Content uploaded by Ana R Coelho
Author content
All content in this area was uploaded by Ana R Coelho on Sep 01, 2017
Content may be subject to copyright.
*For correspondence: l.dong@
griffith.edu.au (L-FD); mberridge@
malaghan.org.nz (MVB);j.neuzil@
griffith.edu.au (JN)
Competing interests: The
authors declare that no
competing interests exist.
Funding: See page 13
Received: 09 October 2016
Accepted: 13 February 2017
Published: 15 February 2017
Reviewing editor: Ralph
DeBerardinis, UT Southwestern
Medical Center, United States
Copyright Dong et al. This
article is distributed under the
terms of the Creative Commons
Attribution License, which
permits unrestricted use and
redistribution provided that the
original author and source are
credited.
Horizontal transfer of whole mitochondria
restores tumorigenic potential in
mitochondrial DNA-deficient cancer cells
Lan-Feng Dong
1
*, Jaromira Kovarova
2
, Martina Bajzikova
2
,
Ayenachew Bezawork-Geleta
1
, David Svec
2
, Berwini Endaya
1
,
Karishma Sachaphibulkij
1
, Ana R Coelho
2,3
, Natasa Sebkova
2,4
, Anna Ruzickova
2
,
An S Tan
5
, Katarina Kluckova
2
, Kristyna Judasova
2
, Katerina Zamecnikova
2,6
,
Zuzana Rychtarcikova
2,7
, Vinod Gopalan
1,8
, Ladislav Andera
2
, Margarita Sobol
9
,
Bing Yan
1
, Bijay Pattnaik
10
, Naveen Bhatraju
10
, Jaroslav Truksa
2
, Pavel Stopka
4
,
Pavel Hozak
9
, Alfred K Lam
8
, Radislav Sedlacek
9
, Paulo J Oliveira
3
,
Mikael Kubista
2,11
, Anurag Agrawal
10
, Katerina Dvorakova-Hortova
2,4
,
Jakub Rohlena
2
, Michael V Berridge
5
*, Jiri Neuzil
1,2
*
1
School of Medical Science, Griffith University, Southport, Australia;
2
Institute of
Biotechnology, Czech Academy of Sciences, Prague, Czech Republic;
3
CNC-Center
for Neuroscience and Cell Biology, University of Coimbra, Cantanhede, Portugal;
4
Department of Zoology, Faculty of Science, Charles University, Prague, Czech
Republic;
5
Malaghan Institute of Medical Research, Wellington, New Zealand;
6
Zittau/Goerlitz University of Applied Sciences, Zittau, Germany;
7
Faculty of
Pharmacy, Charles University, Hradec Kralove, Czech Republic;
8
School of Medicine,
Griffith University, Southport, Australia;
9
Institute of Molecular Genetics, Czech
Academy of Sciences, Prague, Czech Republic;
10
CSIR Institute of Genomics and
Integrative Biology, New Delhi, India;
11
TATAA Biocenter, Gothenburg, Sweden
Abstract Recently, we showed that generation of tumours in syngeneic mice by cells devoid of
mitochondrial (mt) DNA (r
0
cells) is linked to the acquisition of the host mtDNA. However, the
mechanism of mtDNA movement between cells remains unresolved. To determine whether the
transfer of mtDNA involves whole mitochondria, we injected B16r
0
mouse melanoma cells into
syngeneic C57BL/6N
su9-DsRed2
mice that express red fluorescent protein in their mitochondria. We
document that mtDNA is acquired by transfer of whole mitochondria from the host animal, leading
to normalisation of mitochondrial respiration. Additionally, knockdown of key mitochondrial
complex I (NDUFV1) and complex II (SDHC) subunits by shRNA in B16r
0
cells abolished or
significantly retarded their ability to form tumours. Collectively, these results show that intact
mitochondria with their mtDNA payload are transferred in the developing tumour, and provide
functional evidence for an essential role of oxidative phosphorylation in cancer.
DOI: 10.7554/eLife.22187.001
Introduction
Mitochondria are vital organelles of eukaryotic cells responsible for energy production and other key
biochemical functions. Many human diseases, including cancer, are characterised by mutations in
mitochondrial DNA (mtDNA). This is linked to altered mitochondrial bioenergetics, such that cancer
cells are more glycolytic than their non-malignant counterparts, as postulated almost a century ago
by Warburg. Altered energy metabolism is now regarded as one of the hallmarks of cancer
Dong et al. eLife 2017;6:e22187. DOI: 10.7554/eLife.22187 1 of 22
RESEARCH ARTICLE
(Koppenol et al., 2011;Hanahan and Weinberg, 2011;Vyas et al., 2016). In this context, the mito-
chondrial genome has been reported to play a role in tumorigenesis (Lee and St John, 2016;
Patananan et al., 2016) and in metastatic cancer (Ishikawa et al., 2008;Hayashi et al., 2016).
Although many cancer cells are biased towards the glycolytic metabolism, they also need oxida-
tive phosphorylation (OXPHOS) for their ‘pathophysiological’ requirements (Weinberg et al., 2010).
Recent research has demonstrated a new concept of cancer metabolism, emphasising the impor-
tance of OXPHOS in the tumour environment beyond its role in bioenergetics (Gentric et al., 2016).
A novel paradigm has emerged, according to which respiration is important for cancer cell prolifera-
tion, and also for tumour formation, progression and metastasis (LeBleu et al., 2014;Viale et al.,
2014). This is probably linked to metabolic re-modelling (Birsoy et al., 2015;Sullivan et al., 2015).
There are reports that some cancer cells retain OXPHOS capacity and have no obvious respiratory
defects (Frezza and Gottlieb, 2009;Jose et al., 2011). Further, inhibiting glycolysis may restore
higher rates of OXPHOS in neoplastic cells (Moreno-Sa
´nchez et al., 2007;Michelakis et al., 2010).
Hence, depriving cancer cells of their capacity to respire may preclude them from forming tumours.
We recently reported on the importance of respiration in tumour formation and progression
(Tan et al., 2015). We showed that cancer cells without mtDNA (r
0
cells) form tumours after a con-
siderable delay compared to their parental counterparts. Tumour progression was associated with
mtDNA acquisition from the host, resulting in respiration recovery. While these findings point to a
new phenomenon of horizontal transfer of mtDNA between mammalian cells in vivo
(Berridge et al., 2015,2016), direct evidence for the role of mitochondrial respiration in tumour for-
mation as well as understanding the mode of mtDNA acquisition is lacking.
Here we provide a link between efficient tumour formation and recovery of mitochondrial respira-
tion, and show that mtDNA acquisition occurs via trafficking of whole mitochondria.
Results
Cell lines derived from tumours that formed from B16r
0
cells are
homogeneous in mtDNA distribution and contain a fully assembled
respirasome
We have shown that B16r
0
cells injected subcutaneously into C57BL/6J mice formed syngeneic
tumours with a 2–3-week delay compared to B16 cells, and next generation sequencing (NGS) indi-
cated the host origin of mtDNA (Tan et al., 2015). Since NGS would not detect heteroplasmy of
less than about 3%, a much more sensitive single cell/digital droplet (sc/dd) PCR method was used
in the current study to document that the homoplasmic polymorphism at the tRNA
Arg
locus of
mtDNA of cell lines isolated from tumours grown subcutaneously from B16r
0
cells (B16r
0
SC cells) is
of the host origin. The assay is able to detect heteroplasmy down to 0.5%, demonstrating with very
high confidence that the mtDNA in B16r
0
SC cells is of host origin, and that original B16 polymor-
phism is either completely absent or present below the detection limit of 0.5% of mtDNA
(Figure 1A; see also Appendix 1—figure 1 for validation of sc/ddPCR).
We next analysed the properties of B16, B16r
0
and B16r
0
SC cells, as well as a B16r
0
CTC sub-
line derived from circulating tumor cells and a B16r
0
SCL sub-line derived from lung metastases
(Tan et al., 2015). Appendix 1–figure 2A documents confocal microscopy analysis of mtDNA in
mitochondria, showing that B16r
0
cells lack mtDNA, whereas mtDNA appears homogeneously dis-
tributed in mitochondria in all other sub-lines. Super-resolution stimulated emission depletion (STED)
microscopy exerted similar levels and distribution of mtDNA nucleoids in B16, B16r
0
SC, B16r
0
CTC
and B16r
0
SCL cells, and no nucleoids in B16r
0
cells, also showing largely unchanged levels of
Tom20 and low level of TFAM (Figure 1B; see also Appendix 1—figure 2E). Native blue gel electro-
phoresis (NBGE) revealed that B16r
0
cells do not contain the supercomplex/respirasome (formed by
CI, CIII and CIV), but contain low amounts of sub-CV (Figure 1C). CII was found to be fully assem-
bled in all sub-lines, which is reasonable considering that all four subunits in CII are encoded by
nuclear DNA (nDNA) (Figure 1C). To test if cells replicate their mtDNA, we established the mito-
chondrial chromatin immunoprecipitation (mitoChIP) assay. This showed a high level of DNA poly-
merase-g1 (POLG1) binding to the D-LOOP region of mtDNA in all cells except B16r
0
cells
(Figure 1D). B16r
0
SC, B16r
0
CTC and B16r
0
SCL cells showed similar respiration to B16 cells, but no
respiration was observed with B16r
0
cells (Figure 1E,F). Accordingly, B16r
0
cells produced more
Dong et al. eLife 2017;6:e22187. DOI: 10.7554/eLife.22187 2 of 22
Research article Cancer Biology
Figure 1. Cells derived from B16r
o
cell-grown tumours feature mtDNA with host polymorphism, and recovered
mitochondrial complexes and respiration. (A) B16, B16r
0
and B16r
0
SC cells were assessed by sc/dd PCR for
polymorphism of the tRNA
Arg
locus of mtDNA using specific probes (see Materials and methods). The insert
shows a cell (circled) before (upper image) and after (lower image) withdrawn for analysis. (B) B16, B16r
0
, B16r
0
SC,
Figure 1 continued on next page
Dong et al. eLife 2017;6:e22187. DOI: 10.7554/eLife.22187 3 of 22
Research article Cancer Biology
lactate (Figure 1G) and less ATP (Figure 1H). B16r
0
cells also had lower succinate dehydrogenase
(SDH) (Figure 1I) and succinate quinone reductase (SQR) (Figure 1J) activity, as well as lower citrate
synthase (CS) activity (Figure 1K). Finally, we observed higher glucose uptake in B16r
0
and B16r
0
SC
cells, and lower uptake in B16r
0
SCL cells (Figure 1L). Collectively, these results document that mito-
chondrial function is already fully restored in cells derived from the primary tumour.
