Content uploaded by Ali Asghar Baloch
Author content
All content in this area was uploaded by Ali Asghar Baloch on Jul 14, 2023
Content may be subject to copyright.
Submitted 28 December 2022
Accepted 1 June 2023
Published 14 July 2023
Corresponding author
Veronika Piačková,
piackova@frov.jcu.cz
Academic editor
Yasmina Abd-Elhakim
Additional Information and
Declarations can be found on
page 24
DOI 10.7717/peerj.15614
Copyright
2023 Baloch et al.
Distributed under
Creative Commons CC-BY 4.0
OPEN ACCESS
Immune responses in carp strains with
different susceptibility to carp edema
virus disease
Ali Asghar Baloch1, Dieter Steinhagen2, David Gela1, Martin Kocour1,
Veronika Piačková1and Mikolaj Adamek2
1Faculty of Fisheries and Protection of Waters, South Bohemian Research Center of Aquaculture and
Biodiversity of Hydrocenoses, University of South Bohemia in České Budějovice, Vodňany, Czech Republic
2Fish Disease Research Unit, Institute for Parasitology, University of Veterinary Medicine Hannover,
Hannover, Germany
ABSTRACT
Carp edema virus disease (CEVD), also known as koi sleepy disease (KSD), represents
a serious threat to the carp industry. The expression of immune-related genes to CEV
infections could lead to the selection of crucial biomarkers of the development of the
disease. The expression of a total of eleven immune-related genes encoding cytokines
(IL-1β, IL-10, IL-6a, and TNF-α2), antiviral response (Mx2), cellular receptors
(CD4, CD8b1, and GzmA), immunoglobulin (IgM), and genes encoding-mucins was
monitored in gills of four differently KSD-susceptible strains of carp (Amur wild carp,
Amur Sasan, AS; Ropsha scaly carp, Rop; Prerov scaly carp, PS; and koi) on days 6
and 11 post-infection. Carp strains were infected through two cohabitation infection
trials with CEV genogroups I or IIa. The results showed that during the infection
with both CEV genogroups, KSD-susceptible koi induced an innate immune response
with significant up-regulation (p<0.05) of IL-1β, IL-10, IL-6a, and TNF-α2 genes
on both 6 and 11 days post-infection (dpi) compared to the fish sampled on day 0.
Compared to koi, AS and Rop strains showed up-regulation of IL-6a and TNF-α2
but no other cytokine genes. During the infection with CEV genogroup IIa, Mx2 was
significantly up-regulated in all strains and peaked on 6 dpi in AS, PS, and Rop. In koi,
it remained high until 11 dpi. With genogroup I infection, Mx2 was up-expressed in
koi on 6 dpi and in PS on both 6 and 11 dpi. No significant differences were noticed
in selected mucin genes expression measured in gills of any carp strains exposed to
both CEV genogroups. During both CEV genogroups infections, the expression levels
of most of the genes for T cell response, including CD4, CD8b1, and GzmA were down-
regulated in AS and koi at all time points compared to day 0 control. The expression
data for the above experimental trials suggest that both CEV genogroups infections in
common carp strains lead to activation of the same expression pattern regardless of
the fish’s susceptibility towards the virus. The expression of the same genes in AS and
koi responding to CEV genogroup IIa infection in mucosal tissues such as gill, gut,
and skin showed the significant up-regulation of all the cytokine genes in gill and gut
tissues from koi carp at 5 dpi. Significant down-regulation of CD4 and GzmA levels were
only detected in koi gill on 5 dpi but not in other tissues. AS carp displayed significant
up-expression of Mx2 gene in all mucosal tissues on 5 dpi, whereas in koi, it was up-
regulated in gill and gut only. In both carp strains, gill harbored a higher virus load on 5
dpi compared to the other tissues. The results showed that resistance to CEV could not
How to cite this article Baloch AA, Steinhagen D, Gela D, Kocour M, Piačková V, Adamek M. 2023. Immune responses in carp strains
with different susceptibility to carp edema virus disease. PeerJ 11:e15614 http://doi.org/10.7717/peerj.15614
be linked with the selected immune responses measured. The up-regulation of mRNA
expression of most of the selected immune-related genes in koi gill and gut suggests that
CEV induces a more systemic mucosal immune response not restricted to the target
tissue of gills.
Subjects Aquaculture, Fisheries and Fish Science, Veterinary Medicine, Virology, Zoology,
Freshwater Biology
Keywords Carp edema virus, Common carp, Gene expression, Immune related genes,
Mucosal response
INTRODUCTION
Common carp rearing condition has intensified in recent decades, which could have
resulted in increased chronic stress and a weakened immune system, increasing their
susceptibility to various pathogens. Among them, infection caused by carp edema virus
(CEV) is gaining attention, as it is characterized by high mortality rates but can be
also manifested as subclinical infection (Amita et al., 2002;Ono, Nagai & Sugai, 1986).
Therefore the disease caused by CEV and known as carp edema virus disease (CEVD),
or koi sleepy disease (KSD) could represent a significant threat to the carp industry. The
KSD name has been derived from the main clinical signs manifested by affected fish which
usually show lethargy and increasing unresponsiveness, as they can be seen lying in the
bottom of tanks for extended periods (Pretto et al., 2013). Gross lesions incorporating
spreading hemorrhagic skin lesions with edema, particularly in the abdomen, pale gills,
sunken eyes, and ulcerative inflammation on the anus may also be seen (Oyamatsu et al.,
1997). A large amount of mucus is produced on the skin and gills as well (Zhang et al.,
2017). The CEVD/KSD was first reported in koi farms in Japan in 1974, where it caused
substantial mortalities (Amita et al., 2002;Ono, Nagai & Sugai, 1986) and economic losses.
Since then, the disease has spread almost worldwide (Machat et al., 2021).
Carp edema virus (CEV), which belongs to the Poxviridae family, has a mulberry-like
structure made up of double-stranded DNA about 250–280 nm in diameter (Oyamatsu et
al., 1997). The infection seems to be most prevalent in the gills. An electron microscope
revealed that diseased fish exhibit morphologically altered gill epithelium that displays
poxvirus-like structures (Jung-Schroers et al., 2015;Miyazaki, Isshiki & Katsuyuki, 2005;
Haenen et al., 2014;Pretto et al., 2013). Two to three different genogroups (genetic clades)
of CEV have been so far characterized: I, IIa, and IIb (Way & Stone, 2013;Matras et al.,
2017;Adamek et al., 2017b). Common carp are the primary hosts of genogroup I, which
has been detected in most European waters. A majority of genogroup IIa reports have
been in koi, but not exclusively, while genogroup IIb has been detected in both carp and
koi samples (Matras et al., 2017;Adamek et al., 2018;Matějíčková et al., 2020;Ouyang et al.,
2020).
Like higher vertebrates, teleosts have an immune system that employs both specific
(adaptive) and non-specific (innate) responses against pathogens such as viruses, bacteria,
and parasites (Whyte, 2007). The non-specific immune response is considered the very first
Baloch et al. (2023), PeerJ, DOI 10.7717/peerj.15614 2/31
defence against pathogens. Unlike other vertebrates, fish primarily rely on the non-specific
immune system for survival during early embryonic development (Rombout et al., 2005).
The fact that fish are poikilothermic also means they rely less on some of the conventional
characteristics of adaptive immunity, due to slow and relatively low antibody defences and
slow proliferation, maturation, and memory of lymphocytes. Thus, it is considered that
innate immune responses play a fundamental role in fish immunity.
In higher animals infections with poxviruses are contained through combination of
innate and adaptive immunity. The response to infection is primary undertaken by the
inflammatory and natural killer (NK) cells (Smith & Kotwal, 2002). These non-specific
responses control viral replication and allow the time for mounting a specific antigenic
adaptive response (Magnadottir, 2010). For instance, T lymphocytes, also referred to as T
cells, are a crucial component of the adaptive immune response to infections. They are a
type of white blood cell that have the ability to recognize and respond to viral antigens
and regulate the immune response through cytokine production (Andersen et al., 2006;
Tortorella et al., 2000). Research has indicated that T cell responses play a vital role in
controlling pox virus infections, and the activation and expansion of T cells is a significant
factor in resolving the infection (Yamaguchi et al., 2019). Furthermore, genetic variations
in fish have been shown to affect the T cell response magnitude and specificity to pox
viruses, which may impact the outcome of the infection (Adamek et al., 2021). During CEV
infection in carp the immune response is somehow complicated by onset of environmental
immunosuppression caused by intoxication with ammonia (Adamek et al., 2021), however
the host–virus interaction is reciprocally impacted by host genetic competitiveness and virus
genomic characteristics. Several emerging genogroups of CEV have so far been identified
among carp populations worldwide. These genogroups are seemingly selective mutations
targeted toward the numerous variants within the common carp strains/species (Adamek
et al., 2017c). It has been also reported, that there are differences between various strains
of carp in the expression of cytokines during viral infections, specifically the interferon
(IFN) and interferon-stimulated genes (ISGs) (Tadmor-Levi et al., 2019). Several varieties
of common carp have emerged as an outcome of natural geographic separation of common
carp groups and domestication, providing a wide range of genetic resources. As already
has been published, there may be a large variations in susceptibility among strains that
have a different genetic background, as was evident in studies focused on evaluation
of susceptibility of different common carp strains to experimental infection of cyprinid
herpesvirus 3 (CyHV-3) (Shapira et al., 2005;Rakus et al., 2009;Piačková et al., 2013;
Adamek et al., 2019). Comparatively to other viral diseases in fish, scant studies have been
conducted on the gene expression patterns of immune-related genes in CEV-infected carp
strains. In case of CEV, researchers have exposed different strains of carp (Amur wild carp,
Amur sasan, AS; Ropsha scaly carp, Rop; Prerov scaly carp, PS; and koi), having different
susceptibility to CEV, genogroups I and IIa (Adamek et al., 2017a). However, the study
focused primarily on determining whether carp strains were susceptible to the disease, and
only type I interferon responses as the parameter of non-specific immunity were assessed for
CEV affected carp strains. The mucosal-epithelial barrier is a vital component of the innate
immune response of fish against viruses (Langevin et al., 2013;Secombes & Zou, 2017). It
Baloch et al. (2023), PeerJ, DOI 10.7717/peerj.15614 3/31
includes the gills, skin, and gastrointestinal tract as its main components (Huttenhuis et al.,
2006;Magnadottir, 2010), all of which encounter pathogenic agents present in the aquatic
environment. This barrier employs various mechanisms to hinder pathogen invasion,
including the release of antimicrobial factors by immune cells or tissues. The gut mucosal
layer serves as the first barrier against pathogen invasion, but it also provides nutrients for
bacterial pathogens (Garcia et al., 1997), resulting in a delicate balance between gut mucosal
secretions and microorganisms. Studies on innate immune responses of fish gut epithelial
cells against viral infections are limited. Carp gut epithelial cells exhibit increased expression
of cytokines such as IFN-α2, IL-1 β, and iNOS upon cyprinid herpes virus 3 infection,
highlighting the significance of gut epithelial cytokine signalling in maintaining mucosal
immunity (Syakuri et al., 2013). The skin serves as the primary line of defence against
invading pathogens and plays a critical role in immune responses. However, the molecular
mechanisms underlying the fish skin’s immune response remain poorly understood, and
its potential as an indicator of immune competence is unknown, despite the convenience
of non-invasive skin sampling. The expression of immune-related molecules in fish skin
could significantly contribute to the immune response against infections. Some observed
differences in cytokine genes in disease susceptibility between fish species and/or strains
have been linked to the differing ability of the fish to prevent pathogen attachment and
entry at mucosal epithelial sites (Adamek et al., 2019;Adamek et al., 2022a;Adamek et al.,
2022b). The gill mucosal immune system is distinguished by various humoral and cellular
immune mechanisms that synergize to safeguard the tissue against infection (Gomez,
Sunyer & Salinas, 2013). When infected, both the local immune cell populations, which
include mucosal ‘‘innate’’ T-cells and IgT + B cells, and the immune cells mobilized from
specialized immune organs via the bloodstream, can contribute to the elimination of the
infection (Marcos-López et al., 2017).
