Systemic administration of oleoylethanolamide protects from neuroinflammation and anhedonia induced by LPS in rats

Abstract

Background: The acylethanolamides oleoylethanolamide and palmitoylethanolamide are endogenous lipid mediators with
proposed neuroprotectant properties in central nervous system (CNS) pathologies. The precise mechanisms remain partly
unknown, but growing evidence suggests an antiinflammatory/antioxidant profile.
Methods: We tested whether oleoylethanolamide/palmitoylethanolamide (10mg/kg, i.p.) attenuate neuroinflammation
and acute phase responses (hypothalamus-pituitary-adrenal (HPA) stress axis stress axis activation, thermoregulation, and
anhedonia) induced by lipopolysaccharide (0.5mg/kg, i.p.) in rats.
Results: Lipopolysaccharide increased mRNA levels of the proinflammatory cytokines tumor necrosis factor-α, interleukin-
1β, and interleukin-6, nuclear transcription factor-κB activity, and the expression of its inhibitory protein IκBα in cytoplasm,
the inducible isoforms of nitric oxide synthase and cyclooxygenase-2, microsomal prostaglandin E2
synthase mRNA, and
proinflammatory prostaglandin E2
content in frontal cortex 150 minutes after administration. As a result, the markers of
nitrosative/oxidative stress nitrites (NO2
-
) and malondialdehyde were increased. Pretreatment with oleoylethanolamide/
palmitoylethanolamide reduced plasma tumor necrosis factor-α levels after lipopolysaccharide, but only oleoylethanolamide
significantly reduced brain tumor necrosis factor-α mRNA. Oleoylethanolamide and palmitoylethanolamide prevented
lipopolysaccharide-induced nuclear transcription factor-κB (NF-κB)/IκBα upregulation in nuclear and cytosolic extracts,
respectively, the expression of inducible isoforms of nitric oxide synthase, cyclooxygenase-2, and microsomal prostaglandin
E2
synthase and the levels of prostaglandin E2
. Additionally, both acylethanolamides reduced lipopolysaccharide-induced

Full text

Received: September 16, 2014; Revised: December 5, 2014; Accepted: December 15, 2014
© The Author 2015. Published by Oxford University Press on behalf of CINP.
International Journal of Neuropsychopharmacology, 2015, 1–14
doi:10.1093/ijnp/pyu111
Research Article
1
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://
creativecommons.org/licenses/by-nc/4.0/), which permits non-commercial re-use, distribution, and reproduction in any medium,
provided the original work is properly cited. For commercial re-use, please contact journals.permissions@oup.com
 
Systemic Administration of Oleoylethanolamide
Protects from Neuroinammation and Anhedonia
Induced by LPS in Rats
Aline Sayd, MSc; María Antón, MSc; Francisco Alén, PhD; Javier Rubén Caso,
PhD; Javier Pavón, PhD; Juan Carlos Leza, MD, PhD; Fernando Rodríguez de
Fonseca, MD, PhD; Borja García-Bueno, PhD; Laura Orio PhD
Department of Psychobiology, Faculty of Psychology, Complutense University, Complutense University of Madrid
(UCM), Madrid, Spain (Ms Antón, and Drs Alén, Rodríguez de Fonseca and Orio); Department of Pharmacology,
Faculty of Medicine, UCM, and Centro de Investigación Biomédica en Red de Salud Mental (CIBERSAM)), Madrid,
Spain (Ms Sayd, and Drs Leza and García-Bueno); Department of Psychiatry, Faculty of Medicine, UCM, and
Centro de Investigación Biomédica en Red de Salud Mental (CIBERSAM), Madrid, Spain (Dr Caso); UGC Salud
Mental, Instituto de Investigación Biomédica de Málaga, Hospital Regional Universitario de Málaga-Universidad
de Málaga, and Red de Trastornos Adictivos, Málaga, Spain (Drs Pavón and Rodríguez de Fonseca).
A.S., M.A., B.G.-B., and L.O.contributed equally to this work.
Correspondence: Laura Orio, PhD, Department of Psychobiology, Faculty of Psychology, Complutense University of Madrid, Campus de Somosaguas
s/n, 28223 Pozuelo de Alarcón, Madrid (email: lorio@psi.ucm.es.); and Borja García-Bueno, PhD, Department of Pharmacology, Faculty of Medicine,
Complutense University of Madrid, Ciudad Universitaria, 28480 Madrid, Spain (bgbueno@med.ucm.es).
Abstract
Background: The acylethanolamides oleoylethanolamide and palmitoylethanolamide are endogenous lipid mediators with
proposed neuroprotectant properties in central nervous system (CNS) pathologies. The precise mechanisms remain partly
unknown, but growing evidence suggests an antiinammatory/antioxidant prole.
Methods: We tested whether oleoylethanolamide/palmitoylethanolamide (10 mg/kg, i.p.) attenuate neuroinammation
and acute phase responses (hypothalamus-pituitary-adrenal (HPA) stress axis stress axis activation, thermoregulation, and
anhedonia) induced by lipopolysaccharide (0.5 mg/kg, i.p.) in rats.
Results: Lipopolysaccharide increased mRNA levels of the proinammatory cytokines tumor necrosis factor-α, interleukin-
1β, and interleukin-6, nuclear transcription factor-κB activity, and the expression of its inhibitory protein IκBα in cytoplasm,
the inducible isoforms of nitric oxide synthase and cyclooxygenase-2, microsomal prostaglandin E2 synthase mRNA, and
proinammatory prostaglandin E2 content in frontal cortex 150 minutes after administration. As a result, the markers of
nitrosative/oxidative stress nitrites (NO2
-) and malondialdehyde were increased. Pretreatment with oleoylethanolamide/
palmitoylethanolamide reduced plasma tumor necrosis factor-α levels after lipopolysaccharide, but only oleoylethanolamide
signicantly reduced brain tumor necrosis factor-α mRNA. Oleoylethanolamide and palmitoylethanolamide prevented
lipopolysaccharide-induced nuclear transcription factor-κB (NF-κB)/IκBα upregulation in nuclear and cytosolic extracts,
respectively, the expression of inducible isoforms of nitric oxide synthase, cyclooxygenase-2, and microsomal prostaglandin
E2 synthase and the levels of prostaglandin E2. Additionally, both acylethanolamides reduced lipopolysaccharide-induced

2 | International Journal of Neuropsychopharmacology, 2015
oxidative/nitrosative stress. Neither oleoylethanolamide nor palmitoylethanolamide modied plasma corticosterone levels
after lipopolysaccharide, but both acylethanolamides reduced the expression of hypothalamic markers of thermoregulation
interleukin-1β, cyclooxygenase-2, and prostaglandin E2, and potentiated the hypothermic response after lipopolysaccharide.
Interestingly, only oleoylethanolamide disrupted lipopolysaccharide-induced anhedonia in a saccharine preference test.
Conclusions: Results indicate that oleoylethanolamide and palmitoylethanolamide have antiinammatory/neuroprotective
properties and suggest a role for these acylethanolamides as modulators of CNS pathologies with a neuroinammatory component.
Keywords: OEA, PEA, lipopolysaccharide, neuroinammation, anhedonia
Introduction
Endogenous lipid transmitters derived from membrane precur-
sors are a current focus of investigation due to the wide range of
biological functions in which they participate, including modula-
tion of neurotransmitter release, neuroplasticity, synaptogenesis,
neurogenesis, brain information processing, and cellular ener-
getic systems (Orio etal., 2013). Fatty acid acylethanolamides are
endogenous lipid mediators with multiple physiological functions
that include the endocannabinoid anandamide (arachidonoyle-
thanolamide [AEA]) and the noncannabimimmetic compounds
N-oleoylethanolamide (OEA) and N-palmitoylethanolamide
(PEA). Though involved in different functions, the acylethanola-
mides share biosynthetic and degradative mechanisms. They are
synthesized on demand through a phospholipase D enzyme act-
ing on a membrane phospholipid precursor, which is synthesized
by a cAMP and Ca2+-dependent N-acyltransferase (Piomelli, 2003).
Upon its release, they experience reuptake by a catalytically silent
fatty acid amide hydrolase (FAAH)-1 variant (Fu etal., 2011) and
are degraded through enzymatic hydrolysis by a specic FAAH
(Schmid etal., 1985; Cravatt etal., 1996).
OEA and PEA are structurally related compounds that act
mainly thought the nuclear peroxisome proliferator-activated
receptor-alpha (PPAR-α) (Rodriguez de Fonseca etal., 2001; Fu
et al., 2003; Lo Verme et al., 2005; Di Cesare Mannelli etal.,
2013), although they might bind the transient receptor poten-
tial vanilloid type-1 (Overton etal., 2006; Almasi etal., 2008;
Godlewski etal., 2009), the G protein-coupled receptors GPR55
and GPR119 (Overton et al., 2006; Godlewski et al., 2009), or
other PPAR isoforms (Paternity etal., 2013; but see Fu et al.
2003; LoVerme et al., 2006). OEA is known as a satiety factor
(Rodriguez de Fonseca etal., 2001; Fu etal., 2003), and both PEA
and OEA act as analgesics in inammatory and neuropathic
pain (Lo Verme et al., 2005; Suardiaz et al., 2007; Di Cesare
Mannelli etal., 2013).
Growing evidence indicates that OEA and PEA may have
neuroprotective properties in neurological disorders such as
stroke (Sun etal., 2007; Zhou etal., 2012; Ahmad etal., 2012a),
traumatic brain injury (Ahmad et al., 2012b), Parkinson´s dis-
ease (Gonzalez-Aparicio et al., 2013; Gonzalez-Aparicio and
Moratalla, 2013), or addiction (Melis etal., 2008; Plaza-Zabala
etal., 2010; Bilbao etal., 2013; Coppola and Mondola, 2013). Some
of the mechanisms implicated are the modulation of antioxi-
dant responses, neuroinammation, glial cell proliferation/dif-
ferentiation, neurogenesis, and neurotransmission.
Given the signicance and complexity of neuroinamma-
tion in the physiopathology of central nervous system (CNS)
diseases, we studied the role of OEA and PEA as modulators of
the inammatory/immune response after a lipopolysaccharide
(LPS) challenge. LPS is a component of the outer membrane on
gram-negative bacteria that is extensively used for neuroin-
ammation modeling. Systemic LPS injection to experimental
animals elicits a multisystemic response that includes immune,
endocrine, metabolic, and behavioral components known as
the acute-phase response and sickness behavior (Hart, 1988;
Konsman etal., 2002; Kushner and Rzewnicki, 1997).
We tested the efcacy of OEA and PEA to modulate the canon-
ical proinammatory pathway triggered by the activation of the
nuclear factor-κB (NF-κB) (Madrigal etal., 2001) after LPS and eval-
uated the acute-phase responses described as activation of hypo-
thalamo-pituitary axis (HPA) (increases in plasma corticosterone),
changes in hypothalamic markers of thermoregulation (interleu-
kin [IL]-1β, cyclooxygenase [COX]-2, and prostaglandin [PG]E2),
and behavioral malaise (by checking motivational behavior).
Methods
Animals
Ninety-four male outbred Wistar Hannover rats (HsdRccHan:Wist,
from Harlan, Spain), weighing 350 to 400 g, were housed in
groups (n = 5–6) and maintained at a constant temperature of
24 ± 2°C at a relative humidity of 70 ± 5% in a 12-hour light–dark
cycle (lights on at 8:00 ). Animals were fed a standard pellet
chow (A04 SAFE, Scientic Animal Food and Engineering, Augy,
France) with free access to fresh tap water and were maintained
under constant conditions for 10days prior to experiments.
All experimental protocols were approved and followed the
guidelines of the Animal Welfare Committee of the Universidad
Complutense of Madrid according to European legislation
(2010/63/UE).
Drug Administration
LPS (serotype O111:B4, ref. L2630 Sigma, Spain) was dissolved
in saline and injected i.p. at 0.5 mg/kg. THe dose was chosen
according to previous reports to induce neuroinammation
(MacDowell etal., 2013). OEA (10 mg/kg, i.p.; synthesized in our
laboratory; Giuffrida etal., 2000) and PEA (10 mg/kg, i.p.; Tocris,
Spain) were dissolved in vehicle (5% Tween 80 in saline) and
injected 10 minutes before LPS administration. The doses were
chosen according to previous studies in rodents reporting anti-
inammatory/neuroprotective effects (Plaza-Zabala etal., 2010;
Ahmad etal., 2012a, 2012b; Zhou etal., 2012).
Tissue Samples and Plasma Collection
Brain tissue samples were taken 150 minutes after LPS injec-
tion using a lethal dose of sodium pentobarbital (300 mg/kg, i.p.,
Dolethal, Spain). The timing of sacrice after LPS was chosen on
the basis of previous studies showing an NF-κB-dependent pro-
inammatory response in the frontal cortex of Wistar rats at this
time point (Perez-Nievas etal., 2010; MacDowell etal., 2013). Brains
were isolated from the skull, and meninges and blood vessels were
carefully discarded. The frontal cortex and hypothalamus were
excised and frozen at -80°C until assayed. Blood was collected by

Sayd et al. | 3
cardiac puncture using trisodium citrate (3.15% wt/vol) as antico-
agulant. Plasma was obtained by blood centrifugation (2000 g) 15
minutes at 4°C and stored at -20°C until determinations.
Rat brain frontal cortex was chosen because of its high lev-
els of proinammatory/antiinammatory mediators and its
susceptibility to the neuroinammatory process elicited by LPS
(Garcia-Bueno et al., 2008) and because this brain area is an
important neural substrate for the regulation of the HPA axis
response to an immune/inammatory challenge (Radley etal.,
2006). Hypothalamus is the main brain area involved in ther-
moregulation and fever (Saper, 1998).
Preparation of Nuclear and Cytosolic Extracts
A modied procedure based on the method of Schreiber and col-
leagues (Schreiber etal., 1989) was used. Briey, brain frontal cortex
and hypothalamus samples were homogenized in 300L buffer
(10 mmol/L N-2-hydroxyethyl piperazine-N-2-ethanesulfonic
acid (pH 7.9); 1mmol/L ethylenediamine tetraacetic acid (EDTA),
1 mmol/L ethylene glycol tetraacetic acid (EGTA), 10 mmol/L
KCl, 1 mmol/L dithiothreitol, 0.5 mmol/L phenylmethylsulfo-
nyl uoride, 0.1 mg/mL aprotinin, 1 mg/mL leupeptin, 1 mg/mL
Nap-tosyll-lysine-chloromethyl ketone, 5 mmol/L NaF, 1mmol/L
NaVO4, 0.5 mol/L sucrose, and 10mmol/L Na2MoO4). After 15 min-
utes, 0.5 % Nonidet P-40 (Roche, Mannheim, Germany) wasadded.
The tubes were vortexed and nuclei were collected by cen-
trifugation at 8000 g for 5 minutes. Supernatants were consid-
ered as the cytosolic fraction. The pellets were resuspended in
100L buffer supplemented with 20% glycerol and 0.4 mol/L KCl
and shaken for 30 minutes at 4°C. Nuclear protein extracts were
obtained by centrifugation at 13 000 g for 5 minutes, and aliquots
of the supernatant were stored at -80°C. All steps of the frac-
tionation were carried out at 4°C.
Western-Blot Analyses
To determine the expression levels of the enzymes inducible
nitric oxide synthase (iNOS) and COX-2, brain frontal cortices
and hypothalamus were homogenized by sonication in 400L
of phosphate-buffered saline (pH = 7) mixed with a protease
inhibitor cocktail (Complete, Roche, Madrid, Spain) followed by
centrifugation at 12 000 g for 10 minutes at 4°C. After adjusting
protein levels in the supernatants, homogenates were mixed
with Laemmli sample buffer (Bio Rad, CA) and 10L (1 mg/mL)
was loaded into an electrophoresisgel.
Membranes were blocked in 10 mM Tris-buffered saline
containing 0.1% Tween-20 and 5% skimmed milk/bovine
serum albumin (BSA) and incubated with specic primary
antibodies:IκBα (rabbit polyclonal antibody against an epitope
mapping at the C-terminus of IκBα of human origin; dilution
1:1000 in 5% skimmed milk in BSA, Santa Cruz Biotechnology,
CA); iNOS (rabbit polyclonal antibody against a peptide mapping
at the amino terminus of iNOS of human origin; dilution 1:1000
in TBS-Tween, Santa Cruz Biotechnology, CA); COX-2 (goat poly-
clonal antibody against a peptide mapping at the C-terminus of
COX-2 of human origin; dilution 1:750 in 5% BSA in TBS-Tween,
Santa Cruz Biotechnology, CA). After washing with Tween 20,
the membranes were incubated with the respective horserad-
ish peroxidase-conjugated secondary antibodies for 90 minutes
at room temperature. Blots were imaged using an Odyssey Fc
System (Li-COR Biosciences), quantied by densitometry (NIH
ImageJ software), and expressed in arbitrary units of optical
density. The housekeeping gene β-actin was used as loading
control.
Real Time-Polymerase Chain Reaction Analysis
Total cytoplasmic RNA was prepared from samples of frontal
cortex or hypothalamus using TRIZOL reagent (Invitrogen, Grand
Island, NY); aliquots were converted to complementary DNA
using random hexamer primers. Quantitative changes in mRNA
levels were estimated by real time-polymerase chain reaction
(RT-PCR) using the following cycling conditions: 35 cycles of
denaturation at 95°C for 10 seconds, annealing at 58–61°C for 15
seconds depending on the specic set of primers, and extension
at 72°C for 20 seconds. Reactions were carried out in the presence
of SYBR green (1:10 000 dilution, Molecular Probes, Eugene, OR)
in a 20-L reaction in a Rotor-Gene (Corbett Research, Mortlake,
Australia). The primers used were to detect IL-1β, IL-6, TNF-α,
NF-κB p65 subunit, IκBα, iNOS, COX-2, and m-PGES-1 (sequence
details in Table 1). Relative mRNA concentrations were obtained
by comparing the take-off point of the different samples using
the software provided in the unit. It establishes an inverse cor-
relation between the number of cycles before take-off and the
concentration of mRNA, while assigning arbitrary units to the
results. Tubulin and GADPH primer levels were used to normalize
data (results are shown using tubulin normalization).
Plasma Cytokine Determination
IL- 1β and TNF-α plasma levels were determined using com-
mercially available enzyme-linked immunosorbent assays
(RayBiotech). Plasma samples were 1:2 diluted and assayed
following the manufacturer´s guidelines. Quantication
was performed using a standard curve of increasing
cytokines´concentrations. The optical density was measured
Table1. RT-PCR Primer Sequence Details
Forward Primers (3’-5’) Reverse Primers (5’-3’)
IL-1βACCTGCTAGTGTGTGATGTTCCCA AGGTGGAGAGCTTTCAGCTCACAT
IL-6 AAGCTGAGCGACGAGTACAAGA GTCAGCTCCAGCACCTTGTG
TNF-αCTGGCCAATGGCATGGATCTCAAA ATGAAATGGCAAATCGGCTGACGG
NFκB p65 CATGCGTTTCCGTTACAAGTGCGA TGGGTGCGTCTTAGTGGTATCTGT
IκBαTGGCCTTCCTCAACTTCCAGAACA TCAGGATCACAGCCAGCTTTCAGA
iNOS GGACCACCTCTATCAGGAA CCTCATGATAACGTTTCTGGC
COX-2 CTTCGGGAGCACAACAGAG GCGGATGCCAGTGATAGAG
m-PGES-1 GGTGAAGCAAATGTTCCCAGCTCA TTTAGCGGTTGGTCAAAGCCCATC
Tubulin CCCTCGCCATGGTAAATACAT ACTGGATGGTACGCTTGGTCT
GAPDH TGCACCACCAACTGCTTAGC GGCATGGACTGTGGTCATGAG
Abbreviations: COX, cyclooxygenase; IL, interleukin; iNOS, inducible nitric oxide synthase; m-PGES-1, microsomal prostaglandin E2 synthase; NF, nuclear factor; RT-
PCR, real time-polymerase chain reaction; TNF, tumor necrosis factor.

4 | International Journal of Neuropsychopharmacology, 2015
using a microplate reader (Synergy 2; BioTek Instruments) set
to 450 nm. The sensitivities of the assays were <80 pg/mL for
IL-1β and <25 pg/mL for TNF-α. Intra-assay and inter-assay coef-
cients of variation were <10% and 12%, respectively, for both
kits.
Nitrites (NO2
-)Levels
As the stable metabolites of the free radical nitric oxide (NO•),
NO2
- were measured by using the Griess method (Green etal.,
1982). In an acidic solution with 1% sulphanilamide and 0.1%
N-(1-Naphthyl)ethylenediamine (NEDA), nitrites convert into a
pink compound that is photometrically calculated at 540 nm in
a microplate reader (Synergy 2; BioTek).
Lipid Peroxidation
Lipid peroxidation was measured by a modication of the
method of Das and Ratty (1987), whereby the thiobarbituric acid
reacting substances, predominantly malondialdehyde (MDA),
produced as a secondary product were quantied by use of
the 2-thiobarbituric acid (TBA) color reaction. Brain tissue was
homogenized in 10 volumes (wt/vol) of sodium phosphate buffer
(pH 7.4). Assays contained tissue homogenate, trichloroacetic
acid (40% wt/vol), HCl (5 M), and TBA (2% wt/vol). Samples were
heated for 15 minutes at 90°C and centrifuged at 12 000 g for 10
minutes. The MDA-TBA adduct (pink chromogen) of the super-
natant was measured spectrophotometrically (532 nm) and the
MDA concentration calculated by use of a standard curve pre-
pared with MDA tetra-butylammonium salt. The results were
expressed as nmol/mg protein.
Plasma Corticosterone
Corticosterone was measured in plasma by using a commer-
cially available kit by RIA Coat-a-Count (Siemens, Los Angeles,
CA). A gamma counter (Wallac Wizard 1470, Perkin Elmer,
Waltham, MA) was used to measure radioactivity of the sam-
ples. The time of blood extraction and plasma collection oscil-
lated between 1:00  and 3:00 .
NF-κB Transcription FactorAssay
NF-κB transcription factor activity was determined in nuclear
extracts by using an enzyme-linked immunosorbent assay-
based kit (Cayman Chemicals, Tallin, Estonia). Nuclear extracts
were incubated with specic NF-κB p65 subunit response ele-
ment probes, and p65 bound to its response element probe
was detected using a specic antibody against this subu-
nit. Horseradish peroxidase-labeled secondary antibody was
added and the binding was detected by spectrophotometry.
Measurement was performed according to the manufacturer’s
instructions. This assay is specic for p65 activation, and it does
not cross-react with other NF-κB subunits, such as p50.
PGE2 Determination
PGE2 levels were measured by commercially available enzyme
immunoassay (PGE2 EIA Kit-Monoclonal; Cayman Chemical,
Tallin, Estonia). Samples were sonicated in 400 mL homogeni-
zation buffer (0.1 M phosphate buffer, pH = 7.4, 1 mM EDTA, and
10 mM indomethacin), puried in 4 volumes ethanol for 5 min-
utes at 4°C, centrifuged at 3000 g for 10 minutes, and acidied
with glacial extracted using SPE (C-18) acetic acid (pH = 3.5). PGE2
was extracted using SPE (C-18) columns (Waters, MA) rinsed
with methanol and water. After sample´s application, columns
were washed with water and hexane and PGE2 was eluted with
ethyl acetate. Samples were evaporated to dryness under nitro-
gen and resuspended in enzyme immunoassay buffer. PGE2
levels were measured in a 96-well plate and read at 405 nm
following the manufacturer’s instructions (Synergy 2; BioTek
Instruments). The sensitivity of the assay for PGE2 was 15 pg/
mL; intra- and interassay coefcients of variation were 6.6% and
15.5%, respectively.
ProteinAssay
Protein levels were measured using the Bradford method
(Bradford, 1976).
Measurement of Rectal Temperature
Rectal temperature was measured by the use of a digital read-
out thermocouple (BAT12 thermometer, Physitemp) with a reso-
lution of 0.1°C accuracy of ±0.1°C attached to a RET-2 Rodent
Sensor, which was inserted 2.5 cm into the rectum of the rat,
the animal being lightly restrained by holding it in the hand of a
trained individual to avoid stress-confounding factors. Asteady
readout was obtained within 10 seconds of probe insertion.
Saccharine PreferenceTest
Rats fed ad libitum were housed individually and were offered
a free choice between 2 bottles located in the cages in a ran-
dom manner, one with a 0.1% saccharin solution and another
with tap water, during the time of the experiment (30 hours).
Separated groups of animals were used to test the thermic
response and the preference for saccharine. The consumption
of water and saccharin solution was recorded at specic time
intervals after pharmacological treatments. The preference for
saccharin was calculated as consumed saccharin solution/total
uid intake. No previous food or water deprivation was applied
before the test.
Statistical Analyses
Data in text and gures are expressed as mean ± SEM. Data were
analyzed by 2-way ANOVA comparing 2 factors: inammation
(vehicle or LPS) and pretreatment (vehicle, OEA, PEA), followed
by Bonferroni posthoc test when appropriate. Data on sac-
charine preference test, total uid intake, and rectal tempera-
tures were analyzed by 2-way repeated-measures ANOVA using
treatment as a between-subjects factor and time as a repeated
measure, followed by Bonferroni posthoc test. The behavioral
experiments (rectal temperatures and saccharine preference
test) and Western blots were performed independently for OEA
and PEA, so the 2-way ANOVA were run accordingly (reported in
results in this order: OEA and PEA). Additionally, in the behav-
ioral experiments, we ran a 2-way ANOVA comparing the 2 fac-
tors (inammation and pretreatment) at specic time points of
the temporal curves: we chose 1 hour and 3 hours after LPS in
the temperature curves, since the hypothalamic markers were
studied at a time in between (2.5 hours); in the saccharine pref-
erence test, we chose the last time point of the test (30 hours),
since it represents an accumulated measure over time. AP value
≤ .05 was considered statistically signicant. Data were analyzed
using GraphPad Prism version 5.04 (GraphPad Software Inc., San
Diego, CA).

Sayd et al. | 5
Results
Effect of OEA and PEA on Proinammatory
Cytokines in FrontalCortex
LPS administration increased mRNA expression of the proin-
ammatory cytokines TNF-α (Figure 1a; F(1,19) P = 5.97, P = .0245),
IL-1β (Figure 1B; F(1,24) P = 10.34, P = .0037), and IL-6 (Figure 1C;
F(1,19) P = 22.93, P = .0001) in frontal cortex 150 minutes after admin-
istration. Pretreatment with OEA signicantly reduced the
increase in TNF-α mRNA levels induced by LPS (interaction effect:
F(2,19) P = 6.177) and had no signicant effect on IL-1β and IL-6 in the
presence or absence of LPS. Although PEA reduces LPS-induced
increase in TNF-α and IL-1β (but not IL-6) mRNA, posthoc test
revealed that these effects failed to reach statistical signicance.
To test whether the CNS effects of acylethanolamides may be
affected by peripheral modulation of circulating cytokines, we
measured TNF-α and IL-1β in plasma after treatments. Figure1D
(graph box) shows that both OEA and PEA modied the increase
in plasma TNF-α observed after LPS injection (interaction effect
F(2,67) P = 4.968; P = .0097). Levels of plasma IL-1β were not affected
by the treatments (data not shown).
Effect of OEA and PEA in the Activation of
Proinammatory NF-κB
The release of proinammatory cytokines TNF-α, IL-1β, and IL-6
after LPS may account for NF-κB activation, so we studied the
mRNA expression and activity of NF-κB proinammatory subu-
nit p65 (Figure2A-B) and its inhibitory protein IκBα (Figure2C-
E). LPS increased p65 subunit (F(1,18) P = 13.37, P = .0011) in nuclear
extracts of frontal cortex, which is inhibited by OEA pretreat-
ment at the level of mRNA (Figure2A; F(2,16) P = 12.54, P = .0009) and
activity (Figure2B; interaction effect F(2,15) P = 5.313, P = .0180). PEA
administration reduced the p65 mRNA expression (Figure 2A;
F(2,15) P = 5.313, P = .018) but had no signicant effect in the activ-
ity assay (Figure2B; F(2,18) P = .7028, P = .5108). LPS also induced an
upregulation of IκBα mRNA (Figure2C; F(1,20) P = 25.60, P < .0001) and
Figure1. Proinammatory cytokines in frontal cortex (and plasma). Real time-polymerase chain reaction (RT-PCR) analysis of tumor necrosis factor (TNF)-α (A), inter-
leukin (IL-)1β (B), and IL-6 (C) mRNAs in frontal cortex 150 minutes after lipopolysaccharide (LPS) administration. Data (n = 4–7 per group) are normalized by tubulin and
are presented as means ± SEM. Data in D (graph box) represents plasma levels of TNF-α measured by ELISA. Different from control group: *P < .05, **P < .01; different
from vehicle + LPS rats: #P < .05 (2-way ANOVA followed by Bonferroni posthoc test).

6 | International Journal of Neuropsychopharmacology, 2015
protein expression (F(1,13) P = 22.79, P = .0008) in cytosolic extracts
that was prevented by PEA (F(2,20) P = 4.943, P = .0187) at the level
of mRNA. Pretreatment with OEA reduced IκBα protein expres-
sion in LPS-treated animals (interaction effect (F(1,13) P = 39.48, P
< .0001), whereas PEA had no signicant effect at proteinlevel.
Proinammatory Enzymes (COX-2 and iNOS): Effect
of OEA andPEA
NF-κB regulates the expression of genes involved in the accumu-
lation of oxidative/nitrosative and inammatory mediators after
LPS exposure. Among others, 2 main sources of these media-
tors dependent on NF-κB are iNOS and COX-2. LPS induced an
increase in iNOS protein expression (F(1,13) P = 5.221, P = .0482) that
was prevented by OEA (Figure3A; interaction effect: F(1,13) P = 6.112,
P = .0354) and by PEA (Figure3B; interaction effect: F(1,13) P = 14.68,
P = .004). Both acylethanolamides reduced iNOS mRNA expression
in the LPS-treated condition (Figure 3C; interaction effect (F(2,20)
P = 10.44, P = .0013). Similarly, LPS-induced COX-2 upregulation (F(1,
10) P = 13.97, P = .0057) was blocked by the respective preadministra-
tion of OEA and PEA (Figure3D-E, interaction effects: F(1, 10) P = 61.66,
P < .0001 and F(1,11) P = 9.388, P = .0135). COX-2 mRNA levels remain
unchanged in all treatments at this time point (data not shown).
Brain COX-2 and iNOS Main Products: PGE2 Synthesis
and NO2
- Accumulation. Effect of OEA andPEA
The presumed major iNOS and COX-2 brain products, NO and
PGE2, respectively, are potent oxidant/proinammatory mol-
ecules that have been directly related to cellular damage/death
in multiple CNS pathologies.
PGE2 is synthesized by a multienzymatic pathway in which
the specic enzyme microsomal prostaglandin E2 synthase
(mPGES-1) is the last step (Ivanov and Romanovsky, 2004). LPS
increased mPGES-1 mRNA (Figure4A; F(1,20) P = 70.19, P < .0001) and
PGE2 production (Figure4B; F(1,22) P = 9.574, P = .063) in cortical tissue.
As can be observed in Figure4A-B, both OEA and PEA prevented
the LPS-induced upregulation of mPGES-1 and PGE2 (interaction
effects: F(2, 20) P = 13.20, P = .0004 and (F(2, 20) P = 3.074, P = .0711).
Figure4C shows the accumulation of the main NO metabo-
lite, NO2
-, after LPS (F(1, 19) P = 5.692, P = .0276) that was prevented
by pretreatment with both OEA and PEA (main effect of pretreat-
ment (F(2, 19) P = 6.203, P = .0084; interaction F(2, 19) P = .4733, P = .63).
Lipid Peroxidation: Effect of OEA andPEA
As a marker of cellular damage elicited by oxidative/nitrosa-
tive stress, lipid peroxidation was assessed by measuring MDA
accumulation. Figure4D shows that OEA and PEA pretreatments
prevented the LPS-induced overaccumulation of MDA in frontal
cortex (effect of pretreatment F(2, 19) P = 10.57, P = .0008 and inter-
action F(2, 19) P = 4.009, P = .0353).
Effects of OEA and PEA on Plasma
CorticosteroneLevels
The quantication of plasma corticosterone levels at the time
of blood extraction (1:00-3:00 ) revealed an expected corticos-
terone increase in LPS-injected animals (F(1, 24) P = 18.29, P = .0003).
The LPS-induced increase in corticosterone levels rose in 42%
over control values (control: 244.10 ± 13.8 ng/mL). Interestingly,
at that time point, neither OEA (51.3% over controls) nor PEA
(57.57% over controls) prevented the increase in corticosterone
induced by LPS, suggesting that the mechanism of these com-
pounds modulating neuroinammation is independent of sys-
temic corticosterone levels (Table2).
Figure2. Nuclear factor (NF)-κB proinammatory subunit p65 and its inhibitory protein IκBα in frontal cortex. A) Real time-polymerase chain reaction (RT-PCR) analysis
of the proinammatory p65 subunit of NF-κB in nuclear extracts. (B) Activity of NF-κB p65 subunit in nuclear extracts. (C) RT-PCR analysis of the NF-κB inhibitory protein
IκBα in cytosolic extracts. (D) Western-blot and densitometric analysis of IκBα after oleoylethanolamide (OEA) pretreatment. (E) Western-blot and densitometric analy-
sis of IκBα after palmitoylethanolamide (PEA) pretreatment. Data (n = 3–5) on RT-PCR and Western blot are normalized by tubulin and β-actin. Different from control
group: *P < .05, ***P < .001; different from vehicle + lipopolysaccharide (LPS) rats: #P < .05, ##P < .01 (2-way ANOVA followed by Bonferroni posthoc test).

Sayd et al. | 7
Hypothalamic Markers of Thermoregulation: Effects
of OEA andPEA
As another acute-phase response after LPS administration, we
studied the expression of molecular markers related with tem-
perature regulation in the hypothalamus.
The pyrogenic and proinammatory cytokine IL-1β increased
its mRNA up to 6 times in hypothalamus after LPS administra-
tion (F(1, 26) P = 14.62, P = .0007), and this increase was blocked
by OEA and PEA pretreatments (Figure 5A; interaction effect:
F(2, 26) P = 4.982, P = .0147). Similarly, LPS induced an upregula-
tion of COX-2 mRNA in hypothalamus (Figure5B; F(1, 25) P = 12.60,
P = .0016) that was prevented by OEA and PEA (interaction effect:
F(2, 25) P = 8.285, P = .0017).
PGE2, one of the major COX-2 products, is presumably a
mediator of temperature deregulation after LPS (Ivanov and
Romanovsky, 2004). As represented in Figure 5C-D, OEA and
PEA prevented the mRNA upregulation of its synthesis enzyme
mPGES-1 (interaction effect: F(2,28) P = 5.950, P = .0070) and the PGE2
accumulation (interaction: F(2,20) P = 6.132, P = .0113) induced by
LPS in hypothalamus, suggesting an involvement of both acyle-
thanolamides in the acute-phase responses of LPS related with
body temperature regulation.
Thermic Response
Figure 5E and F show the temperature deregulation after LPS
injection. Three basal temperatures were recorded every 30 min-
utes before LPS administration. The media of the 2 rst basal
temperatures (t = -1.0 hour and -0.5 hour) was represented as
“B” in the gures. Arrow indicates time of LPS injection. Basal
temperatures immediately before LPS injection (t = 0) did not
differ signicantly between groups of treatments (F(3,23) P = .58,
P = .65, n.s., and F(3,20) P = 1.15, P = .037, n.s., for OEA (Figure 5E)
and PEA (Figure5F) experiments, respectively). Analysis of the
temperature temporal curves by repeated measures 2-way
Figure3. Effect of acylethanolamides in lipopolysaccharide (LPS)-induced inducible isoforms of nitric oxide synthase (iNOS) and cyclooxygenase (COX)-2 expression.
(A) Western-blot and densitometric analysis of iNOS after oleoylethanolamide (OEA) pretreatment. (B) Western-blot and densitometric analysis of iNOS after palmitoy-
lethanolamide pretreatment. (C) Real time-polymerase chain reaction (RT-PCR) analysis of iNOS after OEA and PEA pretreatments. (D) Western- blot and densitometric
analysis of COX-2 after OEA pretreatment. (E) Western-blot and densitometric analysis of COX-2 after PEA pretreatment. Data (n = 3–5) are represented as means ±
SEM. Different from control group: *P < .05, **P < .01, ***P < .001; different from vehicle + lipopolysaccharide (LPS): #P < .05, ##P < .01, ###P < .001 (2-way ANOVA followed by
Bonferroni posthoc test).

8 | International Journal of Neuropsychopharmacology, 2015
ANOVA showed interactions between time and treatment (F(15,95)
P = 6.696, P < .0001 and F(15,60) P = 14.60, P <. 0001)and main effects
of time (F(5,95) P = 19.0, P < .0001 and F(15,60) P = 27.12, P <. 0001)and
treatment (F(3,95) P = 4.91, P = .0108 and F(3,60) P = 51.35, P < .0001).
Additional analyses revealed that LPS induced a hypothermic
response immediately after the injection and up to 3 to 6 hours
posttreatment. Two-way ANOVA at specic time points revealed
that pretreatments with OEA and PEA potentiated the hypother-
mic response 60 minutes after LPS (F(1,20) P = 40.25, P < .0001 and
(F(1,12) P = 33.31, P < .0001) (Figure5E-F).
Saccharine PreferenceTest
The saccharine preference test was used to evaluate moti-
vational behavior. A decrease in the preference for a natural
reward (sucrose or saccharine) is reective of anhedonia, which
is a core symptom of a depressive-like state (Willner etal., 1987)
and considered part of the sickness behavior after LPS adminis-
tration (Yirmiya, 1996).
Repeated-measures 2-way ANOVA (Figure 6A and B,
respectively) found an overall interaction between time and
treatments (F(15,100) P = 3.625, P < .0001 and F(15,220) P = 5.011, P <.0
001)and main effects of time (F(5,100) P = 9.904, P < .0001 and F(5,220)
P = 3.83, P = .0024) and treatment (F(3,100) P = 7.443, P = .0077 and
F(3,220) P = 19.17, P < .0001). Subsequent analyses revealed that, as
reected in Figure6, LPS injection induced a gradual decrease in
the preference for a saccharine solution (from 3–8 hours up to 30
hours postadministration). Pretreatment with OEA (Figure6A) to
LPS-injected rats restored the preference for saccharine to the
level of controls at any time point, whereas PEA pretreatment
(Figure 6B) had no effect in this motivational test. The com-
parison between the factors inammation and pretreatment by
2-way ANOVA at the time point of 30 hours posttreatment (see
statistical methods) revealed a main effect of OEA pretreatment
in LPS conditions (F(1,20) P = 25.92, P < .0001) and no effect of PEA in
the same condition (F(1,44) P = .012, P = .92,n.s.).
The total amount of liquid (water + saccharine solution)
drunk by the animals in this test differs signicantly between
control and LPS-treated animals. OEA or PEA did not modify this
LPS-induced effect (Table3).
Discussion
Recent studies have demonstrated that PEA and OEA endogenous
levels are regulated in several CNS pathologies (Baker etal., 2001;
Hansen etal., 2001; Schabitz etal., 2002; Berger etal., 2004; Degn
etal., 2007; Bisogno etal., 2008; Hill etal., 2009; Hauer etal., 2013)
and in acute inammatory conditions induced by LPS (Balvers
etal., 2012). Because of the proposed homeostatic protective role
for both bioactive lipids, this acute response could be considered
as part of an antiinammatory protective homeostatic response
regulating cell survival and damage (Fidaleo etal., 2014). Herewith,
to further investigate the role of both acylethanolamides as a pos-
sible homeostatic mechanism in the brain, we decided to explore
whether their exogenous administration might serve as a new
neuroprotective pharmacologic manoeuvre.
Our study provides new evidence of the brain antiinam-
matory properties of OEA and PEA in a model of neuroinam-
mation in vivo. Our previous data indicate that OEA crosses the
Table2. Plasma Corticosterone Levels. The values of corticosterone
obtained in basal conditions (244.10 ± 13.8 ng/mL) were in accordance
with the kit manufacturer’s expected values in adult male Wistar
rats. Lipopolysaccharide (LPS) increased plasma levels of corticoster-
one compared with control animals. Pretreatment with oleoyletha-
nolamide (OEA) or palmitoylethanolamide (PEA) did not modify the
LPS-induced increase in corticosterone. The time of blood extraction
oscillated between 1:00 and 3:00 . Data are presented as means ±
SEM with n = 5 for each group of treatment.
Treatment Corticosterone (ng/mL)
Vehicle + saline 244.10 ± 13.80
OEA + saline 259.17 ± 32.94
PEA + saline 272.96 ± 25.72
Vehicle + LPS 346.64 ± 11.39
OEA + LPS 369.34 ± 35.22
PEA + LPS 384.64 ± 28.50
Figure4. Prostaglandin (PG)E2 synthesis and release, nitrite accumulation, and lipid peroxidation in frontal cortex. (A) Real time-polymerase chain reaction (RT-PCR)
analysis of the PGE2 synthesis enzyme microsomal prostaglandin E2 synthase (mPGES-1). (B) PGE2 levels measured by enzyme immunoassay. (C) NO2
- accumulation.
(D) Malondialdehide accumulation as marker of lipid peroxidation. Data (n = 3–6) are represented as means ± SEM. Different from control group: *P < .05, **P < .01, ***P <
.001; different from vehicle + lipopolysaccharide (LPS): #P < .05, ##P < .01, ###P < .001; different from palmitoylethanolamide (PEA) + saline: ƒP < .05 (2-way ANOVA followed
by Bonferroni posthoc test).

Sayd et al. | 9
blood-brain barrier and reaches the brain rapidly after i.p. admin-
istration. Specically, peripheral administration of OEA (20 mg/
kg, i.p.) induced an increase in the OEA dialysate concentration in
the dorsal striatum 20 minutes after injection (Gonzalez-Aparicio
etal., 2014). Other authors detected a sustained 2-fold increase in
OEA striatal levels over baseline for more than 2 hours after a sin-
gle i.p. administration of OEA (20 mg/kg), reaching the maximum
peak concentration around 15 minutes postinjection (Plaza-Zabala
etal., 2010). In both studies, the OEA concentration is within the
range reported to produce stimulation of PPAR-α receptor-depend-
ent transcription (120 nM) (Fu etal, 2003). PEA has been reported
to cross modestly the blood brain barrier after an oral dose
(Artamonov et al., 2005). Nevertheless, in the present study we
observed that OEA and PEA prevented the LPS-induced increase
in plasma TNF-α levels. These results, together with the studies
mentioned above, indicate that the antiinammatory effects of
OEA and PEA observed in the brain may be a consequence of the
modulation of peripheral inammation (ie, modulation of innate
immune TLR4 receptors) by these acylethanolamides and/or the
direct action in the CNS. Disregarding the mechanisms involved,
the brain is deeply affected by OEA and PEA pretreatments.
Here, we observed that OEA prevented LPS-induced increase
in cortical TNF-α mRNA levels and both acylethanolamides
reduced NF-κB activation, the expression of iNOS and COX-
2, accumulation of NO2
-, and lipid peroxidation in frontal cor-
tex. We supply further conrmation of this antiinammatory
mechanism by showing OEA and PEA reductions in LPS-induced
increases in mPGES-1 and PGE2 levels.
Figure5. Thermoregulation and its hypothalamic markers. Real time-polymerase chain reaction (RT-PCR) analysis of interleukin (IL)-1β (A), cyclooxygenase (COX)-2
(B), and microsomal prostaglandin E2 synthase (mPGES-1) (C), and protein levels of prostaglandin (PG)E2 (D) in the hypothalamus. Rectal temperatures of rats pretreated
with oleoylethanolamide (OEA) (E) and palmitoylethanolamide (PEA) (F). Biochemical data are means ± SEM (n = 3–5). Rectal temperature data for OEA (E) and PEA (F)
are represented as means ± SEM (n = 5–6). Arrows in temperature graphs indicate time of lipopolysaccharide (LPS) injection, “B” represents the mean of 2 rst basal
measures previous to LPS injection, and t = 0 represents the third basal measure right before treatment administration. Different from control group: *P < .05, **P < .01,
***P < .001; different from vehicle + LPS: #P < .05, ##P < .01, ###P < .001; different from OEA + saline group: øøP < .01, øøøP < .001; different from PEA + saline: ƒƒP< .01,ƒƒƒ P < .001
(biochemical data: 2-way ANOVA followed by Bonferroni posthoc test; behavioral data: repeated-measures 2-way ANOVA with Bonferroni posthoc test).

10 | International Journal of Neuropsychopharmacology, 2015
We also provide the rst evidence to our knowledge support-
ing a differential role for OEA and PEA inuencing the acute-
phase responses after LPS. Thus, OEA and PEA did not modify
the increase in plasma corticosterone levels elicited by LPS. In
the hypothalamus, OEA and PEA potently altered the expression
of IL-1β, COX-2, and PGE2, which are presumably mediators of
Figure6. Saccharine preference test. (A) Rats pretreated with oleoylethanolamide (OEA). (B) Rats pretreated with palmitoylethanolamide (PEA). Saccharine preference
was calculated as quantity of saccharine solution drunk/total uid intake and is an index of the motivational state of the animal. The gradual decrease in the prefer-
ence for a saccharine solution observed in LPS-injected rats reects an anhedonic state, which is totally prevented by pretreatment with OEA (A) but not by PEA (B). Data
(n = 6–12) are means ± SEM. Repeated-measures 2-way ANOVA with Bonferroni posthoc test: different from control: *P < .05, **P < .01, ***P < .001; different from vehicle
+ lipopolysaccharide (LPS): ##P < .01, ###P < .001; different from PEA+saline group: ƒP < .05; ƒƒƒP < .001.
Table3. Total Fluid Intake at Different Time Points in the Saccharine Preference Test (A) Pretreatment with oleoylethanolamide (OEA) in lipopoly-
saccharide (LPS) or vehicle-injected rats. (B) Pretreatment with palmitoylethanolamide (PEA) in LPS or vehicle-injected rats. Animals injected with
LPS decreased the total uid intake (water + saccharine solution) during the saccharine preference test (6–30 hours) independently of the pretreat-
ment with OEA (9–30 hours) (A) or PEA (6–30 hours) (B). Data are means ± SEM. Repeated-measures 2-way ANOVA with Bonferroni posthoc test for
Table3A and B, respectively: overall interactions between time and treatment (F(15,100) P = 8.399, P < .0001 and F(15,220) P = 31.14, P < .0001) and main effects
of time (F(5,100) P = 48.88, P < .0001 and F(5,220) P = 135.0, P < .0001) and treatment (F(3,100) P = 8.503, P = .0008 and F(3,220) P = 32.40, P < .0001). Different from con-
trol group: *P < .05, **P < .01, ***P < .001; different from OEA + saline group: øP < .05, øøP < .01, øøøP < .001; different from PEA + saline group: ƒƒƒP < .001.
Total Fluid Intake
A
Treatment/time 1 h 3 h 6 h 9 h 24 h 30 h
Vehicle + saline 5.08 ± 1.30 14.47 ± 3.55 22.33 ± 6.30 27.77 ± 8.20 34.02 ± 8.80 48.42 ± 12.30
OEA + saline 1.34 ± 0.55 15.2 ± 3.58 26.68 ± 5.29 33.45 ± 6.79 45.82 ± 9.66 57.12 ± 10.21
Vehicle + LPS 0.95 ± 0.53 1.27 ± 0.51 2.46 ± 0.75* 3.82 ± 0.78** 7.58 ± 2.29** 14.883 ± 1.94***
OEA + LPS 3.23 ± 1.12 4.35 ± 1.14 4.98 ± 1.18ø 5.58 ± 1.29*øø 6.90 ± 1.69*øøø 8.35 ± 2.02**øøø
Total Fluid Intake
B
Treatment/time 1 h 3 h 6 h 9 h 24 h 30 h
Vehicle + saline 8.68 ± 1.75 19.10 ± 3.04 40.71 ± 4.51 63.86 ± 6.12 87.65 ± 8.98 109.70 ± 11.08
PEA + saline 7.69 ± 3.58 14.96 ± 4.12 33.82 ± 5.34 49.93 ± 7.84 62.80 ± 9.99 83.81 ± 12.69
Vehicle + LPS 2.58 ± 0.67 2.83 ± 0.65 3.31 ± 0.71*** 4.37 ± 0.95*** 6.92 ± 1.79*** 11.45 ± 2.98***
PEA + LPS 2.33 ± 0.61 4.37 ± 1.47 3.31 ± 0.74***ƒ ƒ ƒ 4.26 ± 0.86***ƒ ƒ ƒ 7.79 ± 1.74***ƒ ƒ ƒ 15.24 ± 3.32***ƒ ƒ ƒ

Sayd et al. | 11
body temperature regulation, and they enhanced the hypother-
mic response 60 minutes after LPS administration. Interestingly,
at a behavioral level, only OEA affected the motivational state
of the animals by inhibition of LPS-induced anhedonia, dem-
onstrating that OEA might exert important roles in controlling
motivational processes (hedonic responses) as described for fat-
containing food (Rodriguez de Fonseca etal., 2001; Tellez etal.,
2013).
These selective effects of both acylethanolamides on LPS-
induced acute-phase responses might reect differential mech-
anisms of action that need to be further explored. OEA/PEA
binding to PPAR-α receptor may mediate these effects (Fidaleo
etal., 2014), but PPAR-α independent actions of these acylethan-
olamides cannot be ruledout.
The antiinammatory prole of both acylethanolamides has
been previously described in vitro, where OEA was shown to
reduce iNOS, COX-2, and the cytokines TNF-α and IL-6 in blood
vessels after LPS-induced LDL modication and inammation
(Fan et al., 2014) and in animal models of inammatory and
neurophatic pain (Lo Verme etal., 2005; Suardiaz etal, 2007; Di
Cesare Mannelli etal., 2013).
OEA and PEA blocked the expression and/or activity of the p65
subunit in cortical nuclear extracts, which mediates most of the
NF-κB transcriptional activity. LPS also increased the expression
of the NF-κB inhibitory protein IκBα in cytosolic extracts, which
can be considered an autoregulatory mechanism switched on by
NF-κB to block its stimulation, and was similarly prevented by
OEA and PEA pretreatments. Our results are in agreement with
other studies where PEA and OEA prevented IκBα degradation
and p65 NF-κB nuclear translocation in peripheral hyperalge-
sia (D’Agostino etal., 2009) and stroke injury (Sun etal., 2007;
Ahmad etal., 2012b).
Sickness behavior after LPS was evaluated by measurement of
the following acute-phase responses: activation of HPA axis, body
temperature regulation, and anhedonia. Activation of HPA axis
was checked by measurement of plasma corticosterone levels. LPS
induced an increase in plasma corticosterone that has been previ-
ously reported (Pérez-Nievas etal., 2010). However, neither OEA nor
PEA prevented the rise in corticosterone induced by LPS. Our results
are in agreement with a previous study in which the administra-
tion of URB597, a selective inhibitor of FAAH that enhances the lev-
els of AEA, OEA, and PEA, did not alter an LPS-induced increase in
plasma corticosterone (Kerr etal., 2012). However, the bidirectional
relationship between endocannabinoids and plasma glucocorti-
coids released in the stress response is well documented (Gorzalka
etal., 2008; Hill etal., 2010). It is necessary to develop more detailed
neuroendocrine studies regarding the time course of synthesis and
release of corticosterone and other stress hormones after LPS to
completely discard a role of noncannabinoid acylethanolamines in
the regulation of HPA axis activation.
Regarding temperature regulation, we observed a marked
hypothermia induced by LPS immediately after its administra-
tion and lasting between 3 and 6 hours. Our results are in agree-
ment with other studies reporting dose- and serotype-specic
effects of LPS: high doses (0.25 -0.5 mg/kg, i.p.) of E.coli O111:B4
induced a monophasic hypothermic response in rodents (Akarsu
and Mamuk, 2007). It is important to note that, although fever
is a most predicted response, hypothermia occurs in the most
severe cases of sepsis (Clemmer etal., 1992; Arons etal., 1999). It
has been suggested that the hypothermia in response to LPS is
caused by reduced thermogenesis, involves antipyretic products
released from peripheral macrophages, and is mediated by pros-
taglandins (Derijk RH etal., 1994). In our study, the onset of this
hypothermic response caused by LPS is around the time of sac-
rice of the animals (150 minutes). Biochemical determinations
revealed that, at this time point, LPS induced a marked increase
in pyretic molecules, such as IL-1β, COX-2, and PGE2 in the hypo-
thalamus, probably as a homeostatic mechanism to recover
normal temperature. Interestingly, OEA and PEA pretreatments
potentiated the hypothermic response 60 minutes after LPS.
Body temperature regulation is a highly preserved homeostatic
response that is probably difcult to maintain altered by a sin-
gle dose of these endogenous components. We observed robust
effects of both acylethanolamides preventing the LPS-induced
high increases in IL-1β, COX-2, mPGES-1 mRNAs, and PGE2 levels,
which strengthens our hypothesis of OEA and PEA attempting
to maintain the hypothermia induced by LPS. Hypothermia can
be understood as an adaptive response that enhances recov-
ery by conserving energy to combat acute inammation and
enhance survival (Leon, 2004; Maes etal., 2012). Recently, another
N-ethanolamide derived from fatty acids, commonly known as
the endocannabinoid AEA, has been involved in the LPS-induced
thermic response through action on CB1 receptors (Steiner etal.,
2011), and a role for COX-1 and not COX-2 has been suggested
for LPS-induced hypothermia (Steiner etal., 2009). Interestingly,
peripheral and brain AEA levels are elevated during the systemic
inammatory response to LPS (Liu etal., 2003; Fernandez-Solari
et al., 2006). However, Kerr and colleagues (2012) reported that
LPS failed to alter AEA, OEA, and PEA levels in the hypothalamus.
The sickness behavior is also characterized by a behavioral
inhibition, physio-somatic disturbances such as fatigue and
malaise, and an inability to feel pleasure or anhedonia (Maes
etal., 2012). In our study, the inuence of OEA and PEA in moti-
vational behavior was tested by checking anhedonia in a sac-
charine preference test. LPS-injected animals pretreated with
OEA, but not PEA, showed a preference for the natural reward
saccharine similar to control animals, which is interpreted as a
disruption of LPS-induced anhedonia. Anhedonia is a prolonged
effect of LPS that persists beyond the acute sickness response,
and this behavioral change is thought to reect a depressive-like
phenotype (Willner etal., 1987). Modulation of LPS acute neuro-
inammatory responses by OEA can therefore elicit long-lasting
motivational behavioral effects and possibly antidepressant-like
effects. Total amount of liquid (water plus saccharine solution)
was, however, reduced in LPS-injected rats independently of any
pretreatment. Adecrease in total drinking could be indicative
of behavioral inhibition or fatigue during LPS-induced sickness
behavior. Despite the fact it is a satiety factor (Romano et al.,
2014), OEA at a single dose did not modify the preference for
uids or the total drinking in control animals. However, inter-
estingly, OEA affected the saccharine preference in LPS rats
and modied the anhedonic state after LPS, inducing a positive
motivational state similar to control animals. Elimination of
motivational decits by OEA could be linked with a role of this
lipid mediator on the control of dopamine release in the reward
system. This effect has been clearly demonstrated for high
fat-containing foods (Tellez etal., 2013) or nicotine-mediated
reward (Mascia etal., 2011; Buczynski etal., 2012). Alternatively,
anhedonia has been directly related with lasting lipid peroxi-
dation alterations in the prefrontal cortex in a chronic stress
depression paradigm (Cline etal., 2014). In our study, OEA pre-
vented both lipid peroxidation in frontal cortex and anhedonia
after LPS. Further studies will be necessary to ascertain whether
inhibition of LPS-induced lipid peroxidation by OEA is long last-
ing and may be related with the OEA antianhedonic effect.
The proposed neuroprotective effects of OEA and PEA may
derive in part from their antiinammatory and antioxida-
tive functions, as well as their modulation of neuronal activity
(Melis etal., 2013). Given the importance of neuroinammation
in the physiopathology of neuropsychiatric diseases, our results

12 | International Journal of Neuropsychopharmacology, 2015
suggest that OEA and PEA might help delay the onset of neu-
rodegenerative and neuropsychiatric diseases by reducing the
insults to brain functions. Finally, from a translational point of
view, OEA might also have a benecial prole as a therapeutic
agent, since it may ameliorate the motivational state of indi-
viduals with neuroinammatory or immune related neuropsy-
chiatric conditions.
Acknowledgments
This research was supported by The Spanish Ministry of Health
and Social Policy (PNSD, PR29/11-18295 to L.O.), the Regional
Government of Madrid (S2011/BMD-2308. CANNAB to JC.L.),
Universidad Complutense-Santander (2878–920140 to J.C.L.), and
Consejería de Salud y Bienestar Social, Junta Andalucía (PI0228-
2013). B.G.-B. is a Ramón y Cajal postdoctoral fellow (Spanish
Ministry of Education and Science).
Interest Statement: None.
References
Ahmad A, Genovese T, Impellizzeri D, Crupi R, Velardi E, Marino
A, Esposito E, Cuzzocrea S (2012a) Reduction of ischemic
brain injury by administration of palmitoylethanolamide
after transient middle cerebral artery occlusion in rats. Brain
Res 1477:45–58.
Ahmad A, Crupi R, Impellizzeri D, Campolo M, Marino A, Espos-
ito E, Cuzzocrea S (2012b) Administration of palmitoylethan-
olamide (PEA) protects the neurovascular unit and reduces
secondary injury after traumatic brain injury in mice. Brain,
behavior, and immunity 26:1310–1321.
Akarsu ES, Mamuk S (2007) Escherichia coli lipopolysaccha-
rides produce serotype-specic hypothermic response in
biotelemetered rats. Am J Physiol Regul Integr Comp Physiol
292:R1846–R1850.
Almasi R, Szoke E, Bolcskei K, Varga A, Riedl Z, Sandor Z,
Szolcsanyi J, Petho G (2008) Actions of 3-methyl-N-ole-
oyldopamine, 4-methyl-N-oleoyldopamine and N-oleoyleth-
anolamide on the rat TRPV1 receptor in vitro and in vivo. Life
Sci. 82:644–651.
Arons MM, Wheeler AP, Bernard GR, Christman BW, Russell JA,
Schein R, Summer WR, Steinberg KP, Fulkerson W, Wright P,
Dupont WD, Swindell BB (1999) Effects of ibuprofen on the
physiology and survival of hypothermic sepsis. Crit Care Med
27:699–707.
Artamonov M, Zhukov O, Shuba I, Storozhuk L, Khmel T, Klima-
shevsky V, Mikosha A, Gula N (2005) Incorporation of labelled
N-acylethanolamine (NAE) into rat brain regions in vivo and
adaptive properties of saturated NAE under x-ray irradiation.
Ukr Biokhim Zh. 77(6):51–62.
Bachur NR, Masek K, Melmon KL, Udenfriend S (1965) Fatty acid
amides of ethanolamine in mammalian tissues. J Biol Chem
240:1019–1024.
Baker D, Pryce G, Croxford JL, Brown P, Pertwee RG, Makriyannis
A, Khanolkar A, Layward L,Fezza F,Bisogno T,Di Marzo V (2001)
Endocannabinoids control spasticity in a multiple sclerosis
model. FASEB J 15:300–302.
Balvers MG, Verhoeckx KC, Meijerink J, Bijlsma S, Rubingh CM,
Wortelboer HM, Witkamp RF (2012) Time-dependent effect
of in vivo inammation on eicosanoid and endocannabinoid
levels in plasma, liver, ileum and adipose tissue in C57BL/6
mice fed a sh-oil diet. Int Immunopharmacol. 13:204–214.
Berger C, Schmid PC, Schabitz WR, Wolf M, Schwab S, Schmid HH
(2004) Massive accumulation of N-acylethanolamines after
stroke. Cell signalling in acute cerebral ischemia? J Neuro-
chem 88(5):1159–1167.
Bilbao A,Blanco E,Luque-Rojas MJ,Suarez J,Palomino A,Vida
M,Araos P,Bermudez-Silva FJ,Fernandez-Espejo E,Spanagel
R,Rodriguez de Fonseca F (2013) Oleoylethanolamide dose-
dependently attenuates cocaine-induced behaviours through
a PPARalpha receptor-independent mechanism. Addict Biol
18:78–87.
Bisogno T, Martire A, Petrosino S, Popoli P,Di Marzo V (2008)
Symptom-related changes of endocannabinoid and pal-
mitoylethanolamide levels in brain areas of R6/2 mice, a
transgenic model of Huntington’s disease. Neurochem Int.
52:307–13.
Bradford MM (1976) A rapid and sensitive method for the quanti-
tation of microgram quantities of protein utilizing the princi-
ple of protein-dye binding. Anal Biochem 72:248–254.
Buczynski MW, Polis IY, Parsons LH (2013) The volitional nature
of nicotine exposure alters anandamide and oleoylethanola-
mide levels in the ventral tegmental area. Neuropsychophar-
macology 38:574–84.
Clemmer TP, Fisher CJ, Bone RC, Slotman GJ, Metz CA, Thomas
FO (1992) Hypothermia in the sepsis syndrome and clinical
outcome. Crit Care Med 20:1395–1401.
Cline BH, Anthony DC, Lysko A, Dolgov O, Anokhin K, Schroeter
C, Malin D, Kubatiev A, Steinbusch HW, Lesch KP, Streka-
lova T (2014) Lasting downregulation of the lipid peroxida-
tion enzymes in the prefrontal cortex of mice susceptible
to stress-induced anhedonia. Behav Brain Res pii:S0166-
4328(14)00255-1. doi:10.1016/j.bbr.2014.04.037.
Coppola M, Mondola R (2013) Palmitoylethanolamide: from
endogenous cannabimimetic substance to innovative medi-
cine for the treatment of cannabis dependence. Med Hypoth-
eses 81:619–622.
Cravatt BF, Giang DK, Mayeld SP, Boger DL, Lerner RA, Gilula NB
(1996) Molecular characterization of an enzyme that degrades
neuromodulatory fatty-acid amides. Nature 384:83–87.
D’Agostino G,La Rana G,Russo R,Sasso O,Lacono A,Esposito E,Mattace
Raso G,Cuzzocrea S, Loverme J, Piomelli D, Meli R, Calignano A
(2009) Central administration of palmitoylethanolamide reduces
hyperalgesia in mice via inhibition of NF-kappaB nuclear signal-
ling in dorsal root ganglia. Eur J Pharmacol 613:54–9.
Das NP, Ratty AK (1987) Studies on the effects of the narcotic
alkaloids, cocaine, morphine, and codeine on nonenzymatic
lipid peroxidation in rat brain mitochondria. Biochem Med
Metab Biol 37:258–264.
Degn M, Lambertsen KL, Petersen G, Meldgaard M, Artmann A,
Clausen BH, Hansen SH, Finsen B, Hansen HS, Lund TM (2007)
Changes in brain levels of N-acylethanolamines and 2-ara-
chidonoylglycerol in focal cerebral ischemia in mice. J Neuro-
chem 103:1907–1916.
Derijk RH,Van Kampen M,Van Rooijen N, Berkenbosch F (1994)
Hypothermia to endotoxin involves reduced thermogenesis,
macrophage-dependent mechanisms, and prostaglandins.
Am J Physiol 266:R1–8.
Di Cesare Mannelli L,D’Agostino G,Pacini A,Russo R,Zanardelli
M,Ghelardini C,Calignano A (2013) Palmitoylethanolamide
is a disease-modifying agent in peripheral neuropathy: pain
relief and neuroprotection share a PPAR-alpha-mediated
mechanism. Mediators Inamm 2013:328797.
Fan A, Wu X, Wu H, Li L, Huang R, Zhu Y, Qiu Y, Fu J, Ren J, Zhu
C (2014) Atheroprotective effect of oleoylethanolamide (OEA)
targeting oxidized LDL. PLoS One 9:e85337.
Fernandez-Solari J, Prestilippo JP, Bornstein SR, McCann SM,
Rettori V (2006) Participation of the endocannabinoid system

Sayd et al. | 13
in the effect of TNF-alpha on hypothalamic release of gonad-
otropin-releasing hormone. Ann N Y Acad Sci 1088:238–250.
Fidaleo M, Fanelli F, Ceru MP, Moreno S (2014) Neuroprotective
properties of peroxisome proliferator-activated receptor
alpha (PPARα) and its lipid ligands. Curr Med Chem. In press
(PMID:24606520).
Fu J,Gaetani S,Oveisi F,Lo Verme J,Serrano A,Rodriguez De
Fonseca F,Rosengarth A,Luecke H,Di Giacomo B, Tarzia G,
Piomelli D (2003) Oleylethanolamide regulates feeding and
body weight through activation of the nuclear receptor PPAR-
alpha. Nature 425:90–93.
Fu J, Bottegoni G, Sasso O, Bertorelli R, Rocchia W, Masetti M, Gui-
jarro A, Lodola A, Armirotti A, Garau G, Bandiera T, Reggiani
A, Mor M, Cavalli A, Piomelli D (2011) A catalytically silent
FAAH-1 variant drives anandamide transport in neurons. Nat
Neurosci 15:64–69.
Galan-Rodriguez B,Suarez J,Gonzalez-Aparicio R,Bermudez-Silva
FJ,Maldonado R,Robledo P,Rodriguez de Fonseca F,Fernandez-
Espejo E (2009) Oleoylethanolamide exerts partial and dose-
dependent neuroprotection of substantia nigra dopamine
neurons. Neuropharmacology 56(3):653–664.
Garcia-Bueno B, Caso JR, Leza JC (2008) Stress as a neuroinam-
matory condition in brain: damaging and protective mecha-
nisms. Neurosci Biobehav Rev 32:1136–1151.
Giuffrida A,Rodriguez de Fonseca F, Piomelli D (2000) Quantica-
tion of bioactive acylethanolamides in rat plasma by electro-
spray mass spectrometry. Anal Biochem 280:87–93.
Godlewski G, Offertaler L, Wagner JA, Kunos G (2009) Receptors
for acylethanolamides-GPR55 and GPR119. Prostaglandins
Other Lipid Mediat 89:105–111.
Gonzalez-Aparicio R, Blanco E, Serrano A, Pavon FJ, Parsons LH,
Maldonado R, Robledo P, Fernandez-Espejo E,de Fonseca FR
(2013) The systemic administration of oleoylethanolamide
exerts neuroprotection of the nigrostriatal system in experi-
mental Parkinsonism. Int J Neuropsychopharmacol 17:455–
468.
Gonzalez-Aparicio R, Moratalla R (2013) Oleoylethanolamide
reduces L-DOPA-induced dyskinesia via TRPV1 receptor in a
mouse model of Parkinsons disease. Neurobiol Dis 62:416–425
Gorzalka BB, Hill MN, Hillard CJ (2008) Regulation of endocan-
nabinoid signaling by stress: implications for stress-related
affective disorders. Neurosci Biobehav Rev 32:1152–1160.
Hansen HH, Ikonomidou C, Bittigau P, Hansen SH, Hansen HS (2001)
Accumulation of the anandamide precursor and other N-acy-
lethanolamine phospholipids in infant rat models of in vivo
necrotic and apoptotic neuronal death. J Neurochem 76:39–46.
Hart BL (1988) Biological basis of the behavior of sick animals.
Neurosci Biobehav Rev 12:123–137.
Hauer D, Schelling G, Gola H, Campolongo P, Morath J, Roozendaal
B Hamuni G, Karabatsiakis A, Atsak P, Vogeser M, Kolassa
IT (2013) Plasma concentrations of endocannabinoids and
related primary fatty acid amides in patients with post-trau-
matic stress disorder. PLoS One 8:e62741.
Hill MN, Miller GE, Carrier EJ, Gorzalka BB, Hillard CJ (2009) Cir-
culating endocannabinoids and N-acyl ethanolamines are
differentially regulated in major depression and follow-
ing exposure to social stress. Psychoneuroendocrinology
34:1257–1262.
Hill MN, Patel S, Campolongo P, Tasker JG, Wotjak CT, Bains JS
(2010) Functional interactions between stress and the endo-
cannabinoid system: from synaptic signaling to behavioral
output. J Neurosci 30:14980–14986.
Ivanov AI, Romanovsky AA (2004) Prostaglandin E2 as a mediator
of fever: synthesis and catabolism. Front Biosci 9:1977–1993.
Kilaru A, Isaac G, Tamura P, Baxter D, Duncan SR, Venables BJ,
Welti R, Koulen P, Chapman KD (2010) Lipid proling reveals
tissue-specic differences for ethanolamide lipids in mice
lacking fatty acid amide hydrolase. Lipids 45:863–875.
Kerr DM, Burke NN, Ford GK, Connor TJ, Harhen B, Egan LJ, Finn
DP, Roche M (2012) Pharmacological inhibition of endocan-
nabinoid degradation modulates the expression of inam-
matory mediators in the hypothalamus following an
immunological stressor. Neuroscience 204:53–63.
Konsman JP, Parnet P, Dantzer R (2002) Cytokine-induced sick-
ness behaviour: mechanisms and implications. Trends Neu-
rosci 25:154–159.
Kushner I,Rzewnicki, DL (1997) The acute phase response. In:
Mackowiak PA. Fever: basic mechanisms and management.
Lippincott-Raven: Philadelphia.
Leon LR (2004) Hypothermia in systemic inammation: role of
cytokines. Front Biosci 9:1877–1888
Liu J,Batkai S,Pacher P,Harvey-White J,Wagner JA, Cravatt BF, Gao
B, Kunos G (2003) Lipopolysaccharide induces anandamide
synthesis in macrophages via CD14/MAPK/phosphoinositide
3-kinase/NF-kappaB independently of platelet-activating
factor. J Biol Chem 278:45034–45039.
Lo Verme J,Fu J,Astarita G,La Rana G,Russo R,Calignano
A,Piomelli D (2005) The nuclear receptor peroxisome pro-
liferator-activated receptor-alpha mediates the antiinam-
matory actions of palmitoylethanolamide. Mol Pharmacol
67:15–19.
LoVerme J,Russo R,La Rana G,Fu J,Farthing J,Mattace-Raso
G,Meli R,Hohmann A,Calignano A, Piomelli D (2006) Rapid
broad-spectrum analgesia through activation of peroxisome
proliferator-activated receptor-alpha. J Pharmacol Exp Ther.
319:1051–1061.
MacDowell KS,Garcia-Bueno B,Madrigal JL, Parellada M, Arango
C, Mico JA, Leza JC (2013) Risperidone normalizes increased
inammatory parameters and restores antiinammatory
pathways in a model of neuroinammation. Int J Neuropsy-
chopharmacol 16:121–135.
Madrigal JL, Moro MA, Lizasoain I, Lorenzo P,Castrillo A,Boscá
L,Leza JC (2001) Inducible nitric oxide synthase expression
in brain cortex after acute restraint stress is regulated by
nuclear factor kappaB-mediated mechanisms. J Neurochem
76:532–538.
Maes M, Berk M, Goehler L, Song C, Anderson G,Gałecki P, Leon-
ard B (2012) Depression and sickness behavior are Janus-
faced responses to shared inammatory pathways. BMC
Medicine 10:66
Mascia P, Pistis M, Justinova Z, Panlilio LV, Luchicchi A, Lecca S,
Scherma M, Fratta W, Fadda P, Barnes C, Redhi GH, Yasar S,Le
Foll B, Tanda G, Piomelli D, Goldberg SR (2011) Blockade of nic-
otine reward and reinstatement by activation of alpha-type
peroxisome proliferator-activated receptors. Biol Psychiatry
69:633–641.
Melis M, Pillolla G, Luchicchi A, Muntoni AL, Yasar S, Goldberg SR,
Pistis M (2008) Endogenous fatty acid ethanolamides suppress
nicotine-induced activation of mesolimbic dopamine neu-
rons through nuclear receptors. J Neurosci 28:13985–13994.
Melis M, Carta G, Pistis M, Banni S (2013) Physiological role of
peroxisome proliferator-activated receptors type alpha on
dopamine systems. CNS Neurol Disord Drug Targets 12:70–77.
Orio L, Pavon FJ, Blanco E, Serrano A, Araos P, Pedraz M, Rivera
P, Calado M, Suarez J,de Fonseca FR (2013) Lipid transmitter
signaling as a new target for treatment of cocaine addiction:
new roles for acylethanolamides and lysophosphatidic acid.
Curr Pharm Des 19:7036–7049.

14 | International Journal of Neuropsychopharmacology, 2015
Overton HA, Babbs AJ, Doel SM, Fyfe MC, Gardner LS, Grifn G,
Jackson HC, Procter MJ, Rasamison CM,Tang-Christensen M,
Widdowson PS, Williams GM, Reynet C (2006) Deorphaniza-
tion of a G protein-coupled receptor for oleoylethanolamide
and its use in the discovery of small-molecule hypophagic
agents. Cell Metab 3:167–175.
Paterniti I, Impellizzeri D, Crupi R, Morabito R, Campolo M,
Esposito E, Cuzzocrea S (2013) Molecular evidence for the
involvement of PPAR-δ and PPAR-γ in antiinammatory and
neuroprotective activities of palmitoylethanolamide after
spinal cord trauma. J Neuroinammation 10:20
Perez-Nievas BG, Madrigal JL, Garcia-Bueno B, Zoppi S, Leza
JC (2010) Corticosterone basal levels and vulnerability to
LPS-induced neuroinammation in the rat brain. Brain Res
1315:159–168.
Piomelli D (2003) The molecular logic of endocannabinoid sig-
nalling. Nat Rev Neurosci 4:873–884.
Plaza-Zabala A, Berrendero F, Suarez J, Bermudez-Silva FJ, Fer-
nandez-Espejo E, Serrano A, Pavon FJ, Parsons LH,De Fonseca
FR, Maldonado R, Robledo P (2010) Effects of the endogenous
PPAR-alpha agonist, oleoylethanolamide on MDMA-induced
cognitive decits in mice. Synapse 64:379–389.
Radley JJ, Arias CM, Sawchenko PE (2006) Regional differentiation
of the medial prefrontal cortex in regulating adaptive responses
to acute emotional stress. J Neurosci 26:12967–12976.
Rodriguez de Fonseca F, Navarro M, Gomez R, Escuredo L, Nava
F, Fu J, Murillo-Rodriguez E, Giuffrida A, LoVerme J, Gaetani S,
Kathuria S, Gall C, Piomelli D (2001) An anorexic lipid media-
tor regulated by feeding. Nature 414:209–212.
Romano A,Karimian Azari E,Tempesta B,Mansouri A,Micioni Di
Bonaventura MV,Ramachandran D, Lutz TA, Bedse G,Langhans
W, Gaetani S (2014) High dietary fat intake inuences the acti-
vation of specic hindbrain and hypothalamic nuclei by the
satiety factor oleoylethanolamide. Physiol Behav pii:S0031-
9384(14)00230-3. doi:10.1016/j.physbeh.2014.04.039.
Saper CB (1998) Neurobiological basis of fever. Ann NY Acad Sci
856:90–94.
Schabitz WR, Giuffrida A, Berger C, Aschoff A, Schwaninger M, Schwab
S, Piomelli D (2002) Release of fatty acid amides in a patient with
hemispheric stroke: a microdialysis study. Stroke 33:2112–2114.
Schmid PC, Zuzarte-Augustin ML, Schmid HH (1985) Properties
of rat liver N-acylethanolamine amidohydrolase. J Biol Chem
260:14145–14149.
Schreiber E, Matthias P, Muller MM, Schaffner W (1989) Rapid
detection of octamer binding proteins with ‘mini-extracts’,
prepared from a small number of cells. Nucleic Acids Res
17:6419.
Steiner AA, Hunter JC, Phipps SM, Nucci TB, Oliveira DL, Roberts
JL, Scheck AC, Simmons DL, Romanovsky AA (2009) Cycloox-
ygenase-1 or -2--which one mediates lipopolysaccharide-
induced hypothermia? Am J Physiol Regul Integr Comp
Physiol 297:R485–94.
Steiner AA, Molchanova AY, Dogan MD, Patel S,Pétervári
E,Balaskó M, Wanner SP, Eales J, Oliveira DL, Gavva NR,
Almeida MC,Székely M, Romanovsky AA (2011) The hypo-
thermic response to bacterial lipopolysaccharide critically
depends on brain CB1, but not CB2 or TRPV1, receptors. J
Physiol 589:2415–2431.
Suardíaz M, Estivill-Torrús G, Goicoechea C, Bilbao A, Rodríguez
de Fonseca F (2007) Analgesic properties of oleoylethanola-
mide (OEA) in visceral and inammatory pain. Pain 133:99–
110.
Sun Y, Alexander SP, Garle MJ, Gibson CL, Hewitt K, Murphy SP,
Kendall DA, Bennett AJ (2007) Cannabinoid activation of PPAR
alpha; a novel neuroprotective mechanism. Br J Pharmacol
152:734–743.
Tellez LA, Medina S, Han W, Ferreira JG, Licona-Limón P, Ren X,
Lam TT, Schwartz GJ, de Araujo IE (2013) A gut lipid messen-
ger links excess dietary fat to dopamine deciency. Science
341:800–802.
Willner P, Towell A, Sampson D, Sophokleous S, Muscat R (1987)
Reduction of sucrose preference by chronic unpredictable
mild stress, and its restoration by a tricyclic antidepressant.
Psychopharmacology 93:358–364.
Yirmiya R (1996) Endotoxin produces a depressive-like episode
in rats. Brain Res 711:163–174.
Zhou Y, Yang L, Ma A, Zhang X, Li W, Yang W, Chen C, Jin X (2012)
Orally administered oleoylethanolamide protects mice from
focal cerebral ischemic injury by activating peroxisome prolifer-
ator-activated receptor alpha. Neuropharmacology 63:242–249.