We next analysed cells for their mtDNA levels and expression of selected transcripts. Appen-
dix 1—figure 2B shows no mtDNA in B16r
0
cells, while mtDNA was present at similar levels in other
sub-lines. No mtDNA-encoded transcripts were present in B16r
0
cells. Their levels were low in
B16r
0
SC cells, while higher levels were seen for most transcripts in B16r
0
CTC and in B16r
0
SCL cells.
Transcripts of the assembly factor SCAFI were present at similar levels in all sub-lines, but TFAM
transcripts were low in B16r
0
cells relative to the other cells. Transcripts of nDNA genes coding for
subunits of respiratory complexes were found to be present in all cells, with some being lower in
B16r
0
cells. WB revealed that most proteins investigated were relatively abundant in all sub-lines
with LC3AII levels lower in B16r
0
cells, indicating stalled autophagy (Appendix 1—figure 2C). Inter-
estingly, although present in B16r
0
cells, many nDNA-encoded mitochondrial proteins, including
subunits of RCs, were unstable in these cells, as evidenced using cycloheximide treatment (Appen-
dix 1—figure 2D). Exceptions were SDHA and ATPb; a plausible reason is the absence of binding
partners encoded by mtDNA, which could render the ‘unassembled nDNA-encoded’ subunits unsta-
ble. In summary, these results indicate that, in contrast to 4T1 cells (Tan et al., 2015), the respiratory
function of B16 sublines is already fully recovered at the primary tumour stage.
Recovery of B16r
0
cell respiration fully restores their propensity to
form tumours
Given the rapid recovery of respiratory function in the B16 model, we next tested tumour-forming
capacity of B16 and B16r
0
cells, and of the sub-lines B16r
0
SC, B16r
0
CTC and B16r
0
SCL, derived
from various tumour stages as described above. We found that all sub-lines formed tumours without
delay except for B16r
0
cells with >2 week delay (Figure 2A). Sectioning of tumours derived from all
five sub-lines revealed melanomas with necrotic cells away from blood vessels (Figure 2B). Tumours
derived from the sub-lines were assessed by NBGE, identifying full assembly of all complexes as well
as the respirasome, with somewhat higher levels of the respirasome in tumours derived from B16r
0
cells (Figure 2C). WB revealed similar levels of expression of most proteins tested in the five types
of tumours (Figure 2D). No obvious differences in the expression of genes coding for transcripts of
individual subunits of mitochondrial complexes encoded by mtDNA and nDNA were observed
(Figure 2E). Finally, we tested respiration of tumour tissues derived from the sub-lines. Figure 2F
reveals increased CI-dependent respiration and the maximum electron transfer capacity (ETS) in
tumours derived from B16r
0
and from B16r
0
SCL cells, and no change in CII-dependent respiration.
Normal liver tissue from the same animals used as internal control showed no changes in respiration.
The restoration of the tumorigenic potential fully correlates with the observed recovery of
respiration.
Figure 1 continued
B16r
0
CTC and B16r
0
SCL cells were immunostained for anti-DNA (red) and anti-Tom20 or anti-TFAM IgGs (green).
The upper panels represent lower resolution confocal images depicting a major part of a whole cell, the lower
panels represent higher magnification STED images of the region of interest indicted by the yellow box. (C) Cells
as above were subjected to NBGE followed by WB using antibodies against subunits of individual complexes.
Below is a densitographic evaluation of three gels derived from individual experiments with HSP60 as the internal
control. The cells were assessed for binding of POLG1 to the D-LOOP region of mtDNA using the mitoChIP assay
(D), for routine respiration (E) and for respiration via CI and CII following their permeabilisation (F). The sub-lines
were next assessed for lactate generation (G), ATP level (H), SDH (I), SQR (J) and CS activities (K) as well as for
glucose uptake (L). The symbol ‘*’ indicates statistically significant differences between individual sublines and B16
cells, the symbol ‘#’ in panel C indicates statistically significant difference between individual sublines and B16r
0
cells. The nature of the individual sublines derived from B16r
0
cells is as follows: B16r
0
SC cells, cells derived from
primary tumour grown in B57BL mice grafted with B16r
0
cells; B16r
0
CTC cells, the corresponding circulating
tumour cells; B16r
0
SCL cells, the corresponding cells isolated from lung metastases.
DOI: 10.7554/eLife.22187.002
Dong et al. eLife 2017;6:e22187. DOI: 10.7554/eLife.22187 4 of 22
Research article Cancer Biology
Figure 2. B16r
0
cells form tumours with a delay and with fully assembled respirasome. (A) B16, B16r
0
, B16r
0
SC, B16r
0
CTC and B16r
0
SCL cells were
grafted in C57BL/6J mice (10
6
cells per animal; 6 mice per group), and tumor growth was evaluated using USI. (B) Tumours derived from individual sub-
lines were fixed and sectioned, and inspected following H and E staining. (C) Individual tumours were subjected to NBGE followed by WB to visualize
mitochondrial SCs and RCs. SDS-PAGE followed by WB with antibodies to subunits of mitochondrial RCs and other proteins was used to assess their
Figure 2 continued on next page
Dong et al. eLife 2017;6:e22187. DOI: 10.7554/eLife.22187 5 of 22
Research article Cancer Biology
Suppression of respiration interferes with efficient tumour formation
We have shown for B16 cells (Figures 1 and 2,Appendix 1—figure 2) and previously for 4T1 cells
(Tan et al., 2015) that tumour formation from their respective r
0
variants correlates with
the acquisition of mtDNA and recovery of respiration. However, direct evidence for the requirement
of respiration for tumour formation has been missing. We therefore prepared B16 and B16r
0
cells
with suppressed levels of NDUFV1 (the catalytic subunit of CI) or SDHC (ubiquinone-binding CII sub-
unit essential for its SQR activity) by RNA interference (RNAi) using two different shRNAs for each
protein. Figure 3A shows that NDUFV1 shRNA#2 and SDHC shRNA#2 were rather efficient in knock-
ing down the respective proteins. Figure 3A also reveals that NDUFV1 knock-down (KD) cells exhibit
lower level of CI subunits (NDUFV1 and NDUFS3) while CII subunits (SDHA and SDHC) were unaf-
fected. Conversely, SDHC KD cells showed low levels of CII subunits and also decreased levels of CI
subunits. We used cells stably transfected with NDUFV1 shRNA#2 or SDHC shRNA#2 in subsequent
experiments. Both NDUFV1 KD and SDHC KD cells proliferated at a slower rate than parental cells
(Figure 3B). NDUFV1 KD as well as SDHC KD cells showed lower routine respiration and lower ETS
(Figure 3C). NDUFV1 KD cells respired less via CI, while CII-dependent respiration was largely unaf-
fected; SDHC KD cells not only showed much lower CII-dependent respiration, but also significantly
suppressed CI-dependent respiration (Figure 3D).
We next grafted B16, B16r
0
and B16 cells, as well as their derived NDUFV1 KD and SDHC KD
cells into C57BL/6J mice. Figure 3E shows that tumours started to grow from B16r
0
cells shortly
after day 20 post-grafting of B16r
0
cells in all mice. 4 out of 6 mice grafted with B16r
0
SDHC KD
cells formed tumours with delays of 15 to 40 days compared to B16r
0
cells. Only one out of 5 mice
of the B16r
0
NDUFV1 KD group formed a tumour, with a lag of about 40 days compared to B16r
0
cells. A similar pattern was observed for B16 cells and their NDUFV1 KD and SDHC KD variants,
though the lag for these sub-lines was considerably shorter (Figure 3F). On pathological examina-
tion of the different tumours, relatively subtle differences in morphology were observed (Figure 3G).
B16 melanoma cells form tumours in control mice (NS) showed prominent nuclear pleomorphism.
They appeared more aggressive than cells from r
0
tumours. Tumours derived from both B16
NDUFV1 KD and B16 SDHC KD cells showed better histological differentiation associated with
eosinophilic cytoplasm, vesicular nuclei and frequent deposits of melanin pigments, indicating the
KD cells are less aggressive than their parental counterpart. There were no obvious differences in
morphology of the 3 types of r
0
melanoma cells. Both B16r
0
NDUFV1 KD and B16r
0
SDHC KD
tumours showed focal areas of nuclear pleomorphism and frequent mitotic features.
These data clearly point to respiration recovery as essential for driving efficient tumour formation,
since suppression of respiration completely deregulated this process. Interestingly, while with CII
suppression the majority of mice formed tumours (albeit with additional lag time), most mice grafted
with CI-compromised cells failed to form tumours within 100 days. In summary, we show that respira-
tion is important for efficient tumour formation, which is consistent with recent reports
(Weinberg et al., 2010;Birsoy et al., 2015;Sullivan et al., 2015).