The primary constituents of the mucus layer are large, filamentous glycoproteins known
as mucins that are highly glycosylated. They are strongly adhesive and play a crucial role
in protecting the mucosal surfaces (Roussel & Delmotte, 2005). Mucins impart viscosity to
mucus and form a framework within which various antimicrobial molecules are present
(McGuckin et al., 2011). As mentioned earlier, excessive mucus production during CEV
infection is one of the major clinical symptoms. Therefore, conducting experimental trials
to understand the role of mucin in fish affected by CEV would be interesting.
It has been proven that gills are the known target tissue of CEV and are crucial for the
biology of the all viral genogroups (Adamek et al., 2017c). Therefore, in the present study,
the initial part consists of an evaluation of immune gene responses to CEV genogroup I
and IIa infections in the gills of different carp strains (AS, koi, PS, and Rop). In addition,
to determine whether or not mucosal immune genes fully respond to CEV infection,
therefore, two carp strains (KSD-susceptible koi and KSD-resistant AS) were exposed
to CEV genogroup IIa. In the experimental trial previously published by Adamek et al.
(2017c), the expression of type I interferon and interferon-stimulated genes encoding
IFNa2 were reported in the gills of common carp strains. The background and a brief
summary of CEV load and replication for the study groups were compiled from previous
experimental trials and can be found in Tables S1 &S2. Here, we focus on the Co II and
Baloch et al. (2023), PeerJ, DOI 10.7717/peerj.15614 4/31
Co IV infectious trials, which were infected with genogroup I and IIa, respectively, and
from which the samples were analyzed. In the current study, to measure changes in gene
expression of selected immune genes, reverse transcription-quantitative PCR (RT-qPCR)
assays have been used. Our data provide a deeper understanding of CEV pathogenesis
through cytokine and other immune-related genes.
MATERIALS & METHODS
Infections with CEV genogroup I and IIa
Experimental samples acquired
The samples analyzed in the present study are comprised of two experimental parts.
According to the 3R rule, the samples obtained during experimental infections were
reused for additional analysis of the immune responses. The experimental procedures were
approved by Lower Saxony State Office for Consumer Protection and Food Safety (LAVES),
Oldenburg, Germany under the reference number: 33.19–425 2-04-16/2144. In the initial
part, the samples used for analysis originated from the previously published infection
trial of CEV in different carp strains (Adamek et al., 2017c). Naïve recipient common carp
strains Amur wild carp (AS), Ropsha scaly carp (Rop), Prerov scaly carp (PS), and koi were
acquired as swimming fry from the University of South Bohemia in Ceske Budejovice,
Faculty of Fisheries and Protection of Waters, located in Vodnany, Czech Republic. Using a
full-factorial mating scheme of three females with three males, each experimental stock was
established by artificial reproduction of the appropriate carp strain (Kocour et al., 2005).
From the time the eggs were laid, the stocks were maintained in a closed recirculation
system that was supplied with tap water. Later on, fry were transported to the facility of
the University of Veterinary Medicine in Hannover and raised in a recirculation system
at 20 ◦C in tap water. Commercial carp feed (Skretting, Norway) was fed to fish at 1%
of body weight per day. The average weight of the fish at the beginning of the infection
experiments was 3.7 ±0.9 g were kept under virus and parasite-free conditions. Each carp
population was confirmed to be free of DNA/RNA specific for CyHV-3, spring viremia
of carp virus (SVCV), and CEV by the mean of RT-qPCR or qPCR before using them in
infection experiments.
The infections of tested fish have been carried out by cohabitation with either CEV-
affected common carp or koi showing clinical signs of the disease. Both CEV-affected
common carp and koi were examined by the mean of end-point PCR (already published
data) (Adamek et al., 2017c) which confirmed CEV genogroups I and IIa, respectively.
Sample analysing theme for the experimental part one
Total four cohabitation experiments (Co I, II, III, and IV) were performed with all four
strains. More detailed information for all the infectious trials mentioned above can be
found in Adamek et al. (2017c). The present study was only focused on the samples from
cohabitation experiment II (Co II) and IV (Co IV). In the Co II trial, 11 individuals
from all four strains AS, koi, PS, and Rop were cohabited with CEV genogroup I affected
common carp. On days 6 and 11 post-infection, four fish from each strain were euthanized
by immersion into a 0.5 g L-1 tricaine (Sigma) solution. The samples from the gills were
Baloch et al. (2023), PeerJ, DOI 10.7717/peerj.15614 5/31
collected individually in RNAlater for RNA isolation and gene expression analysis. During
the Co IV experiment, the same four carp strains (eight fish per strain) were cohabited
with koi infected with CEV genogroup IIa. Subsequently, four fish from each strain were
euthanized with the above-mentioned method at days 6 and 11 post-infection. Their gills
were collected in RNAlater. Non-infected fish from each strain were used as a negative
control for gene expression in both experiments.
Fish rearing and sample analysing theme for the second experiment part
In the second experimental study, naïve AS and koi with an average body weight of 20.4 ±
10.9 g were used to evaluate the selected immune-related gene expressions in the mucosal
organs to CEV infection. Before the start of the experimental infection trial, fish were
kept in the similar condition mentioned above and confirmed to be free from DNA/RNA
specific for CyHV-3, spring viremia of carp virus (SVCV) and CEV. Feeding was done
using a commercial feed (Perla Plus, Skretting, Norway) at a rate of 1% body weight per
day. In this part of the study, the data were collected as described by Adamek et al. (2017c).
Total of five fish from each strain were cohabitated with koi infected with CEV genogroup
IIa. At day 5 post-infection, fish from both strains were euthanized by immersion into a 0.5
g L−1tricain (Sigma) solution, and mucosal tissues such as gill, gut and skin were collected
in RNAlater. Fish of the same strains sampled in the day 0 were used as a non-infected
control for gene expression analysis.
DNA isolation
DNA was isolated as previously described in Adamek et al. (2017c). Specifically: 25 mg of
tissue was mechanically lysed in a QIAgen Tissuelyser II (Qiagen, Hilden, Germany), then
the QIAamp DNA Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s
instructions was used. After isolation, the samples were diluted to 50 ng µL−1 and stored
at −80 ◦C.
RNA extraction and cDNA synthesis
Total RNA was extracted from the 25 mg of RNAlater-stored tissue samples using Tri-
reagent (Sigma, St. Louis, MO, USA), according to the manufacturer’s instructions.
The remaining genomic DNA was digested with 2 U of DNase I according to the
manufacturer’s protocol. Prior to cDNA synthesis, RNA concentrations were determined
by spectrophotometry, the integrity was checked using a 1.5% agarose gel. Complementary
DNA (cDNA) was synthesized from 300 ng of total extracted RNA using Maxima TM First
Strand cDNA Synthesis Kit (Thermo Fisher Scientific, Waltham, MA, USA). Prior to RT-
qPCR analysis, cDNA samples were diluted 1:20 with nuclease-free water. Concentrations
of the samples were determined so that homogeneous RNA could be produced for cDNA
synthesis. cDNA samples were stored in −20 ◦C until further use.
RT-qPCR/qPCR analysis
For the estimation of CEV load from CEV genogroup IIa, a qPCR-based double-labelled
probe was used as described by Adamek et al. (2017b). RT-qPCR assays were carried out
using synthesized cDNA and specific primers listed in Table 1 to examine the expression of
Baloch et al. (2023), PeerJ, DOI 10.7717/peerj.15614 6/31
all selected immune-associated genes in gills from part one of the experiment and gill, skin
and gut from the second part of the experiment. The RT-qPCR reactions were carried out in
duplicates using Maxima SYBR Green 2x master mix (Thermo Fisher Scientific, Waltham,
MA, USA) in StepOne Plus Cycler (Thermo Fisher Scientific, Waltham, MA, USA). The
reaction mixture was prepared as follows: 1 ×Maxima SYBR Green mastermix (with 10
nM of ROX), 0.2 µM of each primer, 3.0 µL of 20 ×diluted cDNA and nuclease-free
water to a final volume of 10 µL. The following amplification program was used: initial
denaturation (10 min at 95 ◦C) followed by 40 cycles of denaturation (30 s at 95 ◦C),
annealing (30 s at 55 ◦C), and elongation (30 s at 72 ◦C). The non-template and minus
reverse transcriptase (-RT) controls were performed for each reaction mix and cDNA
sample, respectively. Obtained RT-qPCR data were analyzed using the StepOne software
version 2.1 by measuring and analyzing the quantitative cycles (Cq) for every reaction and
exported to Microsoft Excel. To determine the amount of particular gene copy numbers
present in each sample, recombinant plasmid standard curve from 6 ×100to 6 ×106
gene copies were prepared and used. To normalize expression, the 40S ribosomal protein
S11 was used as a reference gene. Using the formula below, the level of gene expression
was calculated as the copy number of the gene normalized against 1 ×105copies of 40S
ribosomal protein S11 (normalized copy number):
Normalized copy number =mRNA copies per PCR for target gene/(mRNA copies per
PCR for reference gene/105).
