AND METHODS
Transposon construction
Complementary oligonucleotides AW42 GATCCTGTCTCTTAT
ACACATCTGGCGCGCCGTAGAAAATTTATATTTTCAAGGAG
ATGTGTATAAGAGACAG and AW43 GATCCTGTCTCTTATAC
ACATCTCCTTGAAAATATAAATTTTCTACGGCGCGCCAGATG
TGTATAAGAGACAG were 5¢-phosphorylated, annealed to-
gether, and inserted into the BamHI site of pBluescript KS+
(Stratagene). This synthetic insert encodes the TEV protease cleav-
age sequence ENLYFQG and an AscI site, flanked by the ‘‘Outer
End’’ recognition sequences for Tn5 transposase (Goryshin and
Reznikoff 1998). To follow transposition reaction products, a
removable kanamycin resistance cassette (Kan) was then inserted
at the unique AscI site in the TEV transposon. The complete TEV
[Kan] transposon including the kanamycin resistance cassette was
then amplified by PCR using primers FTA1 CCCTCGAGGTCG
ACGGTATCG and RTA1 ATAGGGCGAATTGGAGCTCCA spe-
cific for sequences flanking the transposon.
Random insertion of TEV protease sites into Prp8
For random insertion of TEV [Kan] transposons into the entire
ORF, the target DNA was pRS314, carrying a 9.6-Kb yeast genomic
DNA fragment including the PRP8 coding sequence plus 5¢and 3¢
flanking sequences. Unique sites for NheI and MluI were first
introduced at the 5¢and 3¢ends of the PRP8 ORF by site-directed
mutagenesis (Kunkel 1985) and a Protein A epitope tag was inserted
at the N terminus. Target DNA (1 mg) was incubated in a 10 mL
reaction with a molar equivalent of the TEV [Kan] transposon in
the presence of 0.1 U/mLEZ<TN transposase (Epicentre) at 37C
for 2 h according to the manufacturer’s instructions. The reaction
was stopped by addition of 1 mL 1% SDS followed by heating to
70C for 10 min. Aliquots (1 mL) of the transposition reaction were
transformed by electroporation into XL10 Gold cells (Stratagene),
and plasmids that had been targeted by the transposon were recov-
ered by selection for ampicillin and kanamycin resistance. Plasmid
DNA was prepared from pooled transformants and the PRP8 ORF
was excised by digestion with NheI and MluI, gel purified, and
recloned into NheI + MluI ‘‘gapped’’ pRS314-PRP8 vector, again
selecting for ampicillin and kanamycin resistance. Plasmid DNA
was prepared from pooled transformants, to produce a plasmid
library in which each individual carries a TEV (Kan) transposon
inserted at random somewhere in the PRP8 ORF.
An aliquot of the plasmid library was digested with AscI to excise
the kanamycin resistance cassette, and the linearized plasmid was
gel purified, recircularized by ligation, and transformed by electro-
poration into XL10 Gold cells, this time selecting for ampicillin
resistance. Plasmid DNA was prepared from the pooled cells, giving
a library of pRS314-PRP8 plasmids, each carrying a 69-bp insert
placed at random in the ORF, marked by a unique AscI site. Five of
the six possible reading frames for TEV transposon insertion are
closed by stop codons in the transposon itself. The single open
reading frame introduces a short, internal peptide tag (LSLIHIW
RAVENLYFQGDVYKRQ) that includes the cleavage sequence
for TEV protease (ENLYFQ/G, where / denotes the site of cleavage).
Functional copies of prp8 were identified by plasmid shuffle on
plates containing 5-FOA after transformation into the yeast strain
www.rnajournal.org 383
RNA interactions of splicing factor Prp8
SC261D8B1 (Mataura3–52 leu2 trp1 pep4–3prb1–1132 prc1–407
prp8<Blasticidin [pRS316-PRP8]). The location of each TEV protease
site was determined by restriction mapping and DNA sequencing.