B16r
0
cells acquire mtDNA via transfer of whole mitochondria from the
host
We have previously documented the host origin of mtDNA in cancer cells isolated from primary
tumours derived from 4T1r
0
and B16r
0
cells based on NGS analysis (Tan et al., 2015), which we
confirmed here for B16r
0
SC cells using the more sensitive sc/dd PCR assay (Figure 1A). The only
plausible explanation for this phenomenon is the transfer of mtDNA from host cells to tumour cells
with compromised mtDNA. The question of how mtDNA moves between cells has not been
addressed. An attractive scenario is that whole mitochondria with their payload of mtDNA are trans-
ferred, but alternative explanations such as cell fusion have also been suggested (Vitale et al.,
Figure 2 continued
levels (D), qPCR was used to assess the levels of representative mtDNA- and nDNA-coded mRNAs (E). (F) Tumor (left) and liver tissues (right) from mice
grafted with individual B16 sub-lines were assessed for CI- and CII-dependent respiration, and for maximal uncoupled respiration (ETS, tumour only).
The symbol ‘*’ indicates statistically significant differences between tumours derived from individual sub-lines and tumours derived from B16 cells.
DOI: 10.7554/eLife.22187.003
Dong et al. eLife 2017;6:e22187. DOI: 10.7554/eLife.22187 6 of 22
Research article Cancer Biology
Figure 3. Suppression of respiration deregulates tumour growth. (A) B16 and B16r
0
cells were stably knocked down for either NDUFV1 or SDHC, or
transfected with non-silencing (NS) shRNA, and the expression of NDUFS3, NDUFV1, SDHA and SDHC was assessed by WB. The sub-lines were next
evaluated for proliferation on days 1 (D1), D2, D3 and D4 (B), for routine, leak and ETS respiration (C), and for respiration via CI and CII (D). Balb/-c
nude mice were injected s.c. with 5 10
6
B16r
0
cells as well as cells with NDUFV1 KD or SDHC KD cells (E), or with B16 cells and the derived NDUFV1
KD or SDHC KD cells (F), with six mice per group except for the NDUFV1 group with five animals. Individual mice were assessed for tumor volume
using USI. Tumours derived from B16r
0
and B16 cells were averaged and plotted as mean values, while tumours derived from knock-down cells were
plotted individually. Circles on the X-axis represent individual mice in which tumours did not form within the duration of the experiment. (G) Mice with
tumours derived from cell lines as shown in the Figure were sacrificed, and tumours fixed, sectioned and stained with H and E. The symbol ‘*’ indicates
statistically significant differences between B16 cells and NDUFV1 KD or SDHC KD cells.
DOI: 10.7554/eLife.22187.004
Dong et al. eLife 2017;6:e22187. DOI: 10.7554/eLife.22187 7 of 22
Research article Cancer Biology
2011;Maiuri and Kroemer, 2015). Mesenchymal stem cells (MSCs) have been proposed as donors
of mitochondria due to their high levels of Miro-1, which is the adaptor protein responsible for mito-
chondrial association with the microtubule mobility complex (Ahmad et al., 2014;Mills et al.,
2016). We performed co-culture of MSCs isolated from C57BL/6J mouse bone marrow with either
B16 or B16r
0
cells. Prior to co-culture, the mitochondria of the potential donor (MSC or B16) cells
were labelled with mitochondrial dark red fluorophore (MitoDR). Carboxyfluorescein succinimidyl
ester (CFSE) that binds covalently to amino acid residues inside cells was used for staining the poten-
tial recipient (B16 or B16r
0
) cells. Following co-culture, cells were assessed by confocal microscopy
to determine the extent of mitochondrial transfer to recipient cells. Representative images and
quantitative evaluation (Figure 4A,Appendix 1—figure 3A,B) reveal accumulation of MitoDR
stained mitochondria in CFSE stained r
0
cells, as a result of their transfer from MitoDR stained
MSCs. In similar experiments, pairs of either CFSE
+
B16 / MitoDR
+
MSC or CFSE
+
B16r
0
/MitoDR
+
B16
cells did not show any evidence of MitoDR stained mitochondria in CFSE positive cells, thereby
excluding dye diffusion. Collectively, this indicates that transfer of mitochondria between cells in a
regulated process.
We next conducted a co-culture experiment, in which MSCs were isolated from transgenic
C57BL/6N
su9-DsRed2
mice with red fluorescent mitochondria in somatic cells. These cells were cul-
tured with r
0
cells transfected with a plasmid coding for nuclear targeted blue fluorescence protein
(nBFP) and plasma membrane green fluorescence protein (pmGFP). Appendix 1—figure 3C docu-
ments transfer of DsRed mitochondria from MSCs into the recipient r
0
cells via an intracellular
bridge.
To investigate the origin of mtDNA and the manner of its transfer between host and cancer cells
in vivo, we used transgenic C57BL/6N
su9-DsRed2
mice with red fluorescent mitochondria in somatic
cells. B16r
0
cells transfected with a plasmid coding for nuclear-targeted blue fluorescent protein
(nBFP) were injected subcutaneously into C57BL/6N
su9-DsRed2
mice. Several days later, mice were
sacrificed, the pre-tumour lesion excised, and single cell suspension sorted for double-positive (DP)
cells with both red and blue fluorescence that on average were found with the frequency of
0.23 ±0.18 in the BFP-positive population. Immediately after sorting, B16r
0
DP cells were plated
and inspected by confocal microscopy within about 12 hr before red fluorescence in mitochondria
has been lost. Figure 4B shows an image of a B16r
0
DP cell prepared from a day 11 pre-tumour
lesion, identifying mouse stromal cells as a source of mitochondria that moved into a grafted B16r
0
cell. The sorted DP cells were established as a sub-line. B16, B16r
0
, and B16r
0
DP cells were sub-
jected to transmission electron microscopy and STED microscopy to show the presence of fully
formed mitochondrial cristae (Figure 4C) and mtDNA nucleoids in DP cells (Figure 4D). DP cells
also showed strong binding of POLG1 to the D-LOOP region of mtDNA (Figure 4E) as well as recov-
ery of respiration (Figure 4F), and showed a propensity to form tumours without a lag phase
(Figure 4G). These results document that mtDNA is transferred from stromal cells to B16r
0
cells
within intact mitochondria, resulting in the restoration of respiration and in efficient tumour
formation.
Discussion
Horizontal gene transfer is a process that until recently had not been known in mammals
(Keeling and Palmer, 2008), but has been described for lower eukaryotes (Gladyshev et al., 2008),
affecting their phenotype (Boschetti et al., 2012). In mammals, the mitochondrial gene transfer has
been inferred in a 10,000 year-old canine transmissible venereal tumour (CTVT) (Rebbeck et al.,
2011;Murchison et al., 2014;Strakova and Murchison, 2015). These predictions have now been
confirmed, and a recent study showed at least 5 mtDNA transfers in CTVT within the last 1–2 thou-
sand years (Strakova et al., 2016). Mitochondrial transfer was reported in vitro with functional con-
sequences (Spees et al., 2006;Wang and Gerdes, 2015), as well as in mice with endogenously
injected MSCs (Islam et al., 2012;Ahmad et al., 2014), but these results could also be explained by
the association of membrane-bound particles or exosomes containing mitochondria with the dam-
aged cells rather than functional mitochondria proliferating/dividing inside cells. A recent publication
from our laboratory showed, for the first time, horizontal transfer of mitochondrial genes between
mammalian cells in vivo, based on acquisition of host mtDNA by r
0
tumour cells and on the presence
of host mtDNA markers in cell lines derived from these tumours (Tan et al., 2015). Several
Dong et al. eLife 2017;6:e22187. DOI: 10.7554/eLife.22187 8 of 22
Research article Cancer Biology
Figure 4. mtDNA transfers from host cells to B16r
0
cells in whole mitochondria. (A) MSCs prepared from C57BL/6J mice were labelled with Mito Deep
Red (MitoDR) targeted to mitochondria, B16 or B16r
0
cells were labelled with CFSE. On the left, confocal micrographs are shown for MSCs labelled
with MitoDR co-cultured with B16 or B16r
0
cells, or B16 cells labelled with MitoDR co-cultured with B16r
0
cells labelled with CFSE for 24 hr. On the
right, evaluation of confocal microscopy is shown. (B) C57BL/6N
su9DsRed2
mice with red fluorescent mitochondria were grafted subcutaneously with 10
6
Figure 4 continued on next page
Dong et al. eLife 2017;6:e22187. DOI: 10.7554/eLife.22187 9 of 22
Research article Cancer Biology
subsequently published papers also provide evidence for horizontal transfer of mitochondria under
(patho)physiological conditions (Lei and Spradling, 2016;Hayakawa et al., 2016; ,Osswald et al.,
2015;Moschoi et al., 2016), pointing to OXPHOS as a factor complicating cancer therapy
(Osswald et al., 2015;Moschoi et al., 2016,Matassa et al., 2016). Hence, our data, along with
those of other groups, point to mitochondrial transfer as a highly dynamic field of research, with
important implications for the conceptual understanding of cancer.
Our recent findings (Tan et al., 2015) provoke a number of questions, such as whether respiration
is essential for tumour formation, and what is the mode of mtDNA acquisition. To address these
queries, B16 metastatic melanoma cells without mtDNA and with compromised respiratory function
were used. We show that B16r
0
cells do not form tumours unless they acquire mtDNA and that
severe suppression of either CI- or CII-dependent respiration leads to impaired ability to form
tumours, directly linking mitochondrial respiration and tumor growth. The reason(s) for the appar-
ently greater importance of CI-dependent respiration in tumour formation (Figure 3E,F) remain to
be explored, particularly when the role of SDH in metabolic re-modelling is taken into consideration
(Cardaci et al., 2015;Lussey-Lepoutre et al., 2015). From a mechanistic point of view, CI is essen-
tial for respirasome assembly (Moreno-Lastres et al., 2012) that is needed for CI-dependent respi-
ration (Acı´n-Pe
´rez et al., 2008;Lapuente-Brun et al., 2013;Tan et al., 2015). Another indication of
the importance of CI is the finding that tumours derived from B16r
0
cells feature much higher CI-
dependent respiration (Figure 2F).
We document here that the primary tumour-derived B16r
0
SC cells feature a fully assembled res-
pirasome and complete recovery of respiration, while corresponding 4T1r
0
SC cells show only partial
(20–25%) recovery of respiration (Tan et al., 2015). Consistent with this, 4T1r
0
SC cells formed
tumours with a longer delay than parental 4T1 cells, while no delay was observed for B16r
0
SC cells.
This is likely related to the higher requirement of B16r
0
cells for respiration recovery to form
tumours. This ‘threshold’, apparently lower for 4T1r
0
cells, may be due to higher routine respiration
of B16 cells of some 100 pmol O
2
/s/10
6
cells (Figure 1E) when compared to less than 20 pmol O
2
/s/
10
6
cells for 4T1 cells (Tan et al., 2015). Additionally, the different genetic changes in B16 melanoma
and 4T1 breast carcinoma cells could underpin altered respiration recovery. Whether there is a link
to a requirement for ‘threshold’ recovery of respiration for cancer cells to initiate tumour formation
has yet to be determined. We propose the term ‘OXPHOS addiction’ to describe the requirement
for mitochondrial respiration across the landscape of tumours, and will investigate this in more detail
in future research.
A key question has been the mode of movement of mtDNA between cells. Both selective transfer
of mitochondria and cell fusion have been proposed in the past (Tan et al., 2015;Vitale et al.,
2011). Using C57BL/6N
su9-DsRed2
mice with red fluorescent mitochondria in somatic cells, we now
provide evidence for acquisition of mtDNA by the trafficking of whole mitochondria from host donor
cells to r
0
cells both in vivo (Figure 4B), resulting in long-lasting respiration recovery and, conse-
quently, efficient tumour formation (Figure 4E–G). The transient nature of dsRed expression in recip-
ient B16r
0
cell mitochondria in the in vivo model sheds additional light on the mechanism of
mitochondrial transfer. When dsRed-containing mitochondria are selectively transferred from the
host into the recipient cells, dsRed cannot be replenished in the donated mitochondria by de novo
synthesis (not being encoded in the recipient’s nuclear genome), and the red fluorescence in
Figure 4 continued
B16r
0
cells stably transfected with nBFP. After 11 days, a mouse was sacrificed and the pre-tumour lesion excised and digested into the single cell
population, which was sorted for double positive (DP) (red and blue fluorescent) cells. The cells were then inspected by confocal microscopy for blue
nuclei and red mitochondria. The image shows maximum intensity Z-projection of a representative DP cell. (C) Parental B16, r
0
and r
0
DP cells were
evaluated for mitochondrial morphology using transmission electron microscopy. (D) Parental cells and their r
0
and DP counterparts were
imunnostained for DNA, TFAM and Tom20, and inspected by STED microscopy for mitochondrial nucleoids. The upper panels show a confocal image
of a major part of a whole cell, the lower images depict higher magnification of the regions of interest indicated above by the yellow box obtained by
STED. (E) Parental cells and their r
0
and DP counterparts were assessed for binding of POLG1 to the mtDNA D-LOOP region using mitoChIP. (F)
Parental cells and their r
0
and DP counterparts were evaluated for routine respiration or respiration via CI and CII. (G) B16 cells and their r
0
and DP
counterparts were grafted s.c. in C57BL/6J mice at 10
6
per animal and tumour growth evaluated by USI. The symbol ‘*’ indicates statistically significant
differences between individual B16r
0
or B16r
0
DP cells and parental B16 cells.
DOI: 10.7554/eLife.22187.005
Dong et al. eLife 2017;6:e22187. DOI: 10.7554/eLife.22187 10 of 22
Research article Cancer Biology
donated mitochondria is quickly lost. On the other hand, if cell fusion were responsible for the
observed acquisition of mitochondria from the donor cells (Maiuri and Kroemer, 2015), the donor’s
nuclear material would also be transferred, and mitochondrial dsRed expression would be main-
tained. As this is not the case, the selective transfer of whole, intact mitochondria remains the only
possible explanation of our experimental data. The next step will be to investigate the mechanism of
mitochondrial trafficking between cells in vivo, with tunnelling nanotubes being a plausible mode of
intercellular transfer of the organelles (Rustom et al., 2004;Rogers and Bhattacharya, 2014;
Rustom, 2016).
We conclude that recovery of respiration in tumor cells with damaged mtDNA is essential for effi-
cient tumour formation and that this is accomplished by the intercellular transfer of whole mitochon-
dria. Our findings are consistent with the emerging notion of the essential role of respiration in
cancer cell proliferation and tumor progression (LeBleu et al., 2014;Viale et al., 2014;
Birsoy et al., 2015;Sullivan et al., 2015;Cardaci et al., 2015;Lussey-Lepoutre et al., 2015;
Berridge et al., 2015;Viale et al., 2015), and of a role for mitochondrial transfer in maintaining the
bioenergetics balance (Sinha et al., 2016;Wu et al., 2016). From translational angle, recent studies
on horizontal mitochondrial transfer indicate two tantalising, novel approaches to cancer therapy:
targeting mitochondrial respiration and blocking transfer of mitochondria from stromal cells to can-
cer cells. While we have started exploring the first approach (Dong et al., 2011;Boukalova et al.,
2016;Kluckova et al., 2015;Rohlenova et al., 2017), the other approach remains untested, with
recent papers (Osswald et al., 2015;Moschoi et al., 2016) pointing to its plausibility. Finally, to the
best of our knowledge, this paper is the first report to show lasting functional consequences of a
well-documented mitochondrial transfer event.
Materials and methods
Cell culture
Cell lines were prepared and maintained as described (Tan et al., 2015). C57BL/6J mice were used
as host animals for grafting B16 sub-lines as indicated (Tan et al., 2015). B16 lines formed syngeneic
tumours in C57BL/6J mice indicating their authenticity. Parental and r
0
cells with BFP nuclei were
prepared by stable transfection with the pTagBFP-H2B plasmid (Evrogen) followed by clonal selec-
tion. RNAi was used to knock down NDUFV1 or SDHC subunits, using two different shRNAs (Ori-
Gene) for each protein. In brief, cells were transfected with shRNA using a standard protocol and
inspected by WB for protein levels. Cells with more efficient knock-down of NDUFV1 or SDHC were
used in further experiments.
Isolation of mesenchymal stem cells and their co-culture with cancer
cells
Mouse MSCs were isolated from C57BL/6J mice as described earlier (Ahmad et al., 2014). The pri-
mary cells were plated at the density of 10
6
cells/ml in T25 culture flasks and experiments were per-
formed after the fourth passage. For co-culture experiments, MSCs were stained with Mito Deep
Red (Ex/Em, 644/665 nm; Invitrogen) and B16r
0
cells with the CFSE dye (Ex/Em, 492/517 nm; Invi-
trogen) for 15 min. The cells were then co-cultured for 24 hr and evaluated by flow cytometry (FACS
Calibur) and confocal microscopy (63 x; Leica SP8). Mitochondrial transfer was primarily ascertained
by a fraction of CFSE-positive cells that were also MitoDeepRed-positive. The quantitative mitochon-
drial transfer was primarily ascertained by pixel counts on Z-stack confocal images i.e. red pixels in
cells with green background. Geometric mean intensity of MitoDeerRed fluorescence in double posi-
tive cells was additionally calculated, as a confirmatory measurement of the degree of mitochondrial
transfer. Other co-culture combinations (MSCs with B16 cells, B16 cells with B16r
0
cells) were per-
formed in a similar fashion. Additionally, r
0
cells were transfected with a plasmid coding for nBFP
and pmGFP followed by clonal selection. Transfected r
0
cells were seeded with MSCs prepared
from C57BL/6N
su9DsRed2
mice in glass-bottom dishes (In Vitro Scientific) at 1:1 ratio and co-cultured
for 24 hr. Live cells were inspected using the inverted fluorescence microscope Delta Vision Core
with laser photo-manipulation. The acquired images were deconvolved by Huygens Professional
software (Scientific Volume Imaging) and processed by FiJi ImageJ software.
Dong et al. eLife 2017;6:e22187. DOI: 10.7554/eLife.22187 11 of 22
Research article Cancer Biology
Animals
C57BL/6J mice were used for most of the experiments. They were purchased from the Animal
Resources Centre or produced by the animal breeding facilities of the Institute of Biotechnology and
Malaghan Institute. In all cases, the mice were grafted subcutaneously with various cell lines at 5
10
5
cells per animal. Tumours were monitored by ultrasound imaging (USI) using the Vevo770 system
(VisualSonics, Toronto, Canada). Transgenic mice expressing red fluorescent protein in somatic cell
mitochondria (the CAG/su9-DsRed2 transgene) were generated in the Transgenic Unit of the Czech
Centre for Phenogenomics, Institute of Molecular Genetics, Prague, Czech Republic, using a pronu-
clear injection from the construct provided by Prof. Masaru Okabe (Osaka University, Japan)
(Hasuwa et al., 2010) and C57BL/6N mice. The stable colony of transgenic mice was housed in the
animal facility of the Faculty of Science, Charles University, Prague, Czech Republic, and food and
water were supplied ad libitum. The mice used for the grafting experiments were healthy 10 weeks
old animals with no sign of stress or discomfort. All animal procedures and experimental protocols
were approved by the Animal Welfare Committee of the Czech Academy of Sciences (Animal Ethics
Number 18/2015).
Single cell-digital droplet PCR
Details of the methodology are in the Supplemental information.
Microscopic and flow cytometric cell evaluation, cell sorting and STED
microscopy
Details of the methodology are in the Supplemental information.
Mitochondrial biochemistry assays, gene expression analysis and respiration
assays
Details of the methodology are in the Supplemental information.
Statistical analysis
Unless stated otherwise, data are mean values ±S.D. of at least three independent experiments. In
mouse experiments, groups of 6 animals were used, unless stated otherwise. The two-tailed
unpaired Student’s t test was used to assess statistical significance with p<0.05 being regarded as
significant. Images are representative of three independent experiments.
Acknowledgements
We thank Prof. Okabe for providing the CAG/su9-DsRed2 plasmid, and the Transgenic Unit, Institute
of Molecular Genetics, CAS, Prague, Czech Republic, for production of transgenic mouse founders.
We also thank the Light Microscopy Core Facility of the Institute of Molecular Genetics, Czech Acad-
emy of Sciences, Prague, Czech Republic (supported by grants LM201504, CZ.2.16/3.1.00/21547
and LO1419) for their help with confocal/super-resolution microscopy. The work was supported in
part by the Australian Research Council grant DP150102820 and grants from the Czech Science
Foundation 17-0192J, 16-12719S and 15-02203S to JN, 16-22823S and 17-20904S to JR, 14-05547S
to KD-H., and 16-12816S to JT. RS was supported by a grant from the Czech Academy of Sciences
(RVO 68378050) and by the MEYS, LM2011032 (Czech Centre for Phenogenomics) grant. AA, NB
and BP were supported by CSIR (India) grant MLP5502 and the Wellcome Trust DBT India Alliance
Senior Fellowship (AA). MVB and AST were supported by the Cancer Society of New Zealand, Gene-
sis Oncology Trust and the Malaghan Institute of Medical Research. ARC was supported by PhD
scholarship from the Foundation for Science and Technology (SFRH/BD/103399/2014). The project
was supported in part by TACR (TE01020118); the electron microscopy data presented in this paper
were produced at the Microscopy Centre - Electron Microscopy Core Facility, IMG ASCR, Prague,
Czech Republic, supported by MEYS CR (LM2015062 Czech-BioImaging). The work was also sup-
ported by the Ministry of Education, Youth and Sports of CR within the LQ1604 National Sustainabil-
ity Program II (Project BIOCEV-FAR) and by the BIOCEV European Regional Development Fund
CZ.1.05/1.1.00/02.0109 and by the institutional support of the Institute of Biotechnology RVO:
86652036.
Dong et al. eLife 2017;6:e22187. DOI: 10.7554/eLife.22187 12 of 22
Research article Cancer Biology
Additional information
Funding
Funder Grant reference number Author
Fundac¸a
˜o para a Cie
ˆncia e a
Tecnologia
SFRH/BD/103399/2014 Ana R Coelho
Cancer Society of New Zealand An S Tan
Michael V Berridge
Genesis Oncology Trust An S Tan
Michael V Berridge
Malaghan Institute of Medical
Research
An S Tan
Michael V Berridge
Council for Scientific and In-
dustrial Research
MLP5502 Anurag Agrawal
Naveen Bhatraju
Bijay Pattnaik
Wellcome DBT India Alliance Senior
Fellowship
Bijay Pattnaik
Naveen Bhatraju
Anurag Agrawal
Czech Science Foundation 16-12816S Jaroslav Truksa
Ministerstvo S
ˇkolstvı
´, Mla
´dez
ˇe
a Te
ˇlovy
´chovy
LM2011032 Radislav Sedlacek
Akademie ve
ˇd C
ˇeske
´republiky RVO 68378050 Radislav Sedlacek
Czech Science Foundation 14-05547S Katerina Dvorakova-Hortova
Czech Science Foundation 16-22823S Jakub Rohlena
Czech Science Foundation 17–20904S Jakub Rohlena
Czech Science Foundation 16–12816S Jakub Rohlena
Australian Research Council DP150102820 Jiri Neuzil
Czech Science Foundation 17–0192J Jiri Neuzil
Czech Science Foundation 16-12719S Jiri Neuzil
Czech Science Foundation 15-02203S Jiri Neuzil
BIOCEV European Regional
Development
Jiri Neuzil
The funders had no role in study design, data collection and interpretation, or the decision to
submit the work for publication.
Author contributions
L-FD, Conceptualization, Supervision, Investigation, Writing—original draft, Writing—review and
editing; JK, Conceptualization, Investigation, Methodology, Writing—review and editing; MB, Inves-
tigation, Methodology, Writing—review and editing; AB-G, Conceptualization, Data curation, Inves-
tigation, Methodology; DS, KS, Data curation, Investigation, Methodology; BE, ARC, AR, KJ, KZ, ZR,
LA, MS, BY, BP, Investigation, Methodology; NS, AST, VG, Resources, Investigation, Methodology;
KK, Methodology, Data acquisition; NB, Data curation, Supervision, Investigation, Methodology; JT,
PS, Resources, Supervision, Investigation, Methodology; PH, Supervision, Methodology; AKL,
Resources, Supervision, Investigation; RS, Supervision, Investigation, Methodology; PJO, Conceptu-
alization, Supervision, Methodology; MK, Conceptualization, Supervision, Investigation; AA, Concep-
tualization, Supervision, Investigation, Methodology; KD-H, Conceptualization, Supervision, Funding
acquisition, Investigation, Writing—original draft, Writing—review and editing; JR, Conceptualiza-
tion, Resources, Writing—original draft, Writing—review and editing; MVB, Conceptualization,
Supervision, Funding acquisition, Methodology, Writing—original draft, Project administration, Writ-
ing—review and editing; JN, methodology, investigation
Dong et al. eLife 2017;6:e22187. DOI: 10.7554/eLife.22187 13 of 22
Research article Cancer Biology
Author ORCIDs
Jiri Neuzil, http://orcid.org/0000-0002-2478-2460
Ethics
Animal experimentation: This study was performed in strict accordance with the recommendations
in the Guide for the Care and Use of Laboratory Animals of the Czech Republic All animal proce-
dures and experimental protocols were approved by the Local Ethics Committee (Animal Ethics
Number 18/2015).
References
Acı´n-Pe
´rez R, Ferna´ ndez-Silva P, Peleato ML, Pe´rez-Martos A, Enriquez JA. 2008. Respiratory active
mitochondrial supercomplexes. Molecular Cell 32:529–539. doi: 10.1016/j.molcel.2008.10.021,PMID: 190267
83
Ahmad T, Mukherjee S, Pattnaik B, Kumar M, Singh S, Kumar M, Rehman R, Tiwari BK, Jha KA, Barhanpurkar AP,
Wani MR, Roy SS, Mabalirajan U, Ghosh B, Agrawal A. 2014. Miro1 regulates intercellular mitochondrial
transport & enhances mesenchymal stem cell rescue efficacy. The EMBO Journal 33:994–1010. doi: 10.1002/
embj.201386030,PMID: 24431222
Bayona-Bafaluy MP, Acı
´n-Pe
´ rez R, Mullikin JC, Park JS, Moreno-Loshuertos R, Hu P, Pe´ rez-Martos A, Ferna´ ndez-
Silva P, Bai Y, Enrı
´quez JA. 2003. Revisiting the mouse mitochondrial DNA sequence. Nucleic Acids Research
31:5349–5355. doi: 10.1093/nar/gkg739,PMID: 12954771
Berridge MV, Dong L, Neuzil J. 2015. Mitochondrial DNA in tumor initiation, progression, and metastasis: role of
horizontal mtDNA transfer. Cancer Research 75:3203–3208. doi: 10.1158/0008-5472.CAN-15-0859,
PMID: 26224121
Berridge MV, McConnell M, Bajzikova M, Kovarova J, Neuzil J. 2016. Horizontal transfer of mitochondria in
mammalian cells: beyond Cancer. Current Opinion in Genetics and Development 38:75–82. doi: 10.1016/j.
gde.2016.04.003
Birsoy K, Wang T, Chen WW, Freinkman E, Abu-Remaileh M, Sabatini DM. 2015. An essential role of the
mitochondrial Electron transport chain in cell proliferation is to enable aspartate synthesis. Cell 162:540–551.
doi: 10.1016/j.cell.2015.07.016,PMID: 26232224
Boschetti C, Carr A, Crisp A, Eyres I, Wang-Koh Y, Lubzens E, Barraclough TG, Micklem G, Tunnacliffe A. 2012.
Biochemical diversification through foreign gene expression in bdelloid rotifers. PLoS Genetics 8:e1003035.
doi: 10.1371/journal.pgen.1003035,PMID: 23166508
Boukalova S, Stursa J, Werner L, Ezrova Z, Cerny J, Bezawork-Geleta A, Pecinova A, Dong L, Drahota Z, Neuzil
J. 2016. Mitochondrial targeting of metformin enhances its activity against pancreatic Cancer. Molecular
Cancer Therapeutics 15:2875–2886. doi: 10.1158/1535-7163.MCT-15-1021,PMID: 27765848
Cardaci S, Zheng L, MacKay G, van den Broek NJ, MacKenzie ED, Nixon C, Stevenson D, Tumanov S, Bulusu V,
Kamphorst JJ, Vazquez A, Fleming S, Schiavi F, Kalna G, Blyth K, Strathdee D, Gottlieb E. 2015. Pyruvate
carboxylation enables growth of SDH-deficient cells by supporting aspartate biosynthesis. Nature Cell Biology
17:1317–1326. doi: 10.1038/ncb3233,PMID: 26302408
Dong LF, Jameson VJ, Tilly D, Cerny J, Mahdavian E, Marı
´n-Herna
´ ndez A, Herna´ ndez-Esquivel L, Rodrı
´guez-
Enrı
´quez S, Stursa J, Witting PK, Stantic B, Rohlena J, Truksa J, Kluckova K, Dyason JC, Ledvina M, Salvatore
BA, Moreno-Sa´ nchez R, Coster MJ, Ralph SJ, et al. 2011. Mitochondrial targeting of vitamin E succinate
enhances its pro-apoptotic and anti-cancer activity via mitochondrial complex II. Journal of Biological Chemistry
286:3717–3728. doi: 10.1074/jbc.M110.186643,PMID: 21059645
Frezza C, Gottlieb E. 2009. Mitochondria in Cancer: not just innocent bystanders. Seminars in Cancer Biology 19:
4–11. doi: 10.1016/j.semcancer.2008.11.008,PMID: 19101633
Gentric G, Mieulet V, Mechta-Grigoriou F. 2016. Heterogeneity in Cancer metabolism: new concepts in an old
field. Antioxidants & Redox Signaling. In press. doi: 10.1089/ars.2016.6750,PMID: 27228792
Gladyshev EA, Meselson M, Arkhipova IR. 2008. Massive horizontal gene transfer in bdelloid rotifers. Science
320:1210–1213. doi: 10.1126/science.1156407,PMID: 18511688
Hanahan D, Weinberg RA. 2011. Hallmarks of Cancer: the next generation. Cell 144:646–674. doi: 10.1016/j.cell.
2011.02.013,PMID: 21376230
Hasuwa H, Muro Y, Ikawa M, Kato N, Tsujimoto Y, Okabe M. 2010. Transgenic mouse sperm that have green
acrosome and red mitochondria allow visualization of sperm and their acrosome reaction in vivo. Experimental
Animals 59:105–107. doi: 10.1538/expanim.59.105,PMID: 20224175
Hayakawa K, Esposito E, Wang X, Terasaki Y, Liu Y, Xing C, Ji X, Lo EH. 2016. Transfer of mitochondria from
astrocytes to neurons after stroke. Nature 535:551–555. doi: 10.1038/nature18928,PMID: 27466127
Hayashi JI, Hashizume O, Ishikawa K, Shimizu A. 2016. Mutations in mitochondrial DNA regulate mitochondrial
diseases and metastasis but do not regulate aging. Current Opinion in Genetics & Development 38:63–67.
doi: 10.1016/j.gde.2016.03.004,PMID: 27078865
Huggett JF, Foy CA, Benes V, Emslie K, Garson JA, Haynes R, Hellemans J, Kubista M, Mueller RD, Nolan T,
Pfaffl MW, Shipley GL, Vandesompele J, Wittwer CT, Bustin SA. 2013. The digital MIQE guidelines: minimum
information for publication of quantitative digital PCR experiments. Clinical Chemistry 59:892–902. doi: 10.
1373/clinchem.2013.206375,PMID: 23570709
Dong et al. eLife 2017;6:e22187. DOI: 10.7554/eLife.22187 14 of 22
Research article Cancer Biology
Ishikawa K, Takenaga K, Akimoto M, Koshikawa N, Yamaguchi A, Imanishi H, Nakada K, Honma Y, Hayashi J.
2008. ROS-generating mitochondrial DNA mutations can regulate tumor cell metastasis. Science 320:661–664.
doi: 10.1126/science.1156906,PMID: 18388260
Islam MN, Das SR, Emin MT, Wei M, Sun L, Westphalen K, Rowlands DJ, Quadri SK, Bhattacharya S,
Bhattacharya J. 2012. Mitochondrial transfer from bone-marrow-derived stromal cells to pulmonary alveoli
protects against acute lung injury. Nature Medicine 18:759–765. doi: 10.1038/nm.2736,PMID: 22504485
Jose C, Bellance N, Rossignol R. 2011. Choosing between glycolysis and oxidative phosphorylation: a tumor’s
dilemma? Biochimica Et Biophysica Acta (BBA) - Bioenergetics 1807:552–561. doi: 10.1016/j.bbabio.2010.10.
012,PMID: 20955683
Keeling PJ, Palmer JD. 2008. Horizontal gene transfer in eukaryotic evolution. Nature Reviews Genetics 9:605–
618. doi: 10.1038/nrg2386,PMID: 18591983
Kluckova K, Sticha M, Cerny J, Mracek T, Dong L, Drahota Z, Gottlieb E, Neuzil J, Rohlena J. 2015. Ubiquinone-
binding site mutagenesis reveals the role of mitochondrial complex II in cell death initiation. Cell Death and
Disease 6:e1749. doi: 10.1038/cddis.2015.110,PMID: 25950479
Koppenol WH, Bounds PL, Dang CV. 2011. Otto Warburg’s contributions to current concepts of cancer
metabolism. Nature Reviews Cancer 11:325–337. doi: 10.1038/nrc3038,PMID: 21508971
Lapuente-Brun E, Moreno-Loshuertos R, Acı
´n-Pe
´ rez R, Latorre-Pellicer A, Cola´ s C, Balsa E, Perales-Clemente E,
Quiro´ s PM, Calvo E, Rodrı
´guez-Herna´ ndez MA, Navas P, Cruz R, Carracedo A
´, Lo´ pez-Otı
´n C, Pe´ rez-Martos A,
Ferna´ndez-Silva P, Ferna´ndez-Vizarra E, Enrı
´quez JA. 2013. Supercomplex assembly determines Electron flux in
the mitochondrial Electron transport chain. Science 340:1567–1570. doi: 10.1126/science.1230381,PMID: 23
812712
LeBleu VS, O’Connell JT, Gonzalez Herrera KN, Wikman H, Pantel K, Haigis MC, de Carvalho FM, Damascena A,
Domingos Chinen LT, Rocha RM, Asara JM, Kalluri R. 2014. PGC-1amediates mitochondrial biogenesis and
oxidative phosphorylation in Cancer cells to promote metastasis. Nature Cell Biology 16:992–1003. doi: 10.
1038/ncb3039,PMID: 25241037
Lee WT, St John JC. 2016. Mitochondrial DNA as an initiator of tumorigenesis. Cell Death and Disease 7:e2171.
doi: 10.1038/cddis.2016.77,PMID: 27031968
Lei L, Spradling AC. 2016. Mouse oocytes differentiate through organelle enrichment from sister cyst germ cells.
Science 352:95–99. doi: 10.1126/science.aad2156,PMID: 26917595
Lussey-Lepoutre C, Hollinshead KE, Ludwig C, Menara M, Morin A, Castro-Vega LJ, Parker SJ, Janin M,
Martinelli C, Ottolenghi C, Metallo C, Gimenez-Roqueplo AP, Favier J, Tennant DA. 2015. Loss of succinate
dehydrogenase activity results in dependency on pyruvate carboxylation for cellular anabolism. Nature
Communications 6:8784. doi: 10.1038/ncomms9784,PMID: 26522426
Maiuri MC, Kroemer G. 2015. Essential role for oxidative phosphorylation in Cancer progression. Cell
Metabolism 21:11–12. doi: 10.1016/j.cmet.2014.12.013,PMID: 25565201
Matassa DS, Amoroso MR, Lu H, Avolio R, Arzeni D, Procaccini C, Faicchia D, Maddalena F, Simeon V, Agliarulo
I, Zanini E, Mazzoccoli C, Recchi C, Stronach E, Marone G, Gabra H, Matarese G, Landriscina M, Esposito F.
2016. Oxidative metabolism drives inflammation-induced platinum resistance in human ovarian Cancer. Cell
Death and Differentiation 23:1542–1554. doi: 10.1038/cdd.2016.39,PMID: 27206315
Michelakis ED, Sutendra G, Dromparis P, Webster L, Haromy A, Niven E, Maguire C, Gammer TL, Mackey JR,
Fulton D, Abdulkarim B, McMurtry MS, Petruk KC. 2010. Metabolic modulation of glioblastoma with
dichloroacetate. Science Translational Medicine 2:31ra34–ra34. doi: 10.1126/scitranslmed.3000677,
PMID: 20463368
Mills KM, Brocardo MG, Henderson BR. 2016. APC binds the miro/Milton motor complex to stimulate transport
of mitochondria to the plasma membrane. Molecular Biology of the Cell 27:466–482. doi: 10.1091/mbc.E15-09-
0632,PMID: 26658612
Moreno-Lastres D, Fontanesi F, Garcı
´a-Consuegra I, Martı
´n MA, Arenas J, Barrientos A, Ugalde C. 2012.
Mitochondrial complex I plays an essential role in human respirasome assembly. Cell Metabolism 15:324–335.
doi: 10.1016/j.cmet.2012.01.015,PMID: 22342700
Moreno-Sa
´nchez R, Rodrı
´guez-Enrı
´quez S, Marı
´n-Herna
´ ndez A, Saavedra E. 2007. Energy metabolism in tumor
cells. FEBS Journal 274:1393–1418. doi: 10.1111/j.1742-4658.2007.05686.x,PMID: 17302740
Moschoi R, Imbert V, Nebout M, Chiche J, Mary D, Prebet T, Saland E, Castellano R, Pouyet L, Collette Y, Vey N,
Chabannon C, Recher C, Sarry JE, Alcor D, Peyron JF, Griessinger E. 2016. Protective mitochondrial transfer
from bone marrow stromal cells to acute myeloid leukemic cells during chemotherapy. Blood 128:253–264.
doi: 10.1182/blood-2015-07-655860,PMID: 27257182
Murchison EP, Wedge DC, Alexandrov LB, Fu B, Martincorena I, Ning Z, Tubio JM, Werner EI, Allen J, De Nardi
AB, Donelan EM, Marino G, Fassati A, Campbell PJ, Yang F, Burt A, Weiss RA, Stratton MR. 2014.
Transmissible [corrected] dog Cancer genome reveals the origin and history of an ancient cell lineage. Science
343:437–440. doi: 10.1126/science.1247167,PMID: 24458646
Osswald M, Jung E, Sahm F, Solecki G, Venkataramani V, Blaes J, Weil S, Horstmann H, Wiestler B, Syed M,
Huang L, Ratliff M, Karimian Jazi K, Kurz FT, Schmenger T, Lemke D, Go
¨mmel M, Pauli M, Liao Y, Ha
¨ring P,
et al. 2015. Brain tumour cells interconnect to a functional and resistant network. Nature 528:93–98. doi: 10.
1038/nature16071,PMID: 26536111
Patananan AN, Wu TH, Chiou PY, Teitell MA. 2016. Modifying the mitochondrial genome. Cell Metabolism 23:
785–796. doi: 10.1016/j.cmet.2016.04.004,PMID: 27166943
Rebbeck CA, Leroi AM, Burt A. 2011. Mitochondrial capture by a transmissible Cancer. Science 331:303. doi: 10.
1126/science.1197696,PMID: 21252340
Dong et al. eLife 2017;6:e22187. DOI: 10.7554/eLife.22187 15 of 22
Research article Cancer Biology
Rogers RS, Bhattacharya J. 2013. When cells become organelle donors. Physiology 28:414–422. doi: 10.1152/
physiol.00032.2013,PMID: 24186936
Rohlenova K, Sachaphibulkij K, Stursa J, Bezawork-Geleta A, Blecha J, Endaya B, Werner L, Cerny J, Zobalova R,
Goodwin J, Spacek T, Alizadeh Pesdar E, Yan B, Nguyen MN, Vondrusova M, Sobol M, Jezek P, Hozak P,
Truksa J, Rohlena J, et al. 2017. Selective disruption of respiratory supercomplexes as a new strategy to
suppress Her2
high
Breast Cancer. Antioxidants & Redox Signaling 26:84–103. doi: 10.1089/ars.2016.6677,
PMID: 27392540
Rustom A, Saffrich R, Markovic I, Walther P, Gerdes HH. 2004. Nanotubular highways for intercellular organelle
transport. Science 303:1007–1010. doi: 10.1126/science.1093133,PMID: 14963329
Rustom A. 2016. The missing link: does tunnelling nanotube-based supercellularity provide a new understanding
of chronic and lifestyle diseases? Open Biology 6:160057. doi: 10.1098/rsob.160057,PMID: 27278648
Sinha P, Islam MN, Bhattacharya S, Bhattacharya J. 2016. Intercellular mitochondrial transfer: bioenergetic
crosstalk between cells. Current Opinion in Genetics & Development 38:97–101. doi: 10.1016/j.gde.2016.05.
002,PMID: 27235808
Spees JL, Olson SD, Whitney MJ, Prockop DJ. 2006. Mitochondrial transfer between cells can rescue aerobic
respiration. PNAS 103:1283–1288. doi: 10.1073/pnas.0510511103,PMID: 16432190
Strakova A, Murchison EP. 2015. The Cancer which survived: insights from the genome of an 11000 year-old
Cancer. Current Opinion in Genetics & Development 30:49–55. doi: 10.1016/j.gde.2015.03.005,PMID: 25
867244
Strakova A, Nı
´Leathlobhair M, Wang GD, Yin TT, Airikkala-Otter I, Allen JL, Allum KM, Bansse-Issa L, Bisson JL,
Castillo Domracheva A, de Castro KF, Corrigan AM, Cran HR, Crawford JT, Cutter SM, Delgadillo Keenan L,
Donelan EM, Faramade IA, Flores Reynoso E, Fotopoulou E, et al. 2016. Mitochondrial genetic diversity,
selection and recombination in a canine transmissible Cancer. eLife 5:e14552. doi: 10.7554/eLife.14552,
PMID: 27185408
Sullivan LB, Gui DY, Hosios AM, Bush LN, Freinkman E, Vander Heiden MG. 2015. Supporting aspartate
biosynthesis is an essential function of respiration in proliferating cells. Cell 162:552–563. doi: 10.1016/j.cell.
2015.07.017,PMID: 26232225
Tan AS, Baty JW, Dong LF, Bezawork-Geleta A, Endaya B, Goodwin J, Bajzikova M, Kovarova J, Peterka M, Yan
B, Pesdar EA, Sobol M, Filimonenko A, Stuart S, Vondrusova M, Kluckova K, Sachaphibulkij K, Rohlena J, Hozak
P, Truksa J, et al. 2015. Mitochondrial genome acquisition restores respiratory function and tumorigenic
potential of Cancer cells without mitochondrial DNA. Cell Metabolism 21:81–94. doi: 10.1016/j.cmet.2014.12.
003,PMID: 25565207
Viale A, Corti D, Draetta GF. 2015. Tumors and mitochondrial respiration: a neglected connection. Cancer
Research 75:3687–3691. doi: 10.1158/0008-5472.CAN-15-0491,PMID: 26374463
Viale A, Pettazzoni P, Lyssiotis CA, Ying H, Sa´nchez N, Marchesini M, Carugo A, Green T, Seth S, Giuliani V,
Kost-Alimova M, Muller F, Colla S, Nezi L, Genovese G, Deem AK, Kapoor A, Yao W, Brunetto E, Kang Y, et al.
2014. Oncogene ablation-resistant pancreatic Cancer cells depend on mitochondrial function. Nature 514:628–
632. doi: 10.1038/nature13611,PMID: 25119024
Vitale I, Galluzzi L, Senovilla L, Criollo A, Jemaa` M, Castedo M, Kroemer G. 2011. Illicit survival of Cancer cells
during polyploidization and depolyploidization. Cell Death and Differentiation 18:1403–1413. doi: 10.1038/
cdd.2010.145,PMID: 21072053
Vyas S, Zaganjor E, Haigis MC. 2016. Mitochondria and cancer. Cell 166:555–566. doi: 10.1016/j.cell.2016.07.
002,PMID: 27471965
Wang X, Gerdes HH. 2015. Transfer of mitochondria via tunneling nanotubes rescues apoptotic PC12 cells. Cell
Death and Differentiation 22:1181–1191. doi: 10.1038/cdd.2014.211,PMID: 25571977
Weinberg F, Hamanaka R, Wheaton WW, Weinberg S, Joseph J, Lopez M, Kalyanaraman B, Mutlu GM, Budinger
GR, Chandel NS. 2010. Mitochondrial metabolism and ROS generation are essential for Kras-mediated
tumorigenicity. PNAS 107:8788–8793. doi: 10.1073/pnas.1003428107,PMID: 20421486
Wu TH, Sagullo E, Case D, Zheng X, Li Y, Hong JS, TeSlaa T, Patananan AN, McCaffery JM, Niazi K, Braas D,
Koehler CM, Graeber TG, Chiou PY, Teitell MA. 2016. Mitochondrial transfer by photothermal nanoblade
restores metabolite profile in mammalian cells. Cell Metabolism 23:921–929. doi: 10.1016/j.cmet.2016.04.007,
PMID: 27166949
Dong et al. eLife 2017;6:e22187. DOI: 10.7554/eLife.22187 16 of 22
Research article Cancer Biology
Appendix 1
Single cell-digital droplet PCR
Single cell samples were obtained by automated cell withdrawal using the CellCelector (ALS).
Approximately 10,000 cells were seeded in a 6-well culture plate, nuclei were stained with
DAPI and automated image analysis was performed to identify viable attached cells.
Candidate cells were removed with a 30 mm capillary aspirating 0.1 ml per cell using
automated bottom detection and scrape mode. Each removed cell was deposited into 10 ml
of nuclease-free water supplemented with 1 mg/ml BSA (ThermoFisher) in a 384-well plate
that was cooled during the cell picking. The plate was then sealed and placed on dry ice
until use. Images were collected before and after picking, and only those samples that
contained a single cell were used for further analysis. Negative controls were medium only.
Half of the cell lysate (5 ml) was used in 20 ml ddPCR following the manufacturer´s
recommendations using ddPCR Mastermix for probes (BioRad) supplemented with 450 nM
primers, 250 nM probes: tRNA 8A FAM and 9A HEX (Sigma Aldrich, sequences are in
Appendix 1—table 1 below). Annealing temperature of 57˚C was used for the PCR run in a
C1000 thermocycler (BioRad). Droplet analysis was performed using the QX200 instrument
(BioRad), and data were analysed with Quantasoft according to the digital MIQE guidelines
(Huggett et al., 2013).
Appendix 1—table 1. Primer and probe sequences used in sc/ddPCR.
*
Capital letters indicate
LNA bases; polymorphism is shown in gray.
m_tRNA_Fw gtcacaattctatctctagg
m_tRNA_Rv ggttgaagaaggtagatg
m_tRNA_8A_FAM (host mouse) taattagtTtAaAaAaAaTtAaTgattt
m_tRNA_9A_HEX (parental B16) taattagtTtAaAaAaAaAtTaAtgattt
*
Polymorphism of the mtDNA tRNA
Arg
locus of C57 mice and B16 cells has been published
(Bayona-Bafaluy et al., 2003;Tan et al., 2015).
DOI: 10.7554/eLife.22187.006
The annealing temperature for the tRNA ddPCR assay was optimized using a gradient run
(data not shown), and a simplified validation of the sensitivity of the tRNA assay was
performed. To each 20 ml ddPCR reaction mix about 20,000 copies of parental mtDNA
were added ( »1 ng of purified B16 DNA) and spiked with 1000, 100, 10 and 1 copy of
host mtDNA. Loss of linearity was observed at a prevalence of 0.5% and 0.05% spiked in
host DNA. Pure parental mtDNA gave a background corresponding to 0.18% of host
mtDNA. This very low background is caused by cross reaction due to residual affinity of the
8A host probe to the 9A parental locus. The reciprocal cross reaction of 9A probe binding
to 8A parental locus was not observed (Figure 1A and Appendix 1—figure 1 for
validation of sc/ddPCR). No template controls (NTC) as well as B16r
0
cells were negative.
A single B16 cell contains about 100 copies of mtDNA (not shown); hence our ddPCR
sensitivity of 0.5% is sufficient to detect a single host mtDNA molecule.
Mitochondrial biochemistry and bioenergetics
The activity of SQR, SDH and CS were assessed as described (Tan et al., 2015). Lactate
production, ATP levels and glucose uptake were evaluated by standard procedures
(Tan et al., 2015).
Dong et al. eLife 2017;6:e22187. DOI: 10.7554/eLife.22187 17 of 22
Research article Cancer Biology
Real-time (RT) PCR
Real time PCR was applied to assess the level of mtDNA, real time RT-PCR was used for
evaluation of expression of selected transcripts. Details as well as the list of primers were
published earlier (Tan et al., 2015).
Mitochondrial chromatin immunoprecipitation (mitoChIP)
assay
Cells were crosslinked with 1% formaldehyde, harvested and cell pellets frozen. Pellets were
then resuspended in the ChIP lysis buffer, sonicated for 12 min at cycles consisting of 15
s sonication at amplitude 5 (QsonicaxxX) and 30 s cooling in ice-water bath. Sheared
chromatin was treated with RNAseA and proteinaseK, and subjected to agarose
electrophoresis to confirm correct shearing. Dynabeads were pre-absorbed with salmon
sperm DNA (0.2 mg/ml) and BSA (0.5%) overnight, and 20 ml of bead slurry was
combined with 5 mg of sheared chromatin and 1 ml of either anti-POLG1 IgG (Abcam,
ab128899) or non-specific rabbit IgG, and incubated overnight on a rotating platform.
After extensive washing, chromatin was eluted and treated with RNAseA and
proteinaseK, followed by purification using PCR clean-up columns (MachereyNagel). qRT-
PCR was then run using the Eva Green system (Solis Biodyne) at 95˚C for 12 min, 40
cycles of 95˚C for 15 s, 60˚C for 20 s, 72˚C for 35 s, followed by melt curve analysis using
primers for mouse POLG1: forward - TGA TCA ATT CTA GTA GTT CCC AAA A, reverse
- ACC TCT AAT TAA TTA TAA GGC CAG G. Data were quantified against a non-specific
IgG via the DDCt method.
Electrophoresis and western blotting
Cell as well as tumor lysates were prepared and electrophoresis/WB carried out by standard
procedures.
Confocal microscopy, STED super-resolution microscopy
and transmission electron microscopy (TEM)
For live cell imaging of mitochondria and mtDNA, cells were grown in chamber slides
(LabTek) and incubated for 30 min with 100 nM MitoTracker Red (Molecular Probes) and
5mg/ml Hoechst 33342, and, subsequently for 4 min with 2 mg/ml EtBr. Images were
captured and analysed using the FV1000 confocal microscope and Fluoview software
(Olympus).
STED microscopy was carried out as follows. Cells were grown on high precision cover-
slips over-night, fixed with 4% paraformaldehyde in PBS for 10 min at 37˚C, permeabilised
with the washing buffer (0.1 M glycin, 0.05% TWEEN, 0.05% Triton X-100, PBS), blocked
with 5% normal goat serum (Vector Laboratories), and incubated with primary antibodies
against DNA (PROGEN), TFAM (Abcam) or Tom20 (Santa Cruz Biotechnology). This was
followed by appropriate secondary antibodies including Alexa Fluor555 goat anti-mouse
IgM and Alexa Fluor488 goat anti-rabbit IgG (H+L) (Life Technologies). Nuclei were
labelled with Hoechst 33342 (Sigma-Aldrich). The cover-slips were mounted on glass slides
using 90% glycerol mounting medium with 5% n-propylgalate. The samples were visualized
using Leica TCS SP8 STED 3X microscope equipped with 660 nm STED depletion laser and
fitted with the LAS X 64 bit package software with LAS AF SP8 Dye Finder, 3D
visualization, deconvolution and co-localization module. The acquired images were
Dong et al. eLife 2017;6:e22187. DOI: 10.7554/eLife.22187 18 of 22
Research article Cancer Biology
deconvolved by Huygens Professional software (Scientific Volume Imaging) and processed
by FiJi ImageJ software.
TEM was performed using fixed cells via a standard procedure.
Generation of tumours in C57BL/6N
su9-DsRed2
transgenic
mice, cell sorting and confocal microscopy
B16r
0
cells with BFP nuclei were suspended in 100 ml PBS and grafted subcutaneously in
C57BL/6N
su9-DsRed2
transgenic mice at 10
6
cells per animal. The experiment was repeated
4 times, each time with five mice, and cells were recovered 4, 7, 9, 11 or 12 days post
implantation. The pre-tumor lesion was resected and digested enzymatically (collagenase/
DNase, 20 min, 37˚C). The isolated tumour cells were sorted for nBFP- and mitochondrial
DsRed-positive cells using the BD Influx high speed cell sorter (BD Biosciences) in 8-
chambered cover-glass system (In Vitro Scientific). 12 hr after sorting, the cells were viewed
using the Leica TCS SP5 AOBS Tandem confocal microscope equipped with the LAS AF
software. The acquired images were deconvolved using the Huygens Professional software
(Scientific Volume Imaging) and processed by FiJi ImageJ software.
Respiration assays
Experiments evaluating intact cell respiration were performed using the Oxygraph-2k
instrument (Oroboros) with cells suspended in RPMI medium without serum. Oxygen
consumption was evaluated for cellular ROUTINE respiration, oligomycin-inhibited LEAK
respiration, FCCP-stimulated uncoupled respiration capacity (ETS) and rotenone/antimycin-
inhibited residual respiration (ROX). Respiration via mitochondrial complexes was
evaluated using digitonin-permeabilised cells suspended in the mitochondrial respiration
medium MiR06, and oxygen consumption was evaluated for CI-linked respiration, (CI+CII)-
linked respiration, maximum uncoupled respiration, CII-linked uncoupled respiration as
well as residual oxygen consumption. Respiration via CI and CII was evaluated in the
presence of the proper substrates and inhibitors of the other complex. The results were
normalized to the number of cells.
Respiration of tumour tissue was assessed basically as above. Following sacrifice of mice,
tumours and livers (used as internal control) were excised and homogenized using the
SG3 Shredder (Oroboros). The final cell suspension in the chamber contained 2 to 3 mg/
ml of wet tissue. Mitochondrial respiration via CI or CII was evaluated as mentioned
above.
Dong et al. eLife 2017;6:e22187. DOI: 10.7554/eLife.22187 19 of 22
Research article Cancer Biology
Appendix 1—figure 1. Validation of the sc/ddPCR assay for the tRNA locus. Parental mtDNA
(about 20,000 copies) was spiked with 1000; 100; 10 and 1 copy of host mtDNA.
Respectively, this corresponds to the expected fractions of 5; 0.5; 0.05% and 0.005%. Red
diamonds indicate the measured fractions. NTC is non-template control.
DOI: 10.7554/eLife.22187.007
Dong et al. eLife 2017;6:e22187. DOI: 10.7554/eLife.22187 20 of 22
Research article Cancer Biology
Appendix 1—figure 2. Tumour cells derived from primary tumour have restored mitochondrial
function. (A) B16, B16r
0
, B16r
0
SC, B16r
0
CTC and B16r
0
SCL cells were stained with
MitoTracker Red for mitochondria, EtBr for mtDNA and Hoechst 33342 for nuclei. (B) B16
sub-lines were probed using real-time (RT)PCR for expression of mtDNA and selected
genes encoded by nDNA and mtDNA. The data are mean values ±S.D. derived from three
individual experiments. (C) B16 sub-lines were subjected to SDS-PAGE followed by WB
using various IgGs. (D) Control cells and cycloheximide-treated cells (5 mM, time as shown
in the figure) were separated by SDS-PAGE and subjected to IgGs for selected
mitochondrial proteins. (E) B16 sublines were subjected to SDS-PAGE followed by WB
using anti-TFAM and anti-Tom20 IgG. Data shown are representative of three independent
experiments.
DOI: 10.7554/eLife.22187.008
Dong et al. eLife 2017;6:e22187. DOI: 10.7554/eLife.22187 21 of 22
Research article Cancer Biology
Appendix 1—figure 3. The efficiency of mitochondrial transfer during pair-wise co-culture of
MSC, B16 and B16r
0
was assessed by confocal imaging after 24 hr co-culture in vitro. The
donor mitochondria were labelled with MitoTracker Deep Red, a mitochondria targeted
stain (red), while putative recipient cells were stained with cytoplasmic stain, CFSE (green),
and the nucleus was stained with DAPI (blue). Cells were stained 2 hr prior to co-culture.
Panel Ashows representative images with separate colour channels for each co-culture
pair, as labelled. Panel Bshows Z stacks for the composite images. Panel Cdocuments
mitochondrial transfer from MSCs isolated from C57BL/6N
su9-DsRed2
mice with DsRed
mitochondria co-cultured with r
0
cells labelled with nBFP and pmGFP.
DOI: 10.7554/eLife.22187.009
Dong et al. eLife 2017;6:e22187. DOI: 10.7554/eLife.22187 22 of 22
Research article Cancer Biology