Statistical analysis
Initially, raw RT-qPCR data were analyzed using StepOne software v2.1. The normalized
gene expression data were transformed using a Log 10 (x) transformation before statistical
analysis. Statistical analysis was performed using SigmaPlot 12.5 software (Systat Software,
Chicago, IL, USA). To detect significant differences (p≤0.05) in gene expression and
viral load during CEV infection, 1-way or 2-way ANOVA were used along with pairwise
multiple comparisons using the Holm-Sidak method.
RESULTS
CEV viral load and replication
The viral load and replication of the samples have been determined and published previously
(Adamek et al., 2017c). The common carp strains infected with CEV affected carp with
genogroup I manifested significant differences in susceptibility to the infection. Koi and PS
were more susceptible than AS and showed a high viral load and CEV mRNA expression
than other strains. For additional details, please refer to Table S1.
When the common carp strains and naïve koi were infected with CEV genogroup IIa
(experiment Co IV), koi showed the highest viral load from all strains in both sampling
times (151,668 mean copies at 6 dpi, 1,253,267 copies at 11 dpi), which confirmed its
higher susceptibility to this genogroup. See Table S2 for more information.
Baloch et al. (2023), PeerJ, DOI 10.7717/peerj.15614 7/31
Table 1 RT-qPCR primers used in the study.
Target
gene
Sequences GeneBank ID
or reference
IL-10 CGCCAGCATAAAGAACTCGT AB110780
TGCCAAATACTGCTCGATGT
IL-1 βAAGGAGGCCAGTGGCTCTGT
CCTGAAGAAGAGGAGGCTGTCA AJ245635
IL-6a CAGATAGCGGACGGAGGGGC
GCGGGTCTCTTCGTGTCTT KC858890
TNF- α2 CGGCACGAGGAGAAACCGAGC
CATCGTTGTGTCTGTTAGTAAGTTC AJ311801
Mx2 ATGACCCAGCAGAAGTGGAG
CAGGAACATTGGCAGAGATG XM_019081222
IgM CACAAGGCGGGAAATGAAGA
GGAGGCACTATATCAACAGCA AB004105
CD4 CGTGGACATCTGGCTTTGTG
TTTGGTTTTGCGTCGTCTGT DQ400124
CD8b1 CGGCTCGGAAACTATCACCT
GAGTGGCGGACAGGTTTTCTC EU025120
GzmA GTGTTGGCATCGTCAGTTACG
AGTACCCCAACCTGTCACG GU362096
40S CCGTGGGTGACATCGTTACA
TCAGGACATTGAACCTCACTGTCT
AB012087
Muc5b CAGCCCTCTTCCTCTTTCATC
CCACTCATCTTTCCTTTCTCTTC
Muc2c TGACTGCCAAAGCCTCATTC
CCATTGACTACGACCTGTTTCTC
Van der Marel et al. (2012)
Expression of IL-10, IL-1 β, TNF-α2 and IL-6a genes in carp strains
during the infection with CEV genogroups I and/or IIa
In the challenge with CEV genogroup I (Co II), koi depicted significant lower level of IL-10
and higher levels of IL-6a on day 6th post-infection compared to day 0 p.i. On 11th dpi,
koi showed significantly higher level of IL-1β, TNF-α2 and IL-6a genes, and significant
down-regulation of IL-10 gene expression compared to day 0 (Fig. 1). Whereas, in AS,
the expression of IL-10 was at the same level on both days 6 and 11 p.i. compared to day
0. Significant up-regulation of IL-1β, and IL-6a genes were noticed in AS only on day 11
p.i. Significant elevated levels TNF-α2 were found on both days 6 and 11 p.i. In PS strain,
expression of IL-1βwas significantly up-regulated on day 6 p.i. However, no significant
differences were detected in the expression of other immune genes such as IL-1β, TNF-α2
and IL-6a on both time points compared to fish sampled on day 0. In Rop, significant
up-regulation of TNF-α2 and IL-6a was observed on both days 6 and 11 p.i. However,
there was no differences in the expression of IL-10, and IL-1βon both sampling days.
During the course of an infection with CEV genogroup IIa (Co IV), koi evinced
significant up-regulation of IL-10 and IL-1βon both days 6 and 11 p.i. compared to day
Baloch et al. (2023), PeerJ, DOI 10.7717/peerj.15614 8/31
Figure 1 Reverse transcriptase quantitative PCR (RT-qPCR) analysis of IL-10, IL-1 β, TNF- α2 and IL-
6a genes in gills of four strains. Gene expression was measured in the gill of carp individuals from differ-
ent strains (AS, koi, PS, and Rop) at days 0 (non-infected), 6 and 11 post-infections of CEV genogroup I
or IIa. The gene expression was normalized to the expression of the gene encoding the S11 protein of the
40S subunit as a reference gene. Data are shown as box plot indicating mean and standard deviation from
n=4 fish. Asterisks denote statistically significant differences (*p<0.05) between the control (day 0) and
infected once (day 6 and 11).
Full-size DOI: 10.7717/peerj.15614/fig-1
Baloch et al. (2023), PeerJ, DOI 10.7717/peerj.15614 9/31
0. On day 6 p.i., TNF-α2 levels was not significantly higher on 6 dpi and the increase
continued to 11 dpi, when it was significantly higher than control (0 dpi). The expression
level of IL-6a was significantly higher on day 6 p.i., then it gradually decreased but remained
significantly up-regulated also on day 11 p.i. comparing with day 0. In AS, the expression of
IL-10 gene was at the same level on both days 6 and 11 p.i. compared to day 0. No significant
differences were observed also in IL-1βlevels on both days 6 and 11 p.i. Significantly higher
level of TNF-α2 was noticed on both days 6 and 11 p.i., and these levels were much higher
when compared to genogroup I infection in AS. In PS strain, only expression of IL-1βwas
significantly up-regulated on day 6 p.i. compared to day 0. No significant differences were
detected in the expression of other immune genes such as IL-1β, TNF-α2 and IL-6a on
both time points compared to fish sampled on day 0. In Rop, significant up-regulation of
TNF-α2 gene on both days. The expression of IL-6a gene was also up-regulated on days 6
and 11 p.i. with slight decrease between 6 and 11 dpi. Furthermore, there was no differences
in the expression of IL-10, and IL-1βon both days 6 and 11 p.i.
Expression of CD4, CD8b1 and GzmA in carp strains during the
infection with CEV genogroups I and/or IIa
Challenge with CEV genogroup I (Co II), significantly down-regulated the expression of
CD4 and GzmA in koi on days 6 and 11 p.i. compared to day 0 (Fig. 2). We did not observe
any differences in the expression of CD8b1 in koi on both days 6 and 11 p.i. AS showed
remarkable significant down-expression of CD8b1 and GzmA genes on both infected days
6 and 11 compared to day 0. In addition, the expression level of CD4 was also significantly
down-regulated on days 6 and 11 p.i. but the response was not stronger as CD8b1 and
GzmA genes when compared to day 0. Furthermore, PS and Rop strains did not show any
significant differences in the expression of CD4, CD8b1 and GzmA on day 6 and 11 p.i.
compared to fish sampled on day 0.
In the challenge with CEV genogroup IIa (Co IV), koi manifested significant down-
regulation of CD4 on day 6 and 11 p.i. compared to day 0. However, there was no CD8b1
response detected in koi on both infected days compared to control group. The gradual
decrease of GzmA was noted in koi on both day 6 and 11 p.i compared to day 0, but with
significant difference on day 11 only. There was no difference in CD4 expression in AS strain
p.i compared to day 0. However, significant down-regulation of CD8b1 gene expression
was noticed in AS on both days 6 and 11 p.i when compared to day 0. Furthermore, slight
down-regulation of GzmA was seen but without significant difference. In PS and Rop no
significant differences were observed in the expression of CD4, CD8b1 and GzmA on both
time points compared to fish sampled on day 0.
Expression of Mx2, IgM, and Mucin genes in carp strains during the
infection with CEV genogroups I and/or IIa
During the challenge with CEV genogroup I (Co II), the significantly higher expression
level of Mx2 was noticed in koi on day 6 p.i. however on day 11 p.i. the levels were restored
near day 0 (Fig. 3). The expression of IgM in koi was significantly down-regulated on day
11 p.i. compared to day 0. On day 6 p.i., IgM levels was also lower but not significant
when compared to control group. In AS, on both days 6 and 11 p.i. we did not observe
Baloch et al. (2023), PeerJ, DOI 10.7717/peerj.15614 10/31
Figure 2 Reverse transcriptase quantitative PCR (RT-qPCR) analysis of CD4, CD8b1 and GzmA genes
in gills of four strains. Gene expression was measured in the gill of carp individuals from different strains
(AS, koi, PS, and Rop) at days 0 (non-infected), 6 and 11 post-infections to CEV genogroup I and IIa. The
gene expression was normalized to the expression of the gene encoding the S11 protein of the 40S subunit
as a reference gene. Data are shown as box plot indicating mean and standard deviation from n=4 fish.
Asterisks denote statistically significant differences (*p<0.05) between the control (day 0) and infected
once (day 6 and 11).
Full-size DOI: 10.7717/peerj.15614/fig-2
any significant difference in the expression of Mx2 gene compared to day 0. The IgM
levels in AS was significantly down-expressed on day 6 p.i. compared to control fish. Mx2
expression in PS strain was significantly peaked on day 6 p.i. and stayed elevated up to day
Baloch et al. (2023), PeerJ, DOI 10.7717/peerj.15614 11/31
Figure 3 Reverse transcriptase quantitative PCR (RT-qPCR) analysis of Mx2, IgM, and Mucb5 in gills
of four strains. Gene expression was measured in the gill of infected and non-infected (day 0) carp indi-
viduals from different strains (AS, koi, PS, and Rop) at days 6 and 11 post-infection to CEV genogroup I
and IIa. The gene expression was normalized to the expression of the gene encoding the S11 protein of the
40S subunit as a reference gene. Data are shown as box plot indicating mean and standard deviation from
n=4 fish. Asterisks denote statistically significant differences (*p<0.05) between the control (day 0) and
infected once (day 6 and 11).
Full-size DOI: 10.7717/peerj.15614/fig-3
11 p.i. compared to control group. No IgM response was detected in PS strain on both
infected days. Rop did not exhibit a significant shift in expression level of Mx2 or IgM on
either day 6 or day 11 p.i compared it to control.
Baloch et al. (2023), PeerJ, DOI 10.7717/peerj.15614 12/31
Table 2 CEV virus load in tissues from AS and Koi after experimental cohabitation with CEV
genogroup IIa.
AS Koi
Day 5 Day 5
Gill
Mean 2.09E +04a2.51E +05bc
Median 7.86E +03 2.52E +05
SD 3.09E +04 9.68E +04
Gut
Mean 1.08E +02c1.83E +03c
Median 3.20E +01 1.34E +03
SD 1.96E +02 2.05E +03
Skin
Mean 5.29E +02c1.10E +05b
Median 1.21E +02 7.50E +04
SD 1.08E +03 1.10E +05
Notes.
Carp edema virus load was measured by qPCR as copy numbers of virus specific DNA in the gill, gut and skin of AS and koi
during CEV genogroup IIa infection. Samples were collected 5-day post-exposure from n=6 fish per day. The data on virus
load is shown as mean, median and standard deviation (SD) of genome copies in 250 ng of isolated DNA. Different letters in-
dicate significant differences at p≤0.05 between carp strains.
Upon challenged with CEV genogroup IIa (Co IV), in koi there was observed a significant
upward trend of Mx2 gene on both days 6 and 11 p.i. in comparison to the control day 0.
The IgM expression in koi gradually slightly decreased but without statistical significance.
In AS, the significant peak level of Mx2 was noticed on day 6 p.i. and reduced on day 11 p.i.
near to the control group. There were no differences found in IgM transcripts in AS at both
infected days compared to control fish. Both PS and Rop strains significantly up-regulated
Mx2 expression levels on day 6 p.i. and then reduced to the level of control day 0. We did
not observe any differences in IgM levels in both PS and Rop strains on both days 6 and 11
p.i. compared to the fish sampled on day 0. The present study also investigated the effects
of CEV genogroup I or IIa exposure on Muc5b gene expression in the gills of four different
fish strains. Results demonstrated that there was no significant difference in the Muc5b
gene expression on both days 6 and 11 p.i. in the gills of all four strains when compared
to the control. However, a non-significant slight decrease in the Muc5b mRNA level on
day 11 was noted in the gills of koi carp following the exposure to CEV genogroup I or IIa,
which differed slightly from the other fish strains.
Virus load in AS and koi carp infected with CEV genogroup IIa
The virus load was analyzed in the gill, gut and skin tissues at day 5 post-infection. Among
all selected organs, gills harboured the highest number of CEV specific DNA copies with a
mean of 251,130 copies and median of 252,444 in koi carp and mean of 20,934 and median
7,859 of copy numbers in AS per 250 ng of extracted DNA (Table 2). The skin of koi having
the second highest viral load with a mean copy number of 110,457, and median 74,986,
whereas the gut and skin organs from AS had a virus load below 1,000 copies per 250 ng of
isolated DNA.
Baloch et al. (2023), PeerJ, DOI 10.7717/peerj.15614 13/31
Expression of immune-related genes in the gill, gut and skin tissues
of AS and koi during the infection with CEV genogroup IIa
IL-10, IL-1β, TNF-α2 and IL-6a genes
The expression level of all selected cytokine genes such as IL-10, IL-1β, TNF-α2 and IL-6a
were significantly up-regulated in the gill and gut tissues of koi carp at day 5 p.i. compared
to day 0 (Fig. 4). In contrast, the expression of none of the cytokine genes was shifted in
both gill and gut tissue of AS. Only IL-10 gene showed slight lower expression in the gill
on day 5 p.i. compared to day 0, but without a significant difference.
In the skin tissue, no significant changes were observed in cytokine genes expression in
both koi and AS strains at day 5 p.i. compared to the fish sampled on day 0, except of IL-1β
gene, which was significantly up-expressed (p<0.01) at day 5 p.i. compared to day 0.
CD4, CD8b1 and GzmA genes
There was a significant down-regulation (p<0.05) of CD4 and GzmA transcript levels
observed in the gill of koi carp at day 5 p.i. compared to the control group (Fig. 5). However,
no CD8b1 response was detected in koi at day 5 p.i., compared to the control day 0. In the
AS strains’ gill, slight down-regulation was observed in CD4, CD8b1, and GzmA levels on
day 5 p.i. compared to day 0, although the levels were not statistically significant.
In the gut and skin of both carp strains, no significant changes were noticed in CD4,
CD8b1, and GzmA transcripts on day 5 p.i. compared to the fish sample on day 0.
Mx2, IgM and Mucin genes
No significant difference in IgM levels were noticed in the gill and gut in both AS and koi
strains on 5 dpi, compared to the control fish. Significant down-regulation of IgM was
noticed in koi’s skin at day 5 p.i. however, slight down-expression of IgM transcripts was
found in the AS skin and gill tissue but without significant changes (Fig. 6).
The expression of the Mx2 gene in gill, gut and skin tissues in AS strain was significantly
up-regulated on day 5 post-CEV exposure compared to day 0. The Mx2 transcripts in koi
gill and gut were also significantly up-expressed on day 5 p.i. even much higher than AS
strain. Further, koi skin tissue did not show any significant change on day 5 p.i. compared
to the control.
The tissue-specific expression of mucin genes, Muc2 and Muc5b, was observed among
gill, gut, and skin. Muc2 was exclusively expressed in the gut tissue, whereas Muc5b was
expressed in the gill and skin tissues. No significant differences were found in the expression
levels of these genes in gills and gut. However, a significant down-regulation of Muc5b
transcripts, was observed in the skin tissues of koi on day 5 post-infection compared to the
control.
DISCUSSION
Immune gene expressions during the infections with CEV genogroup
I and IIa
The differences in the immune responses occurring between the fish strains with different
susceptibility to pathogen could explain how the fish successfully protect themselves from
Baloch et al. (2023), PeerJ, DOI 10.7717/peerj.15614 14/31
Figure 4 Reverse transcriptase quantitative PCR (RT-qPCR) analysis of IL-10, IL-1 β, TNF- α2 and IL-
6a genes in the gill, gut and skin tissues of AS and koi at day 0 (non-infected) and 5 post-infection of
CEV genogroup IIa. The gene expression was normalized to the expression of the gene encoding the S11
protein of the 40S subunit as a reference gene. Asterisks denote statistically significant differences marked
with * at p<0.05, with **p<0.01 between the control and infected once.
Full-size DOI: 10.7717/peerj.15614/fig-4
the infections. However, for fish poxviruses there is underwhelming scarcity of data. The
immune responses were addressed only in handful of works; with only type I interferon
response characterized during CEV infection in more than two carp strains (Adamek et al.,
Baloch et al. (2023), PeerJ, DOI 10.7717/peerj.15614 15/31
Figure 5 Reverse transcriptase quantitative PCR (RT-qPCR) analysis of CD4, CD8b1 and GzmA in the
gill, gut and skin tissues of AS and koi at day 0 (non-infected) and 5 post-infection of CEV genogroup
IIa. The gene expression was normalized to the expression of the gene encoding the S11 protein of the 40S
subunit as a reference gene. Asterisks denote statistically significant differences marked with * at p<0.05,
with **p<0.01 between the control and infected once.
Full-size DOI: 10.7717/peerj.15614/fig-5
2017c). Furthermore, no studies describing the any other immune responses of carp strains
after infection by cohabitation with fish infected with the CEV genogroup I or IIa have
been reported yet. Therefore, our study is the first to report the looking on inflammation
and adaptive immune responses in carp strains during CEV infections.
Cytokines belong to the most widely studied group of molecules involved in the function
of the immune system. Amongst, a key pro-inflammatory cytokine, interleukin-1β(IL-1β)
plays an essential role in the fish immune system (Zou & Secombes, 2016). According to the
Baloch et al. (2023), PeerJ, DOI 10.7717/peerj.15614 16/31
Figure 6 Reverse transcriptase quantitative PCR (RT-qPCR) analysis of Mx2, IgM, Muc2, and Mucb5
in the gill, gut and skin tissues of AS and koi. RT-qPCR analysis of Mx2, IgM, Muc2, and Mucb5 in the
gill, gut and skin tissues of AS and koi at day 0 (non-infected) and 5 post-infection of CEV genogroup IIa.
The gene expression was normalized to the expression of the gene encoding the S11 protein of the 40S
subunit as a reference gene. Asterisks denote statistically significant differences marked with * at p<0.05,
with **p<0.01 between the control and infected once.
Full-size DOI: 10.7717/peerj.15614/fig-6
previous studies, it has been studied in a wide range of fish species (Buonocore et al., 2003;
Wang et al., 2006). In our study, during both experiments (Genogroup I and Genogroup
IIa infections), only koi carp showed up-regulation of IL-1βpost-infection. This strong
IL-1βinflammatory response may coincide with the previously conducted study where
koi were found to be susceptible to both genogroups I or IIa infections (Adamek et al.,
2017c). Furthermore, high expression of IL-1βwas also found in different carp lines at
Baloch et al. (2023), PeerJ, DOI 10.7717/peerj.15614 17/31
days 3 and 5 post-infection challenged with CyHV-3 (Rakus et al., 2012). IL-1βmight
be the significant driver of the gill pathology developing during the infection with CEV.
This molecule was associated with the increased pathological changes in mucosal tissues
during CyHV-3 vaccination studies (Adamek et al., 2022a) as well as tilapia lake virus
(TiLV) susceptible strains of Nile tilapia (Oreochromis niloticus) (Adamek et al., 2022b).
In both non-vaccinated carp which was subsequently challenged with CyHV-3 and TiLV
susceptible strains of tilapia infected with the TiLV, the disruption of the skin and gill
barriers and increased occlusion of the intralaminar spaces was associated with increased
expression of the gene encoding for IL-1β. Current studies showing the increased IL-1β
expression in the CEVD susceptible strains could explain the pathology recorded in these
fish (Adamek et al., 2017c).
In our case, the low level of IL-1βin other strains might be due to the increased expression
of IL-6a, which is a key immunosuppressive cytokine secreted by regulatory T-cells (Zou
& Secombes, 2016). This is in accordance with the previous study where IL-6a significantly
down-regulated the expression of IL-1βand TNF-α(key pro-inflammatory cytokines),
suggesting its potential anti-inflammatory role in trout (Costa et al., 2011). In the current
study, significant changes in the expression level of IL-6a were observed in AS, koi, and
Rop strains infected with CEV genogroup I or IIa. Comparatively, the expression pattern
was different between the genogroup I and IIa. Fish infected with genogroup I evidenced
higher expression on days 6 and 11 compared to the control group. However, IL-6a was
elevated on day 6 post-infection and declined on day 11 but remained higher than in the
control. In common carp, the role of IL-6a in the response to viral infections is not defined
yet. However, its crucial role in the humoral immune response was well observed in other
fish species, such as Nile tilapia challenged with the bacterial infection which promotes IgM
antibodies production (Wei et al., 2018). In fish, the expression of the IL-10 gene has also
been linked to a decrease in inflammatory responses (Forlenza, 2009;Ingerslev et al., 2009;
Raida & Buchmann, 2008). We observed relatively high down-regulation of the expression
of IL-10 compared to the control group during the genogroup I infection on day 6 in koi
carp. This low level was maintained till day 11 post-infection. On the contrary, the koi
infected with genogroup IIa elevated the IL-10 expression on days 6 and 11 post-infection.
IL-10 up-regulation to genogroup IIa could result from an increase in humoral immunity
and inhibition of inflammation. Tumor necrosis factor (TNF) is a critical cytokine that
plays an essential role in physiological and pathological processes. It promotes phagocytosis
and nitric oxide production in teleost during viral and bacterial infections (Tafalla, Figueras
& Novoa, 2001). Our results revealed higher expression of TNF-α2 in AS and Rop strains
during both genogroups I and IIa infections. However, in koi, the significantly elevated
level of TNF-α2 was only found on day 11 post-infection campared to the control group.
The higher levels of TNF-α2 might be due to the elevation of IL-1βexpression. This can
be consistent with the previous study where IL-1βproduced local effect on the expression
of TNF-αin muscles that have been treated with a plasmid encoding IL-1βin japanese
flounder Paralichthys olivaceus (Taechavasonyoo, Hirono & Kondo, 2013).
In the context of poxvirus infections, T helper cells play a critical role in the activation
and differentiation of other immune cells, such as B cells and cytotoxic T cells (CTLs)
Baloch et al. (2023), PeerJ, DOI 10.7717/peerj.15614 18/31
(Yamaguchi et al., 2019). CD4 and CD8 are proteins or cell surface markers found on
the surface of T cells, a type of white blood cell that plays a critical role in the immune
response (Zamoyska, 1998). CD4 is primarily found on T helper cells, which are a type
of T cell that play an important role in coordinating the immune response by secreting
cytokines and helping to activate other immune cells such as B cells and cytotoxic T cells
(CTLs) (Brown, Román & Swain, 2004). Changes in the gene expression of CD4 and CD8
markers can provide important information about the state of the immune system and its
response to infection or disease. For example, a decrease in CD4 expression may indicate
a decrease in T helper cell function, which can impair the immune response and increase
susceptibility to infections (Adamek et al., 2021). In mammals, the down-regulation of
CD4 is the anchor that disarms actions against the immunity of several poxviruses. In our
study, down-regulation of CD4 was observed in AS and koi strains during both genogroup
I or IIa infections at days 6 and 11 post-infection compared to the control group. The
highest down-regulation was observed in koi carp on days 6 and 11 post-infection to both
genogroups. Similar, down-regulation of the gene encoding for the CD4 receptor of T-cells
in koi under CEV infection was detected in gills on days 6 and 9 post-infection (Adamek
et al., 2021). They suggest that possible reason for CD4 down-regulation in their study
could be due to the immunosuppressive effect, which results from hyperammonemia in
infected CEV carp. Since, in our findings, a strong down-regulation of CD4 in koi carp
could be speculated to be caused by the elevated viral transcripts infected with genogroup
I or IIa post-infection. In addition, we further analyzed the expression of CD8b1 along
with GzmA (a protein-coding lysis gene produced in cytotoxic T-cells) to CEV infections
in all four strains. CD8 is primarily found on cytotoxic T cells, which are responsible for
recognizing and killing virus-infected cells (Mosmann, Li & Sad, 1997). According to the
study of Adamek et al. (2021), down-regulation expression of CD8b1 was noticed in the
gills of CEV-infected koi carp compared to infected AS at any time points (day 0 to 13
post-infection). Interestingly, in our findings, among all groups only AS showed a tendency
of down-regulation from day 6 to 11 in genogroups I or IIa infections compared to the
control groups. In contrary, when carp lines were challenged with CyHV-3, up-regulation
of CD8b1 was noted from day 1 to day 5 post-infection (Rakus et al., 2012). Poxviruses have
been demonstrated to modulate the host immune system through various mechanisms.
These mechanisms include the inhibition of immune cell activation and proliferation,
downregulation of immune gene expression, and production of immunomodulatory
proteins (Howard et al., 1998). For example, some poxviruses are able to suppress the
expression of interferons, which play a critical role in initiating the host antiviral response
(Fensterl & Sen, 2009). These viruses can also hinder the activation of natural killer cells
and T cells, two essential components of the host immune system. Based on these findings,
it is plausible to suggest that the suppressed expression of CD4 and CD8b1 in fish infected
with carp edema virus may be also a result of viral immunomodulation of the host
immune system. The GzmA levels were strongly down-regulated in koi at days 6 and 11
post-infection compared to the control to both CEV genogroups. The down-regulation
of GzmA in AS infected with genogroup I was observed on days 6 and 11 post-infection.
This down-regulation expression of GzmA could be due to the lower recruitment of
Baloch et al. (2023), PeerJ, DOI 10.7717/peerj.15614 19/31
cytotoxic cells in gills due to CEV infection, which can also be seen in the case of CD4 and
CD8b1 expression. Interestingly, down-regulation of cytotoxic cell markers such as GzmA
in gills has been associated with cortisol-induced immunosuppression during salmon
gill poxvirus (SGPV) infection (Amundsen et al., 2021). Based on SGPV and current CEV
results, down-regulation of GzmA appears to be a very important marker that could predict
the development of the acute form of the disease caused by fish poxviruses (Amundsen et
al., 2021).
Several hundred genes are induced by type I interferon (IFN I), including some that
encode direct antiviral effectors, such as the Mx proteins (Fernández-Trujillo et al., 2015).
They can impede viral replication at different stages of the virus’s life cycle (Das et al.,
2019). The innate immune responses mediated by type I interferon against viruses and
bacteria have been demonstrated in fish (Langevin et al., 2013). The crucial role of type I
interferon-inducing genes in the fish immune response has been emphasized, including
those that encode direct antiviral effectors (Machat et al., 2021). Moreover, interferon-
induced genes are known to encode interferon-stimulated proteins, such as myxovirus
resistance and protein kinase R, which exhibit direct antiviral activity. These proteins can
effectively inhibit viral transcription, degrade viral RNA, inhibit translation, or modify
the proteasome to control various stages of viral replication (Sadler & Williams, 2008).
It was shown that different strains of common carp exhibit varying levels of IFN and
ISG expression in response to viral infections, with susceptible fish showing a quicker
response than resistant ones (Machat et al., 2021). As stated earlier, interferons (IFNs) and
IFN-stimulated genes provide the first line of defense against viral infections. However,
viruses have evolved strategies to escape immune surveillance and establish successful
infections (Rai et al., 2021). Therefore, it is critical to understand the complex mechanisms
of the interaction between viruses and the host’s innate immune system, particularly the
role of IFNs and IFN-stimulated genes, in developing effective treatment strategies for
acute viral infections
The induction of type 1 interferon responses, the mRNA expression of the genes encoding
interferon alpha-2 and interferon-induced proteins viperin and RNA dependent protein
kinase, have been determined in the previously conducted infection trials from the same
experimental study (Adamek et al., 2017c). Furthermore, in a very recent study conducted
by Adamek et al. (2021), koi and AS under CEV infections displayed up-regulation of type
I IFN (ifnα2) expression in the gill and kidney compared to infected fish at any time points
(day 0 to 13 post-infection).
Another important interferon regulatory protein, known as myxovirus resistance protein
(Mx), mediate cellular resistance against wide range of viral pathogens (Gao et al., 2011).
Therefore, we further confirmed the antiviral response of Mx2 during CEV genogroup I
and IIa infections. When the carp strains were infected with CEV genogroup I, the mRNA
expression of the Mx2 gene was significantly up-regulated in the gills of koi, PS and Rop at
both time points days 6 and 11 p.i. compared to day 0. However, the peaked level of Mx2 was
observed on day 6 in koi and PS strains, which proved to be susceptible to CEV genogroup
I (Adamek et al., 2017c). The expression level of Mx2 was not observed in AS strain at
any time points when compared to day 0. During the course of an infection with CEV
Baloch et al. (2023), PeerJ, DOI 10.7717/peerj.15614 20/31
genogroup IIa, the mRNA expression of Mx2 was highly significantly up-regulated in koi
at 6 and 11 days post-infection compared to control. Carp from other strains also showed
the up-regulation of mRNA encoding Mx2 protein (particularly at day 6 post-infection),
but the magnitude of up-regulation was significantly lower on day 11 post-infection. The
evidence from the previous studies (Adamek et al., 2014;Adamek et al., 2017c) shows that
the antiviral response seemed positively correlated with the viral load in infected fish and
cannot be related to the resistance of carp strains to infection. In our findings, the same
results were established in the case of Mx2 antiviral response, except of in PS strain, where
Mx2 levels were not correlated to viral load and replication. Our findings, regarding the
antiviral response of Mx2 correspond with above mentioned results where type I IFNs and
interferon-induced proteins were significantly up-regulated in carp strains evaluated by
Adamek et al. (2017c) and Adamek et al. (2021).
In a primary antibody response, it is the IgM antibodies that constitute the majority of
the body’s antibodies (Janeway Jr et al., 2001). Unlike other types of antibodies, IgM are
produced primarily by B1 cells, with no apparent stimulation by specific antigens (Tumang
et al., 2005). Antigen-specific IgM is produced early following infection by most pathogens,
followed by IgA, IgG, and IgE antibody responses (such as IgT/Z and IgD in fish) that are
more specific (Boes, 2000). Like koi herpes virus disease (KHVD), the first CEVD mortality
in carp occurs approximately a week after infection at a water temperature of 18–24 ◦C, and
mortality may reach 100% at 11 days following infection (Miyazaki, Isshiki & Katsuyuki,
2005;Piačková et al., 2013;Lewisch et al., 2015). This indicates that the mortality occurs
prior the beginning of antibody production or at a time when the level of antibodies is too
low allowing the virus to replicate more freely in the carp body. What is more important,
our study indicate significant down-regulation of IgM levels noticed in koi on day 11
post-infection to CEV genogroups I or IIa compared to the control group which is an
accordance with the findings of Adamek et al. (2021), who reported the down-regulation
expression of IgM in the gills of CEV infected koi with two-fold at day 3 and five-fold at
day 9 p.i.. This could suggest that CEV infection process is delaying the start of antibody
response however this requires further studies. Especially due to the fact, there were only
slight variations in IgM levels in other carp strains but not significantly different.
The significant level of mucin conservation across all vertebrates serves to underscore
their critical role in defending against pathogen intrusion. The pivotal function of mucin
in the mucosal barrier of fish was demonstrated by the linkage of single nucleotide
polymorphisms in mucin 2 and 5b with the resistance of rohu carp (Labeo rohita) to
Aeromonas hydrophila infection (Robinson et al., 2014), thus underscoring the significance
of mucin in host-pathogen interactions. In common carp, mucin 2 and mucin 5b expression
was found to increase during beta glucan feeding (Van der Marel et al., 2012), while it
decreased during CyHV-3 infection (Adamek et al., 2013), highlighting the versatility of
mucin as a biomarker in different physiological settings. The present study investigated
the impact of CEV genogroup I or IIa exposure on Muc5b gene expression in the gills of
four distinct fish strains. The findings indicated that there was no substantial difference in
the Muc5b gene expression on days 6 and 11 p.i. in the gills of all four strains compared to
the control. Nonetheless, in the gills of koi carp, a negligible and non-significant decrease
Baloch et al. (2023), PeerJ, DOI 10.7717/peerj.15614 21/31
in the Muc5b mRNA level was observed on day 11 after the exposure to CEV genogroup I
or IIa, which was marginally different from the other fish strains. Our study differed from
a previous investigation on common carp, which revealed that MUC5 gene expression in
the fish gills was significantly up-regulated following dietary beta-glucan administration
(Van der Marel et al., 2012). In zebrafish (Danio rerio), Similarly, administration of pectin
in the diet resulted in a significant up-regulation of whole body MUC5 gene expression,
as reported in a recent study (Edirisinghe et al., 2019). To date, the expression of other
mucins in CEV-infected fish has only been investigated by Adamek et al. (2017a). Their
study reported a decrease in muc2-like transcripts in common carp at 144 h post-infection.
In contrast, our study did not observe any significant changes in muc5b expression levels
in CEV-infected carp gills at both 6 and 11 days post-infection. Hence, the potential role
of muc5b in the susceptibility of CEV-infected strains to both genogroups of the virus
remains unclear.
Immune gene responses in mucosal tissues to CEV infection
In fish, the thymus and head kidney serve as the primary lymphoid organs, whereas the
spleen, trunk kidney, and mucosa-associated lymphoid tissue (MALT) located in areas
like the skin, gills, intestine, oral and nasal mucosa, and urogenital tract comprise the
secondary lymphoid organs (Ángeles Esteban, 2012;Soulliere & Dixon, 2017). The MALT
can be further divided by anatomical location into skin-associated lymphoid tissue (SALT),
gut-associated lymphoid tissue (GALT), and gill-associated lymphoid tissue (GIALT)
(Ángeles Esteban, 2012;Salinas, Zhang & Sunyer, 2011).
Skin, gills, and intestines of fish are the first barriers with the biggest mucosal surface
providing the interface between a fish and its environment. As a defence mechanism
against invading pathogens, these tissues secrete antimicrobial humoral factors, which act
through various mechanisms to limit the spread and proliferation of pathogens (Mehana,
Rahmani & Aly, 2015). In this study, AS and koi carps were exposed to CEV genogroup
IIa to determine the immune gene expression in these mucosal tissues. Interestingly, the
results indicate that not only the gills as a target tissue for the virus but also other mucosa
react to the infection. Namely, the mRNA expression level of selected cytokine genes
were mainly regulated in koi carp’s gill and gut post-CEV infection. The detection of
changes in expression of innate immune genes, such as IL-10, IL-1β, TNF-α2 and IL-6a,
during CEV infection suggests that innate immunity in these mucosal tissues played a
significant role in the antiviral process. Similarly, in a very recent study conducted by
Kushala et al. (2022), significant up-regulation of IL-10, IL-1β, and TNF-αwere detected
in the gill of naturally KSD-affected koi. Interestingly, it was found that mucosal immunity
plays even more important role in protection when a cohabitation method is used for
inducing the infection. For instance, when different Nile tilapia strains were infected with
tilapia lake virus (TiLV), the virus load was significantly lower with less mortality in the
strains infected through the cohabitation method compared to strains infected with an
intraperitoneal injection (Adamek et al., 2022b). In our case, despite gill containing the
highest virus load, the strong innate immune mucosal response could be seen in gill and
gut tissues in carp strains infected through the cohabitation method.
Baloch et al. (2023), PeerJ, DOI 10.7717/peerj.15614 22/31
The common carp’s ability to defend itself against viral infections is underlined by
the overproduction of mucus on skin and gill during CEV infection (Zhang et al., 2017).
And it has been recorded that skin epidermal erosion following partial ulceration is one
of the main sign during CEV infections (Miyazaki, Isshiki & Katsuyuki, 2005). In our
case, skin despite showing the second highest viral loads of CEV, did not induce strong
innate immune response, except IL-1β, the only gene that was up-regulated in koi carp
during post-CEV infection. It seems that other immune genes related to skin protection
could play a significant role during the infection with this pathogen. For instance, mucins
(a membrane-associated glycoprotein) that are the main components of the mucosal
barrier studied during the infections with carp viruses CyHV-3, and SVCV including CEV
(genogroup I) (Adamek et al., 2017a). The down-regulation of mucin mRNA expression
was detected in gill and gut mucosal tissues of carp infected with above cited pathogens.
There is a far paucity of research about T cell markers (CD4, CD8b1 and GzmA) to
CEV infection in the mucosal tissue of common carp. Gill is the only mucosal organ
where down-regulation of gene encoding for CD4 and CD8 cytotoxic T cells markers were
detected in koi on day 6 and 9 post-exposure to CEV genogroup IIa infection compared
with control as well to the expression in CEV-infected AS carp (Adamek et al., 2021). Our
findings agree with their study reporting down-regulation of T cell markers such as CD4
and GzmA in koi gill on 5 dpi to CEV genogroup IIa compared to control and AS strains.
Further, no CD4, CD8b1 and GzmA responses were noticed in other mucosal organs,
such as gut and skin. Interestingly up-regulation of Mx2 was noticed in all mucosal organs
during CEV exposure indicating that mucosal tissues induced a robust antiviral response
to CEV infection. The evidence from the previous studies (Adamek et al., 2014;Adamek
et al., 2017c) shows that the antiviral response seemed positively correlated with the virus
load in infected fish and cannot be related to the resistance of carp strains to infection. Our
study found a similar correlation between virus load and antiviral response in gill tissue.
However, the gut harboured the least amount of virus load among the mucosal organs,
showed similar up-regulation expression levels of Mx2 in both strains during post-CEV
exposure.
Furthermore, mucosal response of mucin-encoding genes (Muc2 and Muc5b) in AS and
koi upon CEV genogroup IIa infection in gill, gut and skin tissues was evaluated. In our
case tissue-specific expression of mucin genes was observed, where Muc2 was expressed
exclusively in the gut tissue, and Muc5b was expressed in the gill and skin tissues. Tissue
specific expression of Muc2 and Muc5b genes have been noticed in the previous studies.
For instance, Muc2 in carp is predominantly expressed in gut and Muc5b gene, mostly
expressed in skin and brancial epithelium (Van der Marel et al., 2012). In addition, the gills
predominantly express Muc2-like as the secreted mucin when compared to Muc5b, while
the skin mainly secretes Muc5b in comparison to Muc2-like (Lang et al., 2004). Muc2-like,
Muc5b, and the previously described Muc2 from the gut are the primary secreted mucins
in the major mucosal tissues of the common carp. The current study revealed a marked
down-regulation of Muc5b transcripts in the skin tissue of koi at day 5 post-infection as
compared to the control group. These findings suggest that Muc5b may play a critical role
in the defense mechanisms of koi against the infectious agent. The reduced expression of
Baloch et al. (2023), PeerJ, DOI 10.7717/peerj.15614 23/31
Muc5b transcripts in the skin tissue may lead to impaired mucus production, which may
affect the skin barrier function and increase the susceptibility of koi to infection.
CONCLUSIONS
In conclusion, this is the first study where important immune gene expression was
determined in different carp strains infected with CEV genogroup I and compared with
responses against genogroup IIa. Fish infected with both genogroups demonstrated similar
expression patterns of selected immune-related genes. Interestingly, koi carp was the only
strain where most genes showed significant differences in fish infected with both CEV
genogroups, with slight variation in the expression pattern. Furthermore, the expression
pattern for most genes in KSD-resistant AS strain (Adamek et al., 2017c;Adamek et al.,
2021) resemble some similarities to koi. These similarities might be due to the origin
of both carp strains from the same species, such as Cyprinus rubrofuscus. According to
the observed expression patterns, the difference in susceptibility does not seem to be
related to the kinetics of expression of selected immune genes studied in this work. The
expression patterns however could help explaining the recorded pathology. Furthermore,
up-regulation of mRNA expression of most of the selected immune genes in koi gill and
gut tissues suggests potential systemic mucosal response against CEV infection. Ultimately,
the implementation of further studies of immune responses against CEV should be under
strong consideration because of the paucity of literature regarding the immune responses
of carp to CEV infections.
ADDITIONAL INFORMATION AND DECLARATIONS
Funding
This research was supported by Deutsche Forschungsgemeinschaft (DFG project
number 426513195) and by the Ministry of Education, Youth and Sports of
the Czech Republic—CENAKVA project (LM2018099) and PROFISH project
(CZ.02.1.01/0.0/0.0/16_019/0000869). The funders had no role in study design, data
collection and analysis, decision to publish, or preparation of the manuscript.
Grant Disclosures
The following grant information was disclosed by the authors:
Deutsche Forschungsgemeinschaft: DFG project number 426513195).
Ministry of Education, Youth and Sports of the Czech Republic—CENAKVA project:
LM2018099.
PROFISH project: CZ.02.1.01/0.0/0.0/16_019/0000869.
Competing Interests
The authors declare there are no competing interests.
Author Contributions
•Ali Asghar Baloch performed the experiments, analyzed the data, prepared figures and/or
tables, authored or reviewed drafts of the article, and approved the final draft.
Baloch et al. (2023), PeerJ, DOI 10.7717/peerj.15614 24/31
•Dieter Steinhagen conceived and designed the experiments, analyzed the data, authored
or reviewed drafts of the article, and approved the final draft.
•David Gela conceived and designed the experiments, performed the experiments,
authored or reviewed drafts of the article, and approved the final draft.
•Martin Kocour conceived and designed the experiments, performed the experiments,
authored or reviewed drafts of the article, and approved the final draft.
•Veronika Piačková conceived and designed the experiments, performed the experiments,
analyzed the data, authored or reviewed drafts of the article, and approved the final draft.
•Mikolaj Adamek conceived and designed the experiments, performed the experiments,
analyzed the data, prepared figures and/or tables, authored or reviewed drafts of the
article, and approved the final draft.
Animal Ethics
The following information was supplied relating to ethical approvals (i.e., approving body
and any reference numbers):
Lower Saxony State Office for Consumer Protection and Food Safety (LAVES),
Oldenburg, Germany prodided full approval for this research under the reference number:
33.19–425 2-04-16/2144.
Data Availability
The following information was supplied regarding data availability:
The raw data is available in the Supplemental Files.
Supplemental Information
Supplemental information for this article can be found online at http://dx.doi.org/10.7717/
peerj.15614#supplemental-information.
REFERENCES
Adamek M, Baska F, Vincze B, Steinhagen D. 2018. Carp edema virus from three
genogroups is present in common carp in Hungary. Journal of Fish Diseases
41(3):463–468 DOI 10.1111/jfd.12744.
Adamek M, Hazerli D, Matras M, Teitge F, Reichert M, Steinhagen D. 2017a. Viral
infections in common carp lead to a disturbance of mucin expression in mucosal
tissues. Fish and Shellfish Immunology 71:353–358 DOI 10.1016/j.fsi.2017.10.029.
Adamek M, Matras M, Dawson A, Piackova V, Gela D, Kocour M, Adamek J, Kaminski
R, Rakus K, Bergmann SM, Stachnik M, Reichert M, Steinhagen D. 2019. Type I
interferon responses of common carp strains with different levels of resistance to
koi herpesvirus disease during infection with CyHV-3 or SVCV. Fish and Shellfish
Immunology 87:809–819 DOI 10.1016/j.fsi.2019.02.022.
Adamek M, Matras M, Jung-Schroers V, Teitge F, Heling M, Bergmann SM, Reichert
M, Way K, Stone DM, Steinhagen D. 2017b. Comparison of PCR methods for the
detection of genetic variants of carp edema virus. Diseases of Aquatic Organisms
126(1):75–81 DOI 10.3354/dao03152.
Baloch et al. (2023), PeerJ, DOI 10.7717/peerj.15614 25/31
Adamek M, Matras M, Rebl A, Stachnik M, Falco A, Bauer J, Miebach AC, Teitge
F, Jung-Schroers V, Abdullah M, Krebs T, Schröder L, Fuchs W, Reichert M,
Steinhagen D. 2022a. Don’t let it get under your skin!—vaccination protects the skin
barrier of common carp from disruption caused by cyprinid herpesvirus 3. Frontiers
in Immunology 13:1–19 DOI 10.3389/fimmu.2022.787021.
Adamek M, Oschilewski A, Wohlsein P, Jung-Schroers V, Teitge F, Dawson A, Gela
D, Piackova V, Kocour M, Adamek J, Bergmann SM, Steinhagen D. 2017c.
Experimental infections of different carp strains with the carp edema virus (CEV)
give insights into the infection biology of the virus and indicate possible solutions
to problems caused by koi sleepy disease (KSD) in carp aquaculture. Veterinary
Research 48(1):12 DOI 10.1186/s13567-017-0416-7.
Adamek M, Rakus K, Brogden G, Matras M, Chyb J, Hirono I, Kondo H, Aoki T,
Irnazarow I, Steinhagen D. 2014. Interaction between type I interferon and cyprinid
herpesvirus 3 in two genetic lines of common carp Cyprinus carpio.Diseases of
Aquatic Organisms 111(2):107–118 DOI 10.3354/dao02773.
Adamek M, Rebl A, Matras M, Lodder C, El Rahman S, Stachnik M, Rakus K, Bauer
J, Falco A, Jung-Schroers V, Piewbang C, Techangamsuwan S, Surachetpong
W, Reichert M, Tetens J, Steinhagen D. 2022b. Immunological insights into the
resistance of Nile tilapia strains to an infection with tilapia lake virus. Fish and
Shellfish Immunology 124:118–133 DOI 10.1016/j.fsi.2022.03.027.
Adamek M, Syakuri H, Harris S, Rakus K, Brogden G, Matras M, Irnazarow I,
Steinhagen D. 2013. Cyprinid herpesvirus 3 infection disrupts the skin barrier of
common carp (Cyprinus carpio L.). Veterinary Microbiology 162(2–4):456–470
DOI 10.1016/j.vetmic.2012.10.033.
Adamek M, Teitge F, Baumann I, Jung-Schroers V, Rahman SAEl, Paley R, Piackova
V, Gela D, Kocour M, Rakers S, Bergmann SM, Ganter M, Steinhagen D. 2021. Koi
sleepy disease as a pathophysiological and immunological consequence of a branchial
infection of common carp with carp edema virus. Virulence 12(1):1855–1883
DOI 10.1080/21505594.2021.1948286.
Amita K, Oe M, Matoyama H, Yamaguchi N, Fukuda H. 2002. A survey of koi her-
pesvirus and carp edema virus in colorcarp cultured in Niigata Prefecture, Japan.
Fish Pathology 37(4):197–198 DOI 10.3147/jsfp.37.197.
Amundsen MM, Tartor H, Andersen K, Sveinsson K, Thoen E, Gjessing MC, Dahle
MK. 2021. Mucosal and systemic immune responses to salmon gill poxvirus
infection in Atlantic Salmon are modulated upon hydrocortisone injection. Frontiers
in Immunology 12:689302 DOI 10.3389/fimmu.2021.689302.
Ángeles Esteban M. 2012. An overview of the immunological defenses in fish skin. ISRN
Immunology 2012:1–29 DOI 10.5402/2012/853470.
Andersen MH, Schrama D, Straten PThor, Becker JC. 2006. Cytotoxic T cells. Journal of
Investigative Dermatology 126(1):32–41 DOI 10.1038/sj.jid.5700001.
Boes M. 2000. Role of natural and immune IgM antibodies in immune responses.
Molecular Immunology 37(18):1141–1149 DOI 10.1016/S0161-5890(01)00025-6.
Baloch et al. (2023), PeerJ, DOI 10.7717/peerj.15614 26/31
Brown DM, Román E, Swain SL. 2004. CD4 T cell responses to influenza infection.
Seminars in Immunology 16(3):171–177 DOI 10.1016/j.smim.2004.02.004.
Buonocore F, Prugnoli D, Falasca C, Secombes CJ, Scapigliati G. 2003. Peculiar
gene organisation and incomplete splicing of sea bass (Dicentrarchus labrax L.)
interleukin-1β.Cytokine 21(6):257–264 DOI 10.1016/S1043-4666(03)00095-4.
Costa MM, Maehr T, Diaz-Rosales P, Secombes CJ, Wang T. 2011. Bioactivity studies
of rainbow trout (Oncorhynchus mykiss) interleukin-6: effects on macrophage
growth and antimicrobial peptide gene expression. Molecular Immunology 48(15–
16):1903–1916 DOI 10.1016/j.molimm.2011.05.027.
Das BK, Roy P, Rout AK, Sahoo DR, Panda SP, Pattanaik S, Dehury B, Behera
BK, Mishra SS. 2019. Molecular cloning, GTP recognition mechanism and
tissue-specific expression profiling of myxovirus resistance (Mx) protein in
Labeo rohita (Hamilton) after Poly I:C induction. Scientific Reports 9(1):1–19
DOI 10.1038/s41598-019-40323-0.
Edirisinghe SL, Dananjaya SHS, Nikapitiya C, Liyanage TD, Lee KA, Oh C, Kang
DH, De Zoysa M. 2019. Novel pectin isolated from Spirulina maxima enhances
the disease resistance and immune responses in zebrafish against Edwardsiella
piscicida and Aeromonas hydrophila. Fish and Shellfish Immunology 94:558–565
DOI 10.1016/j.fsi.2019.09.054.
Fensterl V, Sen GC. 2009. Interferons and viral infections. BioFactors 35(1):14–20
DOI 10.1002/biof.6.
Fernández-Trujillo MA, García-Rosado E, Alonso MC, Álvarez MC, Béjar J. 2015.
Synergistic effects in the antiviral activity of the three Mx proteins from gilthead
seabream (Sparus aurata). Veterinary Immunology and Immunopathology 168(1–
2):83–90 DOI 10.1016/j.vetimm.2015.08.007.
Forlenza M. 2009. Immune responses of carp: a molecular and cellular approach to
infections. Doctor of Philosophy, Wageningen University, S.l.
Gao S, Von der Malsburg A, Dick A, Faelber K, Schröder GF, Haller O, Kochs G,
Daumke O. 2011. Structure of myxovirus resistance protein A reveals intra- and
intermolecular domain interactions required for the antiviral function. Immunity
35(4):514–525 DOI 10.1016/j.immuni.2011.07.012.
Garcia T, Otto K, Kjelleberg S, Nelson DR. 1997. Growth of Vibrio anguillarum in
salmon intestinal mucus. Applied and Environmental Microbiology 63(3):1034–1039
DOI 10.1128/aem.63.3.1034-1039.1997.
Gomez D, Sunyer JO, Salinas I. 2013. The mucosal immune system of fish: the evolution
of tolerating commensals while fighting pathogens. Fish and Shellfish Immunology
35(6):1729–1739 DOI 10.1016/j.fsi.2013.09.032.
Haenen O, Way K, Stone D, Engelsma M. 2014. ‘Koi Sleepy Disease’ found for the first
time in Koi Carps in the Netherlandse [Abstract 26]. Tijdschrift Voor Diergeneeskunde
139(4).
Howard J, Justus DE, Totmenin AV, Shchelkunov S, Kotwal GJ. 1998. Molecular
mimicry of the inflammation modulatory proteins (IMPS) of poxviruses: evasion
Baloch et al. (2023), PeerJ, DOI 10.7717/peerj.15614 27/31
of the inflammatory response to preserve viral habitat. Journal of Leukocyte Biology
64(1):68–71 DOI 10.1002/jlb.64.1.68.
Huttenhuis HBT, Romano N, Van Oosterhoud CN, Taverne-Thiele AJ, Mastrolia L,
Van Muiswinkel WB, Rombout JHWM. 2006. The ontogeny of mucosal immune
cells in common carp (Cyprinus carpio L.). Anatomy and Embryology 211(1):19–29
DOI 10.1007/s00429-005-0062-0.
Ingerslev HC, Rønneseth A, Pettersen EF, Wergeland HI. 2009. Differential expression
of immune genes in Atlantic salmon (Salmo salar L.) challenged intraperitoneally
or by cohabitation with IPNV. Scandinavian Journal of Immunology 69(2):90–98
DOI 10.1111/j.1365-3083.2008.02201.x.
Janeway Jr CA, Travers P, Walport M, Shlomchik MJ. 2001. The mucosal immune
system. Immunobiology: the immune system in health and disease. Fifth Edition. New
York: Garland Science.
Jung-Schroers V, Adamek M, Teitge F, Hellmann J, Bergmann SM, Schütze H, Klein-
geld DW, Way K, Stone D, Runge M, Keller B, Hesami S, Waltzek T, Steinhagen
D. 2015. Another potential carp killer?: carp edema virus disease in Germany. BMC
Veterinary Research 11(1):1–4 DOI 10.1186/s12917-015-0424-7.
Kocour M, Gela D, Rodina M, Linhart O. 2005. Testing of performance in common carp
Cyprinus carpio L. under pond husbandry conditions I: top-crossing with Northern
mirror carp. Aquaculture Research 36(12):1207–1215
DOI 10.1111/j.1365-2109.2005.01340.x.
Kushala KB, Nithin MS, Girisha SK, Dheeraj SB, Sowndarya NS, Puneeth TG, Suresh
T, Naveen Kumar BT, Vinay TN. 2022. Fish immune responses to natural infection
with carp edema virus (Koi sleepy disease): an emerging fish disease in India. Fish &
Shellfish Immunology 130:624–634 DOI 10.1016/j.fsi.2022.09.012.
Lang T, Alexandersson M, Hansson GC, Samuelsson T. 2004. Bioinformatic identifica-
tion of polymerizing and transmembrane mucins in the puffer fish Fugu rubripes.
Glycobiology 14(6):521–527 DOI 10.1093/glycob/cwh066.
Langevin C, Aleksejeva E, Passoni G, Palha N, Levraud JP, Boudinot P. 2013. The
antiviral innate immune response in fish: evolution and conservation of the IFN
system. Journal of Molecular Biology 425(24):4904–4920
DOI 10.1016/j.jmb.2013.09.033.
Lewisch E, Gorgoglione B, Way K, El-Matbouli M. 2015. Carp edema virus/koi sleepy
disease: an emerging disease in central-east Europe. Transboundary and Emerging
Diseases 62(1):6–12 DOI 10.1111/tbed.12293.
Machat R, Pojezdal L, Piackova V, Faldyna M. 2021. Carp edema virus and immune
response in carp (Cyprinus carpio): current knowledge. Journal of Fish Diseases
44(4):371–378 DOI 10.1111/jfd.13335.
Magnadottir B. 2010. Immunological control of fish diseases. Marine Biotechnology
12(4):361–379 DOI 10.1007/s10126-010-9279-x.
Marcos-López M, Espinosa Ruiz C, Rodger HD, O’Connor I, MacCarthy E, Esteban
MÁ. 2017. Local and systemic humoral immune response in farmed Atlantic salmon
Baloch et al. (2023), PeerJ, DOI 10.7717/peerj.15614 28/31
(Salmo salar L.) under a natural amoebic gill disease outbreak. Fish and Shellfish
Immunology 66:207–216 DOI 10.1016/j.fsi.2017.05.029.
Matras M, Borzym E, Stone D, Way K, Stachnik M, Maj-Paluch J, Palusińska M,
Reichert M. 2017. Carp edema virus in Polish aquaculture—evidence of significant
sequence divergence and a new lineage in common carp Cyprinus carpio (L.). Journal
of Fish Diseases 40(3):319–325 DOI 10.1111/jfd.12518.
Matějíčková K, Pojezdal Ľ, Pokorová D, Reschová S, Piačková V, Palíková M, Veselý
T, Papežíková I. 2020. Carp oedema virus disease outbreaks in Czech and Slovak
aquaculture. Journal of Fish Diseases 43(9):971–978 DOI 10.1111/jfd.13179.
McGuckin MA, Lindén SK, Sutton P, Florin TH. 2011. Mucin dynamics and enteric
pathogens. Nature Reviews Microbiology 9(4):265–278 DOI 10.1038/nrmicro2538.
Mehana E, Rahmani A, Aly S. 2015. Immunostimulants and fish culture: an overview.
Annual Research & Review in Biology 5(6):477–489 DOI 10.9734/arrb/2015/9558.
Miyazaki T, Isshiki T, Katsuyuki H. 2005. Histopathological and electron microscopy
studies on sleepy disease of koi Cyprinus carpio koi in Japan. Diseases of Aquatic
Organisms 65(3):197–207 DOI 10.3354/dao065197.
Mosmann TR, Li L, Sad S. 1997. Functions of CD8 T-cell subsets secreting different cy-
tokine patterns. Seminars in Immunology 9(2):87–92 DOI 10.1006/smim.1997.0065.
Ono SI, Nagai A, Sugai N. 1986. A histopathological study on juvenile colorcarp, Cypri-
nus carpio, showing edema. Fish Pathology 21(3):167–175 DOI 10.3147/jsfp.21.167.
Ouyang P, Zhou Y, Yang R, Yang Z, Wang K, Geng Y, Lai W, Huang X, Chen D, Fang
J, Chen Z, Tang L, Huang C, Yin L. 2020. Outbreak of carp edema virus disease in
cultured ornamental koi in a lower temperature in China. Aquaculture International
28(2):525–537 DOI 10.1007/s10499-019-00476-1.
Oyamatsu T, Hata N, Yamada K, Sano T, Fukuda H. 1997. An etiological study on
mass mortality of cultured colorcarp juveniles showing edema. Fish Pathology
32(2):81–88 DOI 10.3147/jsfp.32.81.
Piačková V, Flajšhans M, Pokorová D, Reschová S, Gela D, Čížek A, Veselý T. 2013.
Sensitivity of common carp, Cyprinus carpio L. strains and crossbreeds reared in the
Czech Republic to infection by cyprinid herpesvirus 3 (CyHV-3; KHV). Journal of
Fish Diseases 36(1):75–80 DOI 10.1111/jfd.12007.
Pretto T, Manfrin A, Ceolin C, Dalla Pozza M, Zelco S, Quartesan R, Abbadi M,
Panzarin V, Toffan A. 2013. First isolation of koi herpes virus (KHV) in Italy from
imported koi (Cyprinus carpio koi). Bulletin of the European Association of Fish
Pathologists 33(4):126–133.
Rai KR, Shrestha P, Yang B, Chen Y, Liu S, Maarouf M, Chen JL. 2021. Acute infection
of viral pathogens and their innate immune escape. Frontiers in Microbiology
12:1–12 DOI 10.3389/fmicb.2021.672026.
Raida MK, Buchmann K. 2008. Development of adaptive immunity in rainbow trout,
Oncorhynchus mykiss (Walbaum) surviving an infection with Yersinia ruckeri. Fