Content uploaded by Ali McCorkindale
Author content
All content in this area was uploaded by Ali McCorkindale on Nov 06, 2014
Content may be subject to copyright.
8984–8995 Nucleic Acids Research, 2014, Vol. 42, No. 14 Published online 18 July 2014
doi: 10.1093/nar/gku620
The human Piwi protein Hiwi2 associates with
tRNA-derived piRNAs in somatic cells
Simon P. Keam
1,2
, Paul E. Young
1
, Alexandra L. McCorkindale
1
, Thurston H.Y. Dang
1
,
Jennifer L. Clancy
1
, David T. Humphreys
1
, Thomas Preiss
1
, Gyorgy Hutvagner
2
,David
I.K. Mar tin
3
, Jennifer E. Cropley
1,4,*
and Catherine M. Suter
1,4,*
1
Molecular, Structural and Computational Biology Division, Victor Chang Cardiac Research Institute, 405 Liverpool
Street, Darlinghurst, NSW, 2010, Australia,
2
Faculty of Engineering and Information Technology, Centre of Health
Technologies, University of Technology Sydney, 235 Jones Street, Ultimo, NSW, 2007, Australia,
3
Center for
Genetics, Children’s Hospital Oakland Research Institute, 5700 Martin Luther King Jr. Way, Oakland, CA 94609, USA
and
4
Faculty of Medicine, University of New South Wales, Kensington, 2052, Australia
Received March 26, 2014; Revised June 26, 2014; Accepted June 26, 2014
ABSTRACT
The Piwi-piRNA pathway is active in animal germ
cells where its functions are required for germ
cell maintenance and gamete differentiation. Piwi
proteins and piRNAs have been detected outside
germline tissue in multiple phyla, but activity of the
pathway in mammalian somatic cells has been little
explored. In particular, Piwi expression has been ob-
served in cancer cells, but nothing is known about
the piRNA partners or the function of the system
in these cells. We have surveyed the expression of
the three human Piwi genes,
Hiwi
,
Hili
and
Hiwi2,
in multiple normal tissues and cancer cell lines. We
find that
Hiwi2
is ubiquitously expressed; in cancer
cells the protein is largely restricted to the cytoplasm
and is associated with translating ribosomes. Im-
munoprecipitation of Hiwi2 from MDAMB231 cancer
cells enriches for piRNAs that are predominantly de-
rived from processed tRNAs and expressed genes,
species which can also be found in adult human
testis. Our studies indicate that a Piwi-piRNA path-
way is present in human somatic cells, with an un-
characterised function linked to translation. Taking
this evidence together with evidence from primitive
organisms, we propose that this somatic function of
the pathway predates the germline functions of the
pathway in modern animals.
INTRODUCTION
Piwi-domain containing Argonaute proteins are conserved
among eukaryotes and archaea (1–4). The eponymous
member of the Piwi subclade was identied in Drosophila as
a factor necessary for germ cell maintenance (5), and Piwi
orthologues have since been found to be highly expressed in
the developing germline tissues of a wide variety of animal
species (4). Model organisms with impaired Piwi function
generally show no obvious defects outside the germ line:
for example, in laboratory mice, deletion of any one of the
three murine Piwi genes (Miwi, Mili and Miwi2) results in
male sterility accompanied by transposon derepression in
differentiating gametes (6–10), but mice are viable and ap-
pear healthy. Piwi proteins, like their Ago protein cousins,
partner with small RNAs (11–16); Piwi-interacting RNAs
(piRNAs) are typically 24 to 31 nt long, are produced in
a Dicer-independent manner and have reported links to a
multitude of functions (reviewed in (4)). Unlike miRNAs,
piRNAs are extremely diverse, with at least hundreds of
thousands of mature species transcribed from thousands of
genomic loci, many of which are large asymmetric and syn-
tenic clusters (7,11,17).
Retrotransposon suppression in the developing germline
is the best understood function of the Piwi-piRNA path-
way. Piwi proteins and retrotransposon-derived piRNAs act
together during distinct periods of germ cell development
to suppress retrotransposon activation both transcription-
ally and post-transcriptionally (reviewed in (18)). In labo-
ratory mice lacking Mili or Miwi2, increases in retrotrans-
poson transcription are linked to loss of genomic cytosine
methylation on these elements (8,9); this has contributed to
the now well-accepted idea that piRNAs act as guides for
epigenetic modication and suppression of homologous se-
quences in the germline (19).
Studies on the Piwi-piRNA pathway outside the germline
are limited, but there is evidence for somatic function in a
number of organisms. Somatic piRNAs have been cloned
from Drosophila, rhesus macaque and mouse tissues (20–
*
To whom correspondence should be addressed. Tel: +61 2 9295 8720; Fax: +61 2 9295 8601; Email: c.suter@victorchang.edu.au
Correspondence may also be addressed to Jennifer E. Cropley. Tel: +61 2 9295 8619; Fax: +61 2 9295 8601; Email: j.cropley@victorchang.edu.au
C
The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by-nc/4.0/), which
permits non-commercial re-use, distribution, and reproduction in any medium, provided the original work is properly cited. For commercial re-use, please contact
journals.permissions@oup.com
at Physical Sciences Library on November 6, 2014http://nar.oxfordjournals.org/Downloaded from
Nucleic Acids Research, 2014, Vol. 42, No. 14 8985
24), including mouse hippocampal neurons where they as-
sociate with Miwi (25). Somatic piRNAs have also been
implicated in long-term memory formation via epigenetic
mechanisms in the neurons of the model sea slug Aplysia
(26). Expression of the effector Piwi proteins has also been
observed in somatic tissues across phyla. Orthologues of
Piwi are expressed in the stem cells and regenerative tis-
sues of a number of primitive organisms including jellysh
(27), sponges (28), planarians (29,30), polychaete worms
(31) and colonial ascidians (32), implying a conserved func-
tion for Piwi in stem cell maintenance beyond the germline.
Piwi proteins have been found in mammalian somatic cells,
in particular, mouse haematopoietic cells (33,34) and hu-
man cancer cells (35–38), while piRNAs have separately
been reported in both tumours and cancer cell lines (39,40).
It has been suggested that epigenetic silencing by the Piwi-
piRNA pathway could be responsible for the aberrant hy-
permethylation of genes commonly seen in malignant cells
(41).
Given the evidence for somatic Piwi expression, and par-
ticularly the evidence for expression in cancer cells, we set
out to establish which of the human Piwi proteins might
partner with piRNAs in cancer cells, and to seek clues to
the function of the Piwi-piRNA pathway in somatic cells.
We nd that the human Piwi orthologue Hiwi2 is ubiqui-
tously expressed in both normal human somatic tissues and
cancer cell lines, albeit at a lower level than in the testis.
In MDAMB231 breast cancer cells, Hiwi2 localises to the
cytoplasm and associates with the translational apparatus.
Contrary to the hypothesis that the Piwi-piRNA pathway
is involved in the epigenetic aberrations of cancer cells, we
nd that Hiwi2-bound piRNAs are not derived from retro-
transposons or hypermethylated CpG islands; rather they
are predominantly derived from tRNAs, and to a lesser ex-
tent from expressed and unmethylated genes. The tRNA-
derived and gene-derived piRNAs can also be found in the
adult human testis, suggesting a function for Hiwi2 that is
common to germline and soma.