Site-specific labeling and ligation of snRNAs
and pre-mRNAs
U6 snRNA with a single
32
P label and adjacent 4-thioU or U at
position 54 was made by ligation with T4 DNA ligase (Moore and
Sharp 1992) using the following components: U6 (1–53), 5¢-[
32
P]-
U6 (54–77), U6 (78–112), and antisense bridge oligonucleotide
GTAAAACGGTTCATCCTTATGCAGGGGAACTGCTGATCATC
TCTGTATTGTTTC. U6 (1–53) was made by T7 transcription and
ribozyme cleavage using a construct containing U6 (1–53)
embedded between hammerhead and hepatitis delta ribozymes.
U6 (54–77) and U6 (78–112) are synthetic RNAs, the latter with
an unlabeled 5¢phosphate added during synthesis.
U5 snRNA with a single
32
P label and adjacent 4-thioU or U at
position 97 was made by ligation with T4 DNA ligase using the
following components: U5 (97–112), U5 (113–215), and anti-
sense bridge oligonucleotide TCTATGGAGACAACACCCGGAT
GGTTCTGGTAAA. U5 (97–112) was a synthetic RNA, and U5
(113–215) was made by T7 transcription primed with GMP to
introduce an unlabeled 5¢phosphate. The ligated U5 (97–215)
RNA was gel purified, 5¢-[
32
P]-phosphorylated, and ligated to a
T7 transcript comprising U5 (1–96) using T4 RNA ligase (New
England Biolabs; final concentration 1 U/mL).
Actin pre-mRNA with a single
32
P label and adjacent 4-thioU or
Uat5¢SS-1 was made by ligation with T4 DNA ligase using the
following components: actin (1–20), actin (21–37), actin (38–
exon 2), and antisense bridge oligonucleotide TCTTACAGTTAAA
TGGGATGGTCCAAGCGCTAGAACATACAAGAATCCATTGTT
AATTCAG. Actin (1–20) is a synthetic RNA exon 1 sequence
(CUGAAUUAACAAUGGAUUCU) extending to nucleotide 5¢SS-
2. Actin (21–37) (UGUAUGUUCUAGCGCUU) begins with 4-
thioU or U and was 5¢-[
32
P]-phosphorylated. Actin (38–exon 2)
is a T7 transcript initiating at intron position 17 and extending
through the intron into exon 2; T7 transcription was primed with
GMP to introduce an unlabeled 5¢phosphate.
Actin pre-mRNA with a single
32
P label and adjacent 4-thioU or U
at BP+2 was made by ligation with T4 DNA ligase using the following
components: actin (1–283), actin (284–325), actin (326–exon 2), and
antisense bridge oligonucleotide CCAAAGCAGCAACCACTAAAC
ATATAATATAGCAACAAAAAGAATGAAGCAATCGAAGTTAGT
ACATGAGAC. Actin (1–283) was made by T7 transcription and
ribozyme cleavage using a construct containing actin sequences
extending from exon 1 to the final C of the TACTAAC branch point
sequence, upstream of a hepatitis delta ribozyme. Actin (284–325)
(UUCGAUUGCUUCAUUCUUUUUGUUGCUAUAUUAUAUGU
UUAG) begins with 4-thioU or U and was 5¢-[
32
P]-phosphorylated
prior to ligation. Actin (326–exon 2) (UGGUUGCUGCUUUGGUU
AUUG AUAAC) has an unlabeled 5¢phosphate.
U5 and U6 snRNP depletion and reconstitution
methods
U5 snRNP reconstitution was performed essentially as described
(O’Keefe and Newman 1998) using splicing extracts from shuffled
derivatives of the yeast strain SC261.35 (Mataura3–52 leu2 trp1
pep4–3prb1–1132 prc1–407 snr7-rok8 prp8<Blasticidin [pRS316-
PRP8]), in which the genomic copy of the SNR7 gene encoding
U5 snRNA was modified by introduction of a 30-nt insertion into
the sequence encoding stem 1 of U5 snRNA. The modified form of
U5 allows targeted depletion and functional reconstitution of U5
snRNPs (O’Keefe et al. 1996). This snr7 mutant proved to be
synthetically lethal with certain TEV-site-tagged prp8 alleles, so in
these cases reconstitution of U5 snRNPs was achieved by treatment
of extracts from SNR7 shuffle strains with RNase A (final concen-
tration 0.5 ng/mL) at 37C for 30 min, followed by addition of 10
mM DTT, RNasin (final concentration 1 U/mL) and site-specifically
labeled U5 snRNA (final concentration 1 nM). The RNase H and
RNase A-mediated depletion methods were used in parallel on
several splicing extracts containing TEV-site-tagged Prp8; both
methods produced identical TEV cleavage mapping information
for U5 Loop-Prp8 cross-links (data not shown). U6 snRNP deple-
tion and reconstitution was performed using a modification
(R.J. Lin, pers. comm.) of the original method (Fabrizio et al.
1989) as follows: Extracts were incubated under splicing conditions
for 30 min at 30C in the presence of 1 mM d1 oligonucleotide
(CTGTATTGTTTCAAA). Anti-d1 oligonucleotide (TTTGAAA
CAATACAG) was added (final concentration 1 mM), and the reac-
tion was incubated at 30C for 5 min before addition of site-
specifically labeled U6 snRNA (final concentration 1 nM).
RNA–protein cross-linking and cross-link analysis
Splicing extracts were prepared from selected shuffled strains (Lin et
al. 1985) expressing TEV transposon-tagged versions of Prp8, and
these were shown to have normal splicing activity using actin pre-
mRNA as substrate (data not shown). For detection and mapping of
RNA–protein cross-links from specific 4-thioU residues in the pre-
mRNA, splicing reactions (Lin et al. 1985) were assembled on ice,
typically containing 0.2 pmol pre-mRNA in a 200-mLreaction.
Splicing reactions were typically incubated at 23C for 5–10 min
and UV irradiated (365 nm UV) at 4Cfor5min(ModelB100AP
lamp; UV Products). The reaction was diluted 10-fold in IP150 buffer
(10 mM Tris-Cl at pH 8.0, 150 mM NaCl, 0.1% Nonidet NP40) and
incubated with gentle mixing at 4Cfor2hwith10mL IgG-sephar-
ose beads (Pharmacia) to capture complexes containing Prp8. The
beads were washed twice with cold IP150 buffer and twice with 13
TEV buffer (50 mM Tris-Cl at pH 8.0, 0.5 mM EDTA, 5 mM DTT)
and resuspended in 100 mL13TEV buffer. This sample was divided
into two aliquots, 1 mL TEV protease (Invitrogen; 10 U/mL) was
added to one aliquot, and the samples were incubated for 16–40 h at
18C. Digestions with PreScission Protease (Amersham Biosciences,
2U/mL) were performed likewise in 13TEV buffer. Following
protease cleavage, 2 mL RNase T1 (Merck; 10 U/mL) were added
and the samples were incubated at 37C for 1 h. The IgG-sepharose
beads were washed twice in cold IP150 buffer, and proteins were
eluted from the beads in 10 mL LDS sample buffer for 2 min at 90C.
Proteins were fractionated by 3%–8% or 4%–12% SDS-PAGE
(Novex Gels; Invitrogen) and visualized by phosphorimaging.
ACKNOWLEDGMENTS
We thank Adam Wilkinson for his contributions to transposon
design and construction. We also thank Kiyoshi Nagai, Hugh
384 RNA, Vol. 12, No. 3
Turner et al.
Pelham, Jean Beggs, Richard Grainger, and Daniel Pomeranz-
Krummel for comments on the manuscript. This work was sup-
ported by the MRC.
Received September 13, 2005; accepted November 23, 2005.
REFERENCES
Boulanger, S.C., Belcher, S.M., Schmidt, U., Dib-Hajj, S.D., Schmidt,
T., and Perlman, P.S. 1995. Studies of point mutants define three
essential paired nucleotides in the domain 5 substructure of a
group II intron. Mol. Cell. Biol. 15: 4479–4488.
Chiara, M.D., Gozani, O., Bennett, M., Champion-Arnaud, P.,
Palandjian, L., and Reed, R. 1996. Identification of proteins that
interact with exon sequences, splice sites, and the branchpoint
sequence during each stage of spliceosome assembly. Mol. Cell.
Biol. 16: 3317–3326.
Chiara, M.D., Palandjian, L., Feld Kramer, R., and Reed, R. 1997.
Evidence that U5 snRNP recognizes the 3¢splice site for catalytic
step II in mammals. EMBO J. 16: 4746–4759.
Collins, C.A. and Guthrie, C. 1999. Allele-specific genetic interactions
between Prp8 and RNA active site residues suggest a function for
Prp8 at the catalytic core of the spliceosome. Genes & Dev. 13:
1970–1982.
———. 2000. The question remains: Is the spliceosome a ribozyme?
Nat. Struct. Biol. 7: 850–854.
Cortes, J.J., Sontheimer, E.J., Seiwert, S.D., and Steitz, J.A. 1993. Muta-
tions in the conserved loop of human U5 snRNA generate use of
novel cryptic 5¢splice sites in vivo. EMBO J. 12: 5181–5189.
Dix, I., Russell, C.S., O’Keefe, R.T., Newman, A.J., and Beggs, J.D.
1998. Protein–RNA interactions in the U5 snRNP of Saccharo-
myces cerevisiae.RNA 4: 1675–1686.
Fabrizio, P., McPheeters, D.S., and Abelson, J. 1989. In vitro assembly
of yeast U6 snRNP: A functional assay. Genes & Dev. 3: 2137–2150.
Goryshin, I.Y. and Reznikoff, W.S. 1998. Tn5 in vitro transposition. J.
Biol. Chem. 273: 7367–7374.
Grainger, R.J. and Beggs, J.D. 2005. Prp8 protein: At the heart of the
spliceosome. RNA 11: 533–557.
Hilliker, A.K. and Staley, J.P. 2004. Multiple functions for the invar-
iant AGC triad of U6 snRNA. RNA 10: 921–928.
Hodges, P.E., Jackson, S.P., Brown, J.D., and Beggs, J.D. 1995. Extra-
ordinary sequence conservation of the PRP8 splicing factor. Yeast
11: 337–342.
Huppler, A., Nikstad, L.J., Allmann, A.M., Brow, D.A., and Butcher,
S.E. 2002. Metal binding and base ionization in the U6 RNA
intramolecular stem-loop structure. Nat. Struct. Biol. 9: 431–435.
Kandels-Lewis, S. and Seraphin, B. 1993. Involvement of U6 snRNA in
5¢splice site selection. Science 262: 2035–2039.
Kielkopf, C.L., Rodionova, N.A., Green, M.R., and Burley, S.K.
2001. A novel peptide recognition mode revealed by the X-ray
structure of a core U2AF35/U2AF65 heterodimer. Cell 106:
595–605.
Kielkopf, C.L., Lucke, S., and Green, M.R. 2004. U2AF homology
motifs: Protein recognition in the RRM world. Genes & Dev. 18:
1513–1526.
Kim, D.H. and Rossi, J.J. 1999. The first ATPase domain of the yeast
246-kDa protein is required for in vivo unwinding of the U4/U6
duplex. RNA 5: 959–971.
Kuhn, A.N. and Brow, D.A. 2000. Suppressors of a cold-sensitive
mutation in yeast U4 RNA define five domains in the splicing factor
Prp8 that influence spliceosome activation. Genetics 155: 1667–1682.
Kuhn, A.N., Li, Z., and Brow, D.A. 1999. Splicing factor Prp8 governs
U4/U6 RNA unwinding during activation of the spliceosome. Mol.
Cell 3: 65–75.
Kuhn, A.N., Reichl, E.M., and Brow, D.A. 2002. Distinct domains of
splicing factor Prp8 mediate different aspects of spliceosome acti-
vation. Proc. Natl. Acad. Sci. 99: 9145–9149.
Kunkel, T.A. 1985. Rapid and efficient site-specific mutagenesis with-
out phenotypic selection. Proc. Natl. Acad. Sci. 82: 488–492.
Laggerbauer, B., Achsel, T., and Luhrmann, R. 1998. The human U5–
200kD DEXH-box protein unwinds U4/U6 RNA duplices in vitro.
Proc. Natl. Acad. Sci. 95: 4188–4192.
Lesser, C.F. and Guthrie, C. 1993. Mutations in U6 snRNA that alter
splice site specificity: Implications for the active site. Science 262:
1982–1988.
Lin, R.J., Newman, A.J., Cheng, S.C., and Abelson, J. 1985. Yeast
mRNA splicing in vitro. J. Biol. Chem. 260: 14780–14792.
Luo, H.R., Moreau, G.A., Levin, N., and Moore, M.J. 1999. The
human Prp8 protein is a component of both U2- and U12-depen-
dent spliceosomes. RNA 5: 893–908.
Madhani, H.D. and Guthrie, C. 1992. A novel base-pairing interaction
between U2 and U6 snRNAs suggests a mechanism for the catalytic
activation of the spliceosome. Cell 71: 803–817.
Maroney, P.A., Romfo, C.M., and Nilsen, T.W. 2000. Functional
recognition of 5¢splice site by U4/U6.U5 tri-snRNP defines a
novel ATP-dependent step in early spliceosome assembly. Mol.
Cell 6: 317–328.
McPheeters, D.S. and Muhlenkamp, P. 2003. Spatial organization of
protein–RNA interactions in the branch site-3¢splice site region
during pre-mRNA splicing in yeast. Mol. Cell. Biol. 23: 4174–
4186.
Moore, M.J. and Sharp, P.A. 1992. Site-specific modification of pre-
mRNA: The 2¢-hydroxyl groups at the splice sites. Science 256:
992–997.
———. 1993. Evidence for two active sites in the spliceosome pro-
vided by stereochemistry of pre-mRNA splicing. Nature 365:
364–368.
Newman, A.J. and Norman, C. 1992. U5 snRNA interacts with exon
sequences at 5¢and 3¢splice sites. Cell 68: 743–754.
Newman, A.J., Teigelkamp, S., and Beggs, J.D. 1995. snRNA interac-
tions at 5¢and 3¢splice sites monitored by photoactivated cross-
linking in yeast spliceosomes. RNA 1: 968–980.
O’Keefe, R.T. and Newman, A.J. 1998. Functional analysis of the U5
snRNA loop 1 in the second catalytic step of yeast pre-mRNA
splicing. EMBO J. 17: 565–574.
O’Keefe, R.T., Norman, C., and Newman, A.J. 1996. The invariant U5
snRNA loop 1 sequence is dispensable for the first catalytic step of
pre-mRNA splicing in yeast. Cell 86: 679–689.
Padgett, R.A., Podar, M., Boulanger, S.C., and Perlman, P.S. 1994. The
stereochemical course of group II intron self-splicing. Science 266:
1685–1688.
Parker, R., Siliciano, P.G., and Guthrie, C. 1987. Recognition of the
TACTAAC box during mRNA splicing in yeast involves base pair-
ing to the U2-like snRNA. Cell 49: 229–239.
Peebles, C.L., Zhang, M., Perlman, P.S., and Franzen, J.S. 1995. Cat-
alytically critical nucleotide in domain 5 of a group II intron. Proc.
Natl. Acad. Sci. 92: 4422–4426.
Query, C.C. and Konarska, M.M. 2004. Suppression of multiple sub-
strate mutations by spliceosomal prp8 alleles suggests functional
correlations with ribosomal ambiguity mutants. Mol. Cell 14: 343–
354.
Raghunathan, P.L. and Guthrie, C. 1998. RNA unwinding in U4/U6
snRNPs requires ATP hydrolysis and the DEIH-box splicing factor
Brr2. Curr. Biol. 8: 847–855.
Reyes, J.L., Kois, P., Konforti, B.B., and Konarska, M.M. 1996. The
canonical GU dinucleotide at the 5¢splice site is recognized by
p220 of the U5 snRNP within the spliceosome. RNA 2: 213–225.
Reyes, J.L., Gustafson, E.H., Luo, H.R., Moore, M.J., and Konarska,
M.M. 1999. The C-terminal region of hPrp8 interacts with the
conserved GU dinucleotide at the 5¢splice site. RNA 5: 167–179.
Sashital, D.G., Cornilescu, G., McManus, C.J., Brow, D.A., and
Butcher, S.E. 2004. U2-U6 RNA folding reveals a group II
intron-like domain and a four-helix junction. Nat. Struct. Mol.
Biol. 11: 1237–1242.
Selenko, P., Gregorovic, G., Sprangers, R., Stier, G., Rhani, Z., Kramer,
A., and Sattler, M. 2003. Structural basis for the molecular recog-
www.rnajournal.org 385
RNA interactions of splicing factor Prp8
nition between human splicing factors U2AF65 and SF1/mBBP.
Mol. Cell 11: 965–976.
Shevchenko, Y., Bouffard, G.G., Butterfield, Y.S., Blakesley, R.W.,
Hartley, J.L., Young, A.C., Marra, M.A., Jones, S.J., Touchman,
J.W., and Green, E.D. 2002. Systematic sequencing of cDNA clones
using the transposon Tn5. Nucleic Acids Res. 30: 2469–2477.
Siatecka, M., Reyes, J.L., and Konarska, M.M. 1999. Functional inter-
actions of Prp8 with both splice sites at the spliceosomal catalytic
center. Genes & Dev. 13: 1983–1993.
Sigel, R.K., Vaidya, A., and Pyle, A.M. 2000. Metal ion binding sites in
a group II intron core. Nat. Struct. Biol. 7: 1111–1116.
Sontheimer, E.J. and Steitz, J.A. 1993. The U5 and U6 small nuclearRNAs
as active site components of the spliceosome. Science 262: 1989–1996.
Sun, J.S. and Manley, J.L. 1995. A novel U2-U6 snRNA structure is
necessary for mammalian mRNA splicing. Genes & Dev. 9: 843–854.
Teigelkamp, S., Newman, A.J., and Beggs, J.D. 1995. Extensive inter-
actions of PRP8 protein with the 5¢and 3¢splice sites during
splicing suggest a role in stabilization of exon alignment by U5
snRNA. EMBO J. 14: 2602–2612.
Tran, H.J., Allen, M.D., Lowe, J., and Bycroft, M. 2003. Structure of
the Jab1/MPN domain and its implications for proteasome func-
tion. Biochemistry 42: 11460–11465.
Umen, J.G. and Guthrie, C. 1995a. A novel role for a U5 snRNP
protein in 3¢splice site selection. Genes & Dev. 9: 855–868.
———. 1995b. Prp16p, Slu7p, and Prp8p interact with the 3¢splice
site in two distinct stages during the second catalytic step of pre-
mRNA splicing. RNA 1: 584–597.
———. 1996. Mutagenesis of the yeast gene PRP8 reveals domains
governing the specificity and fidelity of 3¢splice site selection.
Genetics 143: 723–739.
Valadkhan, S. and Manley, J.L. 2001. Splicing-related catalysis by
protein-free snRNAs. Nature 413: 701–707.
van Nues, R.W. and Beggs, J.D. 2001. Functional contacts with a range
of splicing proteins suggest a central role for Brr2p in the dynamic
control of the order of events in spliceosomes of Saccharomyces
cerevisiae.Genetics 157: 1451–1467.
Varani, G. and Nagai, K. 1998. RNA recognition by RNP proteins
during RNA processing. Annu. Rev. Biophys. Biomol. Struct. 27:
407–445.
Vidal, V.P., Verdone, L., Mayes, A.E., and Beggs, J.D. 1999. Character-
ization of U6 snRNA–protein interactions. RNA 5: 1470–1481.
Villa, T., Pleiss, J.A., and Guthrie, C. 2002. Spliceosomal snRNAs:
Mg(2+)-dependent chemistry at the catalytic core? Cell 109: 149–
152.
Wu, J. and Manley, J.L. 1989. Mammalian pre-mRNA branch site
selection by U2 snRNP involves base pairing. Genes & Dev. 3:
1553–1561.
Wyatt, J.R., Sontheimer, E.J., and Steitz, J.A. 1992. Site-specific
cross-linking of mammalian U5 snRNP to the 5¢splice site
before the first step of pre-mRNA splicing. Genes & Dev. 6:
2542–2553.
Yean, S.L., Wuenschell, G., Termini, J., and Lin, R.J. 2000. Metal-ion
coordination by U6 small nuclear RNA contributes to catalysis in
the spliceosome. Nature 408: 881–884.
386 RNA, Vol. 12, No. 3
Turner et al.