MATERIAL AND METHODS
Quantitative RT-PCR
Total RNA from human adult testis (Ambion), somatic
tissues (Human Total RNA master panel II, Clontech)
and cell lines was reverse transcribed and subject to quan-
titative PCR in Sybr Master Mix (Roche) with 20 nM
primer. Ribosomal protein Rpl13a was used as a refer-
ence gene. Primer sequences are as follows: Hiwi F: AC
GCTGCATATTTCAGGATAGA, Hiwi R: GACAGTGA
CAGATTTGGCTCTC, Hili F: CGCATTATGTCTGT
GTTCTCAA, Hiwi R: AAGCGATTCTCCTGCCTTAG,
Hiwi2 F: AATGCTCGCTTTGAACTAGAGAC, Hiwi2
R: ATTTTGGGGTAGTCCACATTAAATC, Rpl13a F:
CCTGGAGGAGAAGAGGAAAGAGA, Rpl13a R: TG
TCATACCAGGAAATGAGC.
Nuclear/cytoplasmic fractionation and western blotting
MDAMB231 cells (∼10 × 106) were pelleted by centrifuga-
tion at 4
◦
C. Cytosolic proteins were recovered by lysing the
cell pellet in 400 l Buffer A (10 mM Hepes, 10 mM KCl,
1.5 mM MgCl2, 0.1 mM EDTA, 1 mM dTT, with protease
inhibitor cocktail) for 15 min on ice before addition of 40 l
of 1% NP-40. The cell lysate was then centrifuged at 13 000
× g and the supernatant collected as the cytoplasmic frac-
tion. The pellet was washed twice with 500 lBufferAwith
centrifugation at 13 000 × g, then lysed in 150 lBufferC
(50 mM Tris-HCl (pH 7.5), 0.5% Triton X-100, 137.5 mM
NaCl, 10% Glycerol, 5 mM EDTA, 0.5% SDS, with pro-
tease inhibitor cocktail). The nuclear lysate was sonicated
and cleared by centrifugation at 17 000 × g for 15 min. Sep-
aration of the cytoplasmic and nuclear fractions was veri-
ed by western blot for -tubulin (anti- -tubulin, Sigma
T5201) and histone H2b (anti-H2B, Abcam ab1790). West-
ern blot for Hiwi2 used the anti-Piwil4 antibody (Abcam
ab21869). Western blot secondary antibodies were uores-
cently labelled and membranes were visualised on a Licor
Odyssey.
Immunocytochemistry
MDAMB231 cells on gelatin-coated coverslips were xed
in 4% PFA and blocked before incubation with anti-
Piwil4 (Abcam ab21869) followed by Cy3-AfniPure Don-
key anti-Rabbit IgG, and visualisation on a Carl Zeiss LSM
700 Upright Confocal microscope. DNA was stained with
Hoechst-33342.
Polysome proling
Preparation of sucrose density gradient fractionated
polysomes was performed as previously described (65).
Briey, cells treated with either 200 g/ml puromycin or
no treatment were lysed and the cleared lysate applied to
17–50% sucrose gradients before ultracentrifugation at
210 000 × g. Fractions were collected along the gradient
and protein precipitated from the fractions with methanol
before chloroform extraction. Identication of polysome-
containing fractions was achieved by western blot for
ribosomal protein Rps6 (anti-Rps6, Cell Signal 5G10).
Generation of Flag-Hiwi2 expressing cell line
MDAMB231 cells were transfected with a linearised Flag-
Hiwi2-piRESneo construct using Lipofectamine 2000.
Cells were re-plated after 24 h in a medium containing 1000
g/ml G418. After approximately 3 weeks, colonies con-
taining >100 cells were isolated and expanded. Verica-
tion of Flag-Hiwi2 expression in clonal lines was achieved
by western blot for the Flag epitope (anti-Flag M2, Sigma
F1804). No clone demonstrated high expression of the
tagged protein––all clones showed a modest Flag signal on
western blot; the clone with the highest Flag Hiwi2 expres-
sion was chosen for immunoprecipitation experiments.
Flag-Hiwi2 immunoprecipitation
Approximately 1 × 108 wild-type and Flag-Hiwi2 express-
ing MDAMB231 cells were harvested and lysed by re-
suspension in 200 l MagnaRIP (Millipore) lysis buffer.
Flag-Hiwi2 was immunoprecipitated with anti-FLAG M2
at Physical Sciences Library on November 6, 2014http://nar.oxfordjournals.org/Downloaded from
8986 Nucleic Acids Research, 2014, Vol. 42, No. 14
antibody using the MagnaRIP protein and RNA im-
munoprecipitation kit (Millipore). Half of the immuno-
precipitation was reserved for protein isolation and co-
immunoprecipitated RNAs were isolated from the re-
mainder according to the manufacturer’s instructions. Co-
immunoprecipitated proteins were eluted from the reserved
fraction by incubation in 1 mg/ml 3x Flag peptide solution
(Sigma) in MagnaRIP wash buffer (Millipore).
Mass spectrometry
Proteins co-immunoprecipitated with Flag-Hiwi2 were sep-
arated on a 4–12% Bis-Tris PAGE gel (Invitrogen) and visu-
alised using SYPRO Ruby stain (BioRad). The entire lane
was excised from the gel and analysed by one-dimensional
MS on either a Thermo LTQ FT or Applied Biosystems
QSTAR Pulsar using trypsin digest and ESI TRAP iden-
tication of peptides. Peptides were identied by Mascot
(Matrix Science) using the IPI-Human-v3.58 database, with
fragment tolerance of 0.4 Daltons (monoisotopic) and par-
ent tolerance of 4.0 parts per million (monoisotopic). Pro-
tein coverage, peptide number and signicance were as-
sessed using Scaffold 3 (Proteome Software). Any peptides
with signicant coverage in the wild-type MDAMB231 im-
munoprecipitation were removed from the list of Hiwi2 co-
immunoprecipitated proteins. Results presented are an av-
erage of protein coverage from biological replicate experi-
ments.
Small RNA sequencing
Libraries for deep sequencing were prepared from 3 lofa
total 5 l of co-immunoprecipitated RNA, and from ∼500
ng total RNA from MDAMB231 cells and adult testis, us-
ing the Small RNA Expression Kit with barcoded primers
(Life Technologies). A single-emulsion PCR was used to
couple the barcoded libraries to P1-coated beads, and se-
quencing was performed using 35 bp chemistry on a SOLiD
machine (version 3.0).
SOLiD sequencing data were mapped using the Lifescope
small RNA pipeline (Life Technologies) with zero mis-
matches, and ltered for rRNA. Each tag was mapped
against an expanded small RNA dataset including miRNA
(miRbase 19), snoRNA and tRNA (hsa19 tRNAdb); un-
mapped tags were then mapped against the entire human
genome (hg19). Multimappers were not binned to the de-
fault Lifescope lter; Lifescope output comprised a single
best-mapped position for each tag. The Miwi2 IP E16.5
testis dataset 8 was downloaded from the Gene Expression
Omnibus (accession GSM319957). Adapters were trimmed
using cutadapt prior to mapping to the mouse genome
(mm10) using Bowtie with an 18 base seed, up to three mis-
matches and a maximum sum of mismatched quality values
of 70.
Mapped tags were annotated hierarchically using the en-
sembl perl API and custom perl scripts, with preference
given to sense-oriented transcripts and to small/noncoding
RNA over protein coding genes, in the following or-
der: Human: the miRNA/snoRNA/tRNA dataset above,
UCSC hg19 nested repeat dataset, UCSC hg19 piRNA
dataset, Ensembl Homo sapiens core database (build
67
37); Mouse: miRNA/tRNA, UCSC mm10 nested Re-
peat dataset, Ensembl Mus musculus core database (build
72
38).
Gene expression and cytosine methylation analysis
Gene expression analysis of MDAMB231-Flag-Hiwi2 cells
was performed on 1 g total RNA using an Affymetrix
R
GeneChip
R
Human Gene 1.0 ST Array. Gene signals were
calculated as the mean intensities from all probes across
the gene. Cytosine methylation analysis was performed on
1 ug genomic DNA using the Illumina
R
Innium Human-
Methylation27 BeadChip. Data were processed in BeadStu-
dio software from Illumina; CpG sites are assigned a  value
that is calculated from the intensity of methylated and un-
methylated signals. Thresholds of  ≥ 0.5 and  ≤ 0.2 were
used to designate loci as methylated and unmethylated, re-
spectively.
Gene ontology analysis
Functional analysis of genes with ≥50 mapped piRNAs
in both the Hiwi2 IP and adult testis was carried out in
Ingenuity Pathways Analysis (Ingenuity Systems), to ob-
tain broad ontologies, and also independently in GOrilla
(http://cbl-gorilla.cs.technion.ac.il/), to obtain both broad
and specic ontologies. The Ensembl homo sapiens gene
database (GRCh37.p11), ltered to include only protein-
coding genes, was used as a reference set for both analyses.
TaqMan assay of tRF-piRNAs
tRF-piRNAs were validated using custom TaqMan small
RNA assays (Life Technologies) against the following RNA
sequences (from human tRNAdb loci): GCAUUGGUGG
UUCAGUGGUAGAAUUCU (chr16.trna25-GlyGCC);
UCCCUGGUGGUCUAGUGGUUAGGAUUCGG
(chr1.trna59-GluCTC); GCCCGGAUAGCUCAGU
CGGUAGAGCAUCAGACUU (chr11.trna5-LysTTT);
GUUUCCGUAGUGUAGUGGUCAUCACGUU
(chr5.trna15-ValAAC); GUUUCCGUAGUGUAGCGG
UUAUCACAUU (chr19.trna13-ValCAC). hsa-miR-145
was used as a reference. tRNAs were reverse transcribed
using the TaqMan
R
MicroRNA Reverse Transcription
kit, and qPCR performed using TaqMan
R
Universal PCR
Master Mix II.
RESULTS
Hiwi2 is widely expressed outside the germline
Activity of the Piwi-piRNA system in somatic cells would
require expression of both a Piwi protein and piRNAs. We
surveyed the expression of mRNAs encoding the three hu-
man Piwi members, Hiwi, Hili and Hiwi2, in total RNA
from a panel of normal human tissues and human tu-
mour cell lines representing a diverse range of tumour
types including breast, colon, squamous cell carcinoma and
leukaemia (Figure 1A). Hiwi expression was below the limit
of detection in most normal tissues and cell lines; Hili was
expressed at very low levels in all normal tissues tested, but
at Physical Sciences Library on November 6, 2014http://nar.oxfordjournals.org/Downloaded from
Nucleic Acids Research, 2014, Vol. 42, No. 14 8987
Figure 1. Hiwi2 is expressed in normal human somatic cells and cancer cells. (A) qRT-PCR data showing Hiwi, Hili and Hiwi2 expression in adult testis
(black), normal somatic tissues (blue) and tumour cell lines (red). Expression levels are shown relative to adult testis. (B) Western blot showing Hiwi2
expression in human mammary epithelial cells and the breast cancer cell line MDAMB231, and Miwi2 expression in P21 murine testis. (C) Western blot
showing Hiwi2 expression in cytoplasmic and nuclear fractions prepared from MDAMB231 cells. (D) Immuno-uorescence staining of native MDAMB231
cells captured at low (left) and high (right) magnication showing Hiwi2 concentrated in perinuclear granules in the cytoplasm. (E) Polysome proling
using sucrose density gradient fractionation showing puromycin-sensitive Hiwi2 association with polysomes. Western blot for ribosomal protein Rsp6 (top)
demonstrates the presence of polysomes in heavier fractions; these dissociate and move to lighter fractions with puromycin treatment (+puro). Western
blot for Hiwi2 (bottom) shows an association of Hiwi2 with the polysome-containing fractions that is disrupted with puromycin treatment.
in only one of the cell lines. In contrast, Hiwi2 was ubiqui-
tously expressed across normal somatic tissues, at around
10% of the level seen in the human (18 year old) testis, and
at similar levels in every tumour cell line tested. Hiwi2 pro-
tein expression was conrmed in the breast cancer cell line
MDAMB231 and normal human mammary epithelial cells
by western blot, using an antibody against the murine or-
thologue Miwi2 that also recognizes Hiwi2 (see Supplemen-
tary Figure S1). Hiwi2 protein from both normal and ma-
lignant breast cells gives a similar signal to that of Miwi2
in the testis of an adolescent (P21) mouse (Figure 1B); this
represents about a third of the level of expression seen in
neonatal testis where expression is thought to be at its peak
(see Supplementary Figure S2).
Given that Miwi2 plays a pivotal role in the epigenetic
silencing of transposons in developing germ cells, we won-
dered whether it might play a similar role in cancer cells,
where characteristic genomic hypomethylation is associated
with widespread retrotransposon transcription (42). Direct
involvement in targeted epigenetic silencing would require
that Hiwi2 be located in the nucleus. However, western blot
of nuclear and cytoplasmic fractions of MDAMB231 can-
cer cells reveals that the bulk of somatic Hiwi2 resides in
the cytoplasm (Figure 1C), and immunouorescence shows
Hiwi2 concentrated in perinuclear granules (Figure 1D). In
murine fetal germ cells, Miwi2 is also reportedly present in
cytoplasmic granules, but this is overshadowed by its abun-
dance in the nucleus (8); we observe essentially no nuclear
staining for Hiwi2 in MDAMB231 cells (Figure 1D).
In the mouse germline, it has been shown that Mili and
Miwi are exclusively cytoplasmic, and that Miwi associates
with the translational machinery (8,43). We asked if cy-
toplasmic Hiwi2 in somatic cells is similarly associated
with translation, by performing sucrose gradient fraction-
at Physical Sciences Library on November 6, 2014http://nar.oxfordjournals.org/Downloaded from
8988 Nucleic Acids Research, 2014, Vol. 42, No. 14
ation of MDAMB231 lysates followed by western blotting
with the Miwi2 antibody. We found that a proportion of
Hiwi2 protein associates with denser polysomal fractions in
a puromycin-sensitive manner (Figure 1E), indicating that
Hiwi2 interacts with actively translating ribosomal com-
plexes in the cancer cells.
Hiwi2 binds small RNAs in MDAMB231 cells
The presence of Hiwi2 protein in somatic cells implies the
presence of partner piRNAs, but available antibodies do not
immunoprecipitate Hiwi2 from human cells. Therefore we
established stable MDAMB231 clones that express a Flag-
tagged version of Hiwi2; further analysis was performed on
a line that showed only a modest increase in total Hiwi2
protein, to avoid any off-target effects associated with over-
expression (see Supplementary Figure S3).
Immunoprecipitation with anti-Flag antibody isolated
Hiwi2 from MDAMB231 lysates, along with a number of
other proteins (Figure 2A). MS analysis of the Hiwi2 IP
shows that somatic Hiwi2 interacts with a diverse range
of proteins, only some of which have previously been re-
ported as Piwi partners (Table 1). Heat shock proteins were
the most prominent partners, consistent with an association
with translating ribosomes (44); we also identied several
other translation-associated proteins. Tudor domain con-
taining proteins, which commonly associate with Piwi pro-
teins in the germline (45), were notably absent.
We extracted RNA from duplicate MDAMB231 Flag-
Hiwi2 immunoprecipitations (Hiwi2 IP) and used it to con-
struct small RNA libraries for SOLiD deep sequencing. We
also prepared small RNA libraries from MDAMB231 total
RNA, and commercially available human adult testis RNA,
for comparison. After ltering we obtained 3 894 997 reads
from the Hiwi2 IP that mapped to the human genome ref-
erence without error. The length distribution and broad an-
notation of the Hiwi2-bound small RNAs is shown in Fig-
ure 2B, and those of unselected MDAMB231 small RNAs
in Figure 2C. Both the repertoire and the size distribu-
tions of the Hiwi2 IP RNAs are very different from the
overall small RNA population in the cell line, consistent
with enrichment for particular RNA species: the Hiwi2 IP
distribution is bimodal and shifted toward larger, pi-sized
RNA species heavily dominated by tRNAs, whereas the to-
tal MDAMB231 sample has a modal length of 23, consis-
tent with microRNA being the dominant species. Control
immunoprecipitations using wild-type MDAMB231 lack-
ing Flag-Hiwi2 failed to enrich for any small RNAs.
We also nd that the population of Hiwi2-associated
piRNAs in MDAMB231 cells is distinctly different from
the Miwi2-associated piRNAs in the prepachytene mouse
testis reported by Hannon and colleagues (8). Since tR-
NAs were not specically reported in the prepachytene
dataset, we used our pipeline to re-map these data; the re-
sultant distribution of annotations is nearly identical to
that in the original report (Figure 2D). Most prepachytene
Miwi2-associated piRNAs are retrotransposon derived, but
we nd no enrichment for retrotransposon sequences in
the MDAMB231 Hiwi2 IP; conversely, most MDAMB231
Hiwi2 IP piRNAs are derived from tRNAs, but we nd very
few tRNAs in the prepachytene Miwi2 IP dataset. Further-
more, the MDAMB231 Hiwi2 IP did not recover piRNAs
from the large intergenic clusters characteristic of pachytene
testis piRNAs (46); this is unlikely to be an artefact of our
library preparation or mapping strategy, as we readily de-
tect these intergenic clusters in the adult testis library (Fig-
ure 2E). Despite the absence of the intergenic clusters, we
do detect the 3
UTR-associated piRNA clusters previously
observed in Drosophila ovaries, Xenopus eggs and mouse
testis (47); we also nd these 3
UTR clusters in the human
testis sample (Figure 2F). This raises the possibility of a
retrotransposon-independent function for Piwi that is com-
mon to germ and somatic cells.
Hiwi2-associated genic piRNAs derive from unmethylated
genomic regions
A small but signicant proportion of Hiwi2-associated piR-
NAs are derived from the sense strands of protein-coding
genes (6% of all reads, a 3-fold enrichment over unselected
small RNAs). Using an arbitrary threshold of ≥20 piR-
NAs per gene, we nd that there are 2681 and 1968 genes
producing piRNAs in the Hiwi2 IP and testis, respectively,
with a representative number of each (672 in both) coming
from 3
UTRs. The overlap between MDAMB231 and testis
is highly signicant for both gene and 3
UTR sets (
2
= P
< 0.0001; Figure 3A).
Miwi2 is required for faithful maintenance of methyla-
tion and transcriptional repression of retrotransposons in
developing male gametes (8,9). Retrotransposon sequences
were not enriched in our Hiwi2 IP, but given the known
function of piRNAs in suppressing homologous sequences,
we considered that Hiwi2-bound piRNAs might perform
a similar function in cancer cells; consequently we sought
to determine whether the gene-derived Hiwi2 piRNAs were
associated with hypermethylated and silent loci in can-
cer cells. We used Affymetrix GeneChip Human Gene
1.0 ST expression arrays and Illumina Innium 27K ar-
rays to determine expression state and methylation state in
MDAMB231-Flag-Hiwi2 cells. In total, 11 981 genes for
which we obtained expression data could be unambiguously
categorised by the Innium arrays as either methylated
(4338) or unmethylated (7643); 34 995 piRNAs mapped
to methylated genes whereas 184 907 piRNAs mapped to
unmethylated genes (Figure 3B). The differences in distri-
bution when considering those genes producing zero, few
(1–19) or many (>20) piRNAs indicate that unmethylated
genes are signicantly more likely to produce many piR-
NAs, and methylated genes are more likely to produce none
at all (Figure 3C). The increased production of piRNAs
from unmethylated loci is not merely a function of tran-
scription, as we nd no correlation between transcript levels
and piRNA abundance (Figure 3D).
Using Ingenuity Pathway Analysis, we nd that the genes
producing ≥50 piRNAs in both MDAMB231 and testis are
enriched for a range of ontologies, including development,
growth and proliferation (Figure 3E shows the top 20 most
signicant ontologies; a full list is presented in Supplemen-
tary Table S1). A more detailed analysis with GOrilla (48)
shows that many of the signicantly enriched ontologies in-
volve protein translation and related functions (Supplemen-
tary Table S2).
at Physical Sciences Library on November 6, 2014http://nar.oxfordjournals.org/Downloaded from
Nucleic Acids Research, 2014, Vol. 42, No. 14 8989
Figure 2. Hiwi2 immunoprecipitation from MDAMB231 cells captures a unique set of piRNAs. (A) SYPRO Ruby-stained PAGE gel showing proteins im-
munoprecipitated with Flag M2 antibody from native MDAMB231 cells (left) and MDAMB231 cells stably expressing Flag-Hiwi2 (right). Proteins that co-
immunoprecpitate with Hiwi2 are listed in Table 1. (B) Length distribution (main graph) and annotations (pie chart) of small RNAs co-immunoprecipitated
with Flag-Hiwi2. The genic class is expanded to show the relative number of piRNAs mapping to 5
UTRs, exons and 3
UTRs. (C) Length distribution
and annotations of small RNAs cloned from MDAMB231 total RNA. (D) Annotations of Miwi2-bound piRNAs from E16.5 mouse testis (8), re-mapped
to specically include tRNAs. (E, F). UCSC Genome Browser snapshots show custom track examples of the absence of Hiwi2-bound somatic piRNAs
from intergenic piRNA clusters (E) but their presence at 3
UTR clusters (F); small RNAs from the adult testis dataset map to both intergenic and 3
UTR
clusters. Reads mapping to the positive strand are in red, negative strand in blue.
at Physical Sciences Library on November 6, 2014http://nar.oxfordjournals.org/Downloaded from
8990 Nucleic Acids Research, 2014, Vol. 42, No. 14
Figure 3. Hiwi2-associated genic piRNAs are derived from unmethylated genes. (A) Venn diagram showing overlap of genes with ≥20 mapped piRNAs
from the Hiwi2 immunoprecipitation and in adult testis. Genes with ≥20 piRNAs mapping to the 3
UTR are shown in grey; those with ≥20 piRNAs
mapping across all coding regions are shown in orange. The overlap for both 3
UTRs and all coding regions is highly signicant (
2
test, P < 0.0001).
Genes targeted by Hiwi2-bound piRNAs are signicantly more likely to be unmethylated: (B) box-and-whisker plots show the number of piRNAs mapping
to unmethylated versus methylated genes (Student’s t-test, P < 0.0001) and (C) pie charts show the number of unmethylated versus methylated genes with
no, few (1–19) or many (≥ 20) mapped piRNAs (
2
test, P < 0.0001). (D) Scatter plot showing that the number of Hiwi2-bound piRNAs is not related to
the expression level of the parent gene in MDAMB213-Flag-Hiwi2 cells (R
2
= 0.05). (E) The 20 most signicant ontological functions produced by IPA
for genes with ≥50 mapped piRNAs in both the Hiwi2 IP and adult testis. The scale shows the –log
10
of the Benjamini–Hochberg corrected P-value; the
dashed line denotes corrected P = 0.05.
at Physical Sciences Library on November 6, 2014http://nar.oxfordjournals.org/Downloaded from
Nucleic Acids Research, 2014, Vol. 42, No. 14 8991
Table 1. Proteins identied by MS in Hiwi2-Flag immunoprecipitations.
Identied proteins Gene Class M.W. (kDa) Average % coverage
Piwi-like protein 4 (Hiwi2) PIWIL4 Piwi protein 97 32
Elongation factor 1-alpha 1 EEF1A1 Translational machinery 50 1
Ribosomal protein S27a RPS27a ” 18 5
Myosin-6 MYO6 Structural proteins 224 1
Tubulin, alpha ubiquitous chain TUBA1B ” 46 18
Tubulin beta TUBB ” 48 20
Tubulin beta-2C chain TUBB2C ” 50 18
Tubulin beta-6 chain TUBB6 ” 47 7
RuvB-like 1 RUVBL1 ATPase, DNA helicases 50 6
RuvB-like 2 RUVBL2 ” 51 9
BAG family molecular chaperone regulator 2 BAG2 Heat shock proteins and chaperones 24 14
Chaperonin-containing TCP1, subunit 8 CCT8 ” 59 2
Heat shock 90 kDa protein 1, alpha isoform 1 HSP90AA1 ” 98 3
Heat shock 70 kDa protein 1 HSPA1A/B ” 70 10
HSPA5 protein HSPA5 ” 72 7
Isoform 1 of heat shock cognate 71 kDa protein HSPA8 ” 71 24
60 kDa heat shock protein, mitochondrial HSPD1 ” 61 2
DnaJ homolog subfamily A member 1 DNAJA1 ” 45 2
Glyceraldehyde-3-phosphate dehydrogenase GAPDH Catabolic enzymes 36 3
Isoform M1 of pyruvate kinase isozymes M1/M2 PKM2 ” 58 2
26S protease regulatory subunit PSMC1 ” 49 5
Somatic Hiwi2 preferentially binds processed tRNA frag-
ments
The most striking nding from our annotation of Hiwi2-
bound small RNAs is the predominance of tRNA-derived
RNAs (Figure 2B). The tRNA species we nd do not
appear to be degradation products; rather they are pro-
cessed tRNA fragments (tRFs) with specic signatures. Al-
most three-quarters (73.5%) of Hiwi2-bound piRNAs in the
MDAMB231 cells were tRFs (Figure 2B);wehavecalled
them tRF-piRNAs. Almost 95% of the tRF-piRNAs are
derived from only nine specic tRNA isotypes representing
just ve amino acids: glycine, glutamic acid, lysine, aspar-
tic acid and valine (Figure 4A); most other tRNA isotypes
are also represented in the total number of tRF-piRNAs,
but collectively these contributed less than 5% of all tRF-
piRNA reads. We chose ve of the most abundant tRF-
piRNAs for independent validation using custom TaqMan
assays capable of amplifying only the processed tRF and
not the corresponding full-length tRNA. We were able to
detect all ve tRFs in MDAMB231 total RNA and testis
(Figure 4B) indicating that these fragments are not degrada-
tion products from full-length tRNA generated during the
IP or library preparation procedures.
The abundance of particular tRF-piRNA species in the
MDAMB231 Hiwi2 IP is not correlated to the number of
genomic loci by which they are encoded (Figure 4A), nor
do they appear correlated to the relative expression of the
mature tRNA isotypes in MDAMB231 cells (49), so their
prominence is not a function of gene dosage or expression
level of the tRNA from which they are derived. However
we did nd a strong correlation between the tRF-piRNAs
in the total MDAMB231 small RNA library and those in
the IP library (R
2
= 0.83; Figure 4C), which indicates that
the native relative abundance of tRF-piRNAs is captured
by the immunoprecipitation procedure. We also found that
many of the MDAMB231 tRF-piRNAs are present in the
total adult testis library (Figure 4D) and their abundance in
both datasets is highly correlated (R
2
= 0.80).
When considering the most abundant tRF-piRNAs indi-
vidually, it is clear that each species has a specic size dis-
tribution, consistent with selective processing (Figure 4E).
The exception is the aspartyl-tRNA isotype (Asp-GTC),
which gives a broad size distribution, and also is the only
dominant tRF-piRNA to be processed from the 3
end of
the tRNA: all other tRF-piRNAs are derived from the 5
end of the tRNA (Figure 4F). We also nd that Asp-GTC
tRF-piRNAs are virtually absent from the adult testis sam-
ple, while all the other dominant species are represented
(Figure 4F). All of the most abundant tRF-piRNAs contain
a conserved GG dinucleotide at position 17/18 or 18/19; al-
though this is a common feature of tRNAs in general, it is
noteworthy as this dinucleotide is required for the transla-
tional repressive effect of exogenous tRFs in vitro (50).
DISCUSSION
Since the discovery of piRNAs, the function of the Piwi-
piRNA pathway in the developing animal germline has
been studied extensively. But despite numerous reports of
Piwi expression in somatic cells (reviewed in (51)), and can-
cer cells (reviewed in (52)), the function of the system in
the soma has been obscure. Here we have found that one
of the human Piwis, Hiwi2, is widely expressed at low levels
across somatic tissues, and is also expressed at similar lev-
els in human cancer cell lines. By studying one cancer cell
line in detail, we nd evidence for a conserved function of
the Piwi-piRNA pathway in the regulation of protein trans-
lation. Taken together, the protein partners of Hiwi2, its
cytoplasmic location and the derivation of piRNAs from
expressed genes and specic tRNAs in MDMBA231 cells
and testis, all point to a role in translation regulation. The
ndings also suggest that if Hiwi2 functions in translational
control in somatic cells, it may also do so in the germline.
We began this study with the idea that Hiwi2, given its
known role in de novo methylation and repression of retro-
transposons, could be responsible for aberrant methylation
in cancer cells, which typically exhibit regional cytosine hy-
at Physical Sciences Library on November 6, 2014http://nar.oxfordjournals.org/Downloaded from
8992 Nucleic Acids Research, 2014, Vol. 42, No. 14
Figure 4. tRNA-derived piRNAs dominate the Hiwi2-IP and are also present in the adult testis. (A) Scatter plot showing the abundance of each tRF-
piRNA in the Hiwi2 IP, plotted against the number of its genomic copies. The nine tRF-piRNAs with ≥10
5
reads are highlighted. (B) TaqMan validation of
tRF-piRNA expression in MDBMA231 cells and human adult testis. Taqman quantication of mir-145 is shown for comparison. (C) Scatter plot showing
the ranked abundance of tRF-piRNAs in the Hiwi2 IP versus that in MDBMA231 cells. (D) Scatter plot showing the ranked abundance of tRF-piRNAs in
the Hiwi2 IP versus that in the human adult testis. (E) Size distributions of the six most abundant Hiwi2-bound tRF-piRNAs and (F) the six tRF-piRNAs
from Hiwi2 IP and testis mapped to a representative genomic locus.
at Physical Sciences Library on November 6, 2014http://nar.oxfordjournals.org/Downloaded from
Nucleic Acids Research, 2014, Vol. 42, No. 14 8993
permethylation and silencing concomitant with a global
loss of 5-methylcytosine that is largely attributable to loss of
epigenetic repression at retrotransposons and other repeats
(53). We considered that somatic Hiwi2 might capture genic
sequences by accident, and silence them when acting to re-
press the widespread retrotransposon activation. We thus
sought evidence for Hiwi2-bound piRNAs that may drive
gene silencing in cancer cells. However, we found no enrich-
ment of retrotransposon-derived piRNA sequences in the
Hiwi2 IP, and no association between methylation of a lo-
cus and abundance of the piRNAs derived from it. On the
contrary, the majority of Hiwi2-bound piRNAs are derived
from unmethylated loci, and their abundance has no appar-
ent relationship to the abundance of the parent transcript.
Derivation of piRNAs from unmethylated and expressed
genes is inconsistent with a role for Hiwi2 in gene silenc-
ing, but may be consistent with a role in post-transcriptional
gene regulation. Many of the genes producing large num-
bers of piRNAs were common between the Hiwi2 IP and
adult testis, which raises the possibility that the piRNAs
may have a function that is common to germline and soma.
Genes producing piRNAs cluster in a range of highly signif-
icant ontologies, in which cell growth and morphology func-
tions are prominent. Functions related to RNA and protein
biosynthesis, metabolism and transport are also among the
most signicant.
Gene-derived piRNAs, whatever their function, were
vastly outnumbered in the Hiwi2 IP dataset by tRNA-
derived RNA fragments (tRF). The tRFs are a class of small
RNA that have been observed in a variety of settings and,
like piRNAs, appear to be a phylogenetically ancient species
of small regulatory RNA. They have been found in humans
and other mammals (54), plants (55), yeast (56), protozoa
(57) and even archaea (58,59). tRFs are classied accord-
ing to their processing signature, which essentially relates
to the part of the tRNA from which they are cleaved (54).
All but one of the tRFs in our dataset are 5
tRFs, and can
be distinguished from oxidative stress-induced, angiogenin-
dependent tRNA ‘halves’ on the basis of their length (60).
The relationship, if any, between tRF-piRNAs and gene-
derived piRNAs is yet to be explained.
The generation of mammalian 5
tRFs has been re-
ported to be Dicer-dependent in some studies and Dicer-
independent in others (61–63), and this is likely a reection
of the heterogeneity in this growing class of small RNAs;
they vary in size and sequence composition and can also be
inuenced by culture or growth conditions. The Hiwi2 tRF-
piRNAs identied in this study are a case in point: they dif-
fer in their processing features, although none of the most
abundant show the size or 5
U preference characteristic of
Dicer processing. The principal unifying feature of the tRF-
piRNAs we observe is their association with Hiwi2.
Our ndings point toward a role for Hiwi2 in transla-
tional control. First, Hiwi2 partners predominantly with
tRF-piRNAs (Figures 2Band4); although their mecha-
nisms of action are poorly understood, available evidence
strongly implicates tRFs as translational repressors, with
both sequence-dependent and -independent modes of ac-
tion (50,58,63). Second, Hiwi2 resides in the cytoplasm
where it partners with actively translating ribosomes (Fig-
ures 1C,Dand2E) and other proteins involved in transla-
tion, such as eEF1-alpha and the heat shock proteins (Table
1). Association of Hiwi2 with piRNAs derived from sense
strands of active genes, independent of the genes’ transcript
levels (Figure 3D), is also consistent with a role for Hiwi2
in translational regulation. The murine Piwi proteins Miwi
and Mili have both previously been linked to translational
regulation in developing gametes (43,64); thus the function
of the Piwi-piRNA pathway in translational control is likely
to be conserved across species, and perhaps also through
germline and soma.
While this study is the rst report of tRF association with
a Piwi protein in an animal, there is precedent in the proto-
zoa: shorter 18–22 nt 3
tRFs are found complexed with the
growth-essential Piwi protein Twi12 in Tetrahymena ther-
mophila, although their biological function remains unchar-
acterised (57). In mammalian cells, 5
tRFs associate only
weakly with the classic Ago proteins (62), and in most
species protein partners of 5
tRFs have not been identied.
A signicant exception is the archaeon Haloferax volcanii,
where 5
tRFs are found complexed with actively translating
ribosomes (58); these 5
tRFs are the size of piRNAs (26nt)
and they act to repress translation in a stress-dependent
manner. These data point toward a primitive translational
control function of tRF-piRNAs that acts in the regulation
of gene output in response to changing environmental con-
ditions. But are the archaeal tRFs also complexed with ar-
chaeal Piwi proteins? This has not been studied, but our
ndings here suggest that these may well be.
Here we presented evidence that a Piwi-piRNA pathway
may have a role in translational regulation in human so-
matic cells via Hiwi2 and its associated piRNAs. Correla-
tion with human testis piRNAs suggests that this function
may also be present in human germ cells. Taken together
with evidence regarding Piwi and small RNAs in primitive
organisms, our data suggest an ancient and conserved func-
tion for the pathway that may predate the now prominent
transposon-repressive function in the metazoan germline.
SUPPLEMENTARY DATA
Supplementary Data are available at NAR Online.
ACKNOWLEDGEMENTS
The authors thank: Gunter Meister for providing the
Hiwi2-Flag construct, Richard Saffery and Nick Wong for
assistance with Innium arrays, the Ramaciotti Centre for
Gene Function Analysis and the Bioanalytical Mass Spec-
trometry Facility at UNSW for assistance with expression
arrays and mass spectrometry, Rupert Shuttleworth for as-
sistance with scripting and annotation, and Grace Wei for
assistance with polysome proling. J.E.C. is an ARC DE-
CRA Fellow. T.P. is an NHMRC Senior Research Fellow.
C.M.S. and G.H. are ARC Future Fellows.
FUNDING
National Health and Medical Research Council (NHMRC)
of Australia [APP1025210 to C.M.S]; in part by the Aus-
tralian Research Council (ARC) [DP130103027 to G.H.].
Funding for open access charge: National Health and Med-
ical Research Council.
at Physical Sciences Library on November 6, 2014http://nar.oxfordjournals.org/Downloaded from
8994 Nucleic Acids Research, 2014, Vol. 42, No. 14
Conict of interest statement. None declared.
REFERENCES
1. Burroughs,A.M., Iyer,L.M. and Aravind,L. (2013) Two novel PIWI
families: roles in inter-genomic conicts in bacteria and
mediator-dependent modulation of transcription in
eukaryotes. Biology Direct, 8, 13.
2. Li,Y., Liu,X., Huang,L., Guo,H. and Wang,X.J. (2010) Potential
coexistence of both bacterial and eukaryotic small RNA biogenesis
and functional related protein homologs in Archaea. J. Genet.
Genomics, 37, 493–503.
3. Cerutti,L., Mian,N. and Bateman,A. (2000) Domains in gene
silencing and cell differentiation proteins: the novel PAZ domain and
redenition of the Piwi domain. Trends Biochem. Sci., 25, 481–482.
4. Juliano,C., Wang,J. and Lin,H. (2011) Uniting germline and stem
cells: the function of Piwi proteins and the piRNA pathway in
diverse organisms. Annu. Rev. Genet., 45, 447–469.
5. Cox,D.N., Chao,A., Baker,J., Chang,L., Qiao,D. and Lin,H. (1998)
A novel class of evolutionarily conserved genes dened by piwi are
essential for stem cell self-renewal. Genes Dev., 12, 3715–3727.
6. Deng,W. and Lin,H. (2002) miwi, a murine homolog of piwi, encodes
a cytoplasmic protein essential for spermatogenesis. Dev. Cell, 2,
819–830.
7. Carmell,M.A., Girard,A., van de Kant,H.J., Bourc’his,D.,
Bestor,T.H., de Rooij,D.G. and Hannon,G.J. (2007) MIWI2 is
essential for spermatogenesis and repression of transposons in the
mouse male germline. Dev. Cell, 12, 503–514.
8. Aravin,A.A., Sachidanandam,R., Bourc’his,D., Schaefer,C.,
Pezic,D., Toth,K.F., Bestor,T. and Hannon,G.J. (2008) A piRNA
pathway primed by individual transposons is linked to de novo DNA
methylation in mice. Mol. Cell, 31, 785–799.
9. Kuramochi-Miyagawa,S., Watanabe,T., Gotoh,K., Totoki,Y.,
Toyoda,A., Ikawa,M., Asada,N., Kojima,K., Yamaguchi,Y.,
Ijiri,T.W. et al. (2008) DNA methylation of retrotransposon genes is
regulated by Piwi family members MILI and MIWI2 in murine fetal
testes. Genes Dev., 22, 908–917.
10. Unhavaithaya,Y., Hao,Y., Beyret,E., Yin,H.,
Kuramochi-Miyagawa,S., Nakano,T. and Lin,H. (2009) MILI, a
PIWI-interacting RNA-binding protein, is required for germ line
stem cell self-renewal and appears to positively regulate translation.
J. Biol. Chem., 284, 6507–6519.
11. Aravin,A., Gaidatzis,D., Pfeffer,S., Lagos-Quintana,M., Landgraf,P.,
Iovino,N., Morris,P., Brownstein,M.J., Kuramochi-Miyagawa,S.,
Nakano,T. et al. (2006) A novel class of small RNAs bind to MILI
protein in mouse testes. Nature, 442, 203–207.
12. Grivna,S.T., Beyret,E., Wang,Z. and Lin,H. (2006) A novel class of
small RNAs in mouse spermatogenic cells. Genes Dev., 20,
1709–1714.
13. Saito,K., Nishida,K.M., Mori,T., Kawamura,Y., Miyoshi,K.,
Nagami,T., Siomi,H. and Siomi,M.C. (2006) Specic association of
Piwi with rasiRNAs derived from retrotransposon and
heterochromatic regions in the Drosophila genome. Genes Dev., 20,
2214–2222.
14. Houwing,S., Kamminga,L.M., Berezikov,E., Cronembold,D.,
Girard,A., van den Elst,H., Filippov,D.V., Blaser,H., Raz,E.,
Moens,C.B. et al. (2007) A role for Piwi and piRNAs in germ cell
maintenance and transposon silencing in Zebrash. Cell, 129,
69–82.
15. Aravin,A.A., Sachidanandam,R., Girard,A., Fejes-Toth,K. and
Hannon,G.J. (2007) Developmentally regulated piRNA clusters
implicate MILI in transposon control. Science, 316, 744–747.
16. Watanabe,T., Takeda,A., Tsukiyama,T., Mise,K., Okuno,T.,
Sasaki,H., Minami,N. and Imai,H. (2006) Identication and
characterization of two novel classes of small RNAs in the mouse
germline: retrotransposon-derived siRNAs in oocytes and germline
small RNAs in testes. Genes Dev., 20, 1732–1743.
17. Girard,A., Sachidanandam,R., Hannon,G.J. and Carmell,M.A.
(2006) A germline-specic class of small RNAs binds mammalian
Piwi proteins. Nature, 442, 199–202.
18. Siomi,M.C., Sato,K., Pezic,D. and Aravin,A.A. (2011)
PIWI-interacting small RNAs: the vanguard of genome defence.
Nat. Rev. Mol. Cell Biol., 12, 246–258.
19. Peng,J.C. and Lin,H. (2013) Beyond transposons: the epigenetic and
somatic functions of the Piwi-piRNA mechanism. Curr. Opin. Cell
Biol., 25, 190–194.
20. Ro,S., Song,R., Park,C., Zheng,H., Sanders,K.M. and Yan,W. (2007)
Cloning and expression proling of small RNAs expressed in the
mouse ovary. RNA, 13, 2366–2380.
21. Yan,Z., Hu,H.Y., Jiang,X., Maierhofer,V., Neb,E., He,L., Hu,Y.,
Hu,H., Li,N., Chen,W. et al. (2011) Widespread expression of
piRNA-like molecules in somatic tissues. Nucleic Acids Res., 39,
6596–6607.
22. Ghildiyal,M., Seitz,H., Horwich,M.D., Li,C., Du,T., Lee,S., Xu,J.,
Kittler,E.L., Zapp,M.L., Weng,Z. et al. (2008) Endogenous siRNAs
derived from transposons and mRNAs in Drosophila somatic cells.
Science, 320, 1077–1081.
23. Malone,C.D., Brennecke,J., Dus,M., Stark,A., McCombie,W.R.,
Sachidanandam,R. and Hannon,G.J. (2009) Specialized piRNA
pathways act in germline and somatic tissues of the Drosophila
ovary. Cell, 137, 522–535.
24. Li,C., Vagin,V.V., Lee,S., Xu,J., Ma,S., Xi,H., Seitz,H.,
Horwich,M.D., Syrzycka,M., Honda,B.M. et al. (2009) Collapse of
germline piRNAs in the absence of Argonaute3 reveals somatic
piRNAs in ies. Cell, 137, 509–521.
25. Lee,E.J., Banerjee,S., Zhou,H., Jammalamadaka,A., Arcila,M.,
Manjunath,B.S. and Kosik,K.S. (2011) Identication of piRNAs in
the central nervous system. RNA, 17, 1090–1099.
26. Rajasethupathy,P., Antonov,I., Sheridan,R., Frey,S., Sander,C.,
Tuschl,T. and Kandel,E.R. (2012) A role for neuronal piRNAs in the
epigenetic control of memory-related synaptic plasticity. Cell, 149,
693–707.
27. Seipel,K., Yanze,N. and Schmid,V. (2004) The germ line and somatic
stem cell gene Cniwi in the jellysh Podocoryne carnea. Int. J. Dev.
Biol., 48, 1–7.
28. Funayama,N., Nakatsukasa,M., Mohri,K., Masuda,Y. and
Agata,K. (2010) Piwi expression in archeocytes and choanocytes in
demosponges: insights into the stem cell system in demosponges.
Evol. Dev.,
12,
275–287.
29. Palakodeti,D., Smielewska,M., Lu,Y.C., Yeo,G.W. and
Graveley,B.R. (2008) The PIWI proteins SMEDWI-2 and
SMEDWI-3 are required for stem cell function and piRNA
expression in planarians. RNA, 14, 1174–1186.
30. Reddien,P.W., Oviedo,N.J., Jennings,J.R., Jenkin,J.C. and Sanchez
Alvarado,A. (2005) SMEDWI-2 is a PIWI-like protein that regulates
planarian stem cells. Science, 310, 1327–1330.
31. Giani,V.C. Jr, Yamaguchi,E., Boyle,M.J. and
Seaver,E.C. (2011) Somatic and germline expression of piwi during
development and regeneration in the marine polychaete annelid
Capitella teleta. EvoDevo, 2, 10.
32. Rinkevich,Y., Rosner,A., Rabinowitz,C., Lapidot,Z., Moiseeva,E.
and Rinkevich,B. (2010) Piwi positive cells that line the vasculature
epithelium, underlie whole body regeneration in a basal chordate.
Dev. Biol., 345, 94–104.
33. Nolde,M.J., Cheng,E.C., Guo,S. and Lin,H. (2013) Piwi genes are
dispensable for normal hematopoiesis in mice. PloS one, 8, e71950.
34. Jacobs,J.E., Wagner,M., Dhahbi,J., Boffelli,D. and Martin,D.I.
(2013) Deciency of MIWI2 (Piwil4) induces mouse erythroleukemia
cell differentiation, but has no effect on hematopoiesis in vivo. PloS
One, 8, e82573.
35. Grochola,L.F., Greither,T., Taubert,H., Moller,P., Knippschild,U.,
Udelnow,A., Henne-Bruns,D. and Wurl,P. (2008) The stem
cell-associated Hiwi gene in human adenocarcinoma of the pancreas:
expression and risk of tumour-related death. Br.J.Cancer, 99,
1083–1088.
36. He,W., Wang,Z., Wang,Q., Fan,Q., Shou,C., Wang,J.,
Giercksky,K.E., Nesland,J.M. and Suo,Z. (2009) Expression of
HIWI in human esophageal squamous cell carcinoma is signicantly
associated with poorer prognosis. BMC Cancer, 9, 426.
37. Liu,X., Sun,Y., Guo,J., Ma,H., Li,J., Dong,B., Jin,G., Zhang,J.,
Wu,J., Meng,L. et al. (2006) Expression of hiwi gene in human
gastric cancer was associated with proliferation of cancer cells. Int. J.
Cancer, 118, 1922–1929.
38. Qiao,D., Zeeman,A.M., Deng,W., Looijenga,L.H. and Lin,H. (2002)
Molecular characterization of hiwi, a human member of the piwi
gene family whose overexpression is correlated to seminomas.
Oncogene, 21, 3988–3999.
at Physical Sciences Library on November 6, 2014http://nar.oxfordjournals.org/Downloaded from
Nucleic Acids Research, 2014, Vol. 42, No. 14 8995
39. Cheng,J., Guo,J.M., Xiao,B.X., Miao,Y., Jiang,Z., Zhou,H. and
Li,Q.N. (2011) piRNA, the new non-coding RNA, is aberrantly
expressed in human cancer cells. Clin. Chim. Acta, 412, 1621–1625.
40. Lu,Y., Li,C., Zhang,K., Sun,H., Tao,D., Liu,Y., Zhang,S. and Ma,Y.
(2010) Identication of piRNAs in Hela cells by massive parallel
sequencing. BMB Rep., 43, 635–641.
41. Siddiqi,S. and Matushansky,I. (2012) Piwis and piwi-interacting
RNAs in the epigenetics of cancer. J. Cell. Biochem., 113, 373–380.
42. Ehrlich,M. (2009) DNA hypomethylation in cancer cells.
Epigenomics, 1, 239–259.
43. Grivna,S.T., Pyhtila,B. and Lin,H. (2006) MIWI associates with
translational machinery and PIWI-interacting RNAs (piRNAs) in
regulating spermatogenesis. Proc. Natl. Acad. Sci. USA, 103,
13415–13420.
44. Nelson,R.J., Ziegelhoffer,T., Nicolet,C., Werner-Washburne,M. and
Craig,E.A. (1992) The translation machinery and 70 kd heat shock
protein cooperate in protein synthesis. Cell, 71, 97–105.
45. Vagin,V.V., Wohlschlegel,J., Qu,J., Jonsson,Z., Huang,X., Chuma,S.,
Girard,A., Sachidanandam,R., Hannon,G.J. and Aravin,A.A. (2009)
Proteomic analysis of murine Piwi proteins reveals a role for arginine
methylation in specifying interaction with Tudor family members.
Genes Dev., 23, 1749–1762.
46. Li,X.Z., Roy,C.K., Dong,X., Bolcun-Filas,E., Wang,J., Han,B.W.,
Xu,J., Moore,M.J., Schimenti,J.C., Weng,Z. et al. (2013) An ancient
transcription factor initiates the burst of piRNA production during
early meiosis in mouse testes. Mol. Cell, 50, 67–81.
47. Robine,N., Lau,N.C., Balla,S., Jin,Z., Okamura,K.,
Kuramochi-Miyagawa,S., Blower,M.D. and Lai,E.C. (2009) A
broadly conserved pathway generates 3
UTR-directed primary
piRNAs. Curr. Biol., 19, 2066–2076.
48. Eden,E., Navon,R., Steinfeld,I., Lipson,D. and
Yakhini,Z. (2009) GOrilla: a tool for discovery and visualization of
enriched GO terms in ranked gene lists. BMC Bioinformatics, 10, 48.
49. Pavon-Eternod,M., Gomes,S., Geslain,R., Dai,Q., Rosner,M.R. and
Pan,T. (2009) tRNA over-expression in breast cancer and functional
consequences. Nucleic Acids Res., 37, 7268–7280.
50. Sobala,A. and Hutvagner,G. (2013) Small RNAs derived from the 5
end of tRNA can inhibit protein translation in human cells. RNA
Biol., 10, 553–563.
51. Ishizu,H., Siomi,H. and Siomi,M.C. (2012) Biology of
PIWI-interacting RNAs: new insights into biogenesis and function
inside and outside of germlines. Genes Dev., 26, 2361–2373.
52. Suzuki,R., Honda,S. and Kirino,Y. (2012) PIWI expression and
function in cancer. Front. Genet., 3, 204.
53. Ehrlich,M. (2006) Cancer-linked DNA hypomethylation and its
relationship to hypermethylation. Curr. Top. Microbiol. Immunol.,
310, 251–274.
54. Sobala,A. and Hutvagner,G. (2011) Transfer RNA-derived
fragments: origins, processing, and functions. Wiley Interdiscip. Rev.
RNA, 2, 853–862.
55. Loss-Morais,G., Waterhouse,P.M. and Margis,R. (2013) Description
of plant tRNA-derived RNA fragments (tRFs) associated with
argonaute and identication of their putative targets. Biology Direct,
8:6.
56. Buhler,M., Spies,N., Bartel,D.P. and Moazed,D. (2008)
TRAMP-mediated RNA surveillance prevents spurious entry of
RNAs into the Schizosaccharomyces pombe siRNA pathway. Nat.
Struct. Mol. Biol., 15, 1015–1023.
57. Couvillion,M.T., Sachidanandam,R. and Collins,K. (2010) A
growth-essential Tetrahymena Piwi protein carries tRNA fragment
cargo. Genes Dev., 24, 2742–2747.
58. Gebetsberger,J., Zywicki,M., Kunzi,A. and Polacek,N. (2012)
tRNA-derived fragments target the ribosome and function as
regulatory non-coding RNA in Haloferax volcanii. Archaea, 2012,
260909.
59. Heyer,R., Dorr,M., Jellen-Ritter,A., Spath,B., Babski,J.,
Jaschinski,K., Soppa,J. and Marchfelder,A. (2012) High throughput
sequencing reveals a plethora of small RNAs including tRNA
derived fragments in Haloferax volcanii. RNA Biol., 9, 1011–1018.
60. Thompson,D.M., Lu,C., Green,P.J. and Parker,R. (2008) tRNA
cleavage is a conserved response to oxidative stress in eukaryotes.
RNA, 14, 2095–2103.
61. Babiarz,J.E., Ruby,J.G., Wang,Y., Bartel,D.P. and Blelloch,R. (2008)
Mouse ES cells express endogenous shRNAs, siRNAs, and other
microprocessor-independent, Dicer-dependent small RNAs. Genes
Dev., 22, 2773–2785.
62. Cole,C., Sobala,A., Lu,C., Thatcher,S.R., Bowman,A., Brown,J.W.,
Green,P.J., Barton,G.J. and Hutvagner,G. (2009) Filtering of deep
sequencing data reveals the existence of abundant Dicer-dependent
smallRNAsderivedfromtRNAs.RNA, 15, 2147–2160.
63. Haussecker,D., Huang,Y., Lau,A., Parameswaran,P., Fire,A.Z. and
Kay,M.A. (2010) Human tRNA-derived small RNAs in the global
regulation of RNA silencing. RNA, 16, 673–695.
64. Vourekas,A., Zheng,Q., Alexiou,P., Maragkakis,M., Kirino,Y.,
Gregory,B.D. and Mourelatos,Z. (2012) Mili and Miwi target RNA
repertoire reveals piRNA biogenesis and function of Miwi in
spermiogenesis. Nat. Struct. Mol. Biol., 19, 773–781.
65. Clancy,J.L., Wei,G.H., Echner,N., Humphreys,D.T., Beilharz,T.H.
and Preiss,T. (2011) mRNA isoform diversity can obscure detection
of miRNA-mediated control of translation. RNA, 17,
1025–1031.
at Physical Sciences Library on November 6, 2014http://nar.oxfordjournals.org/Downloaded from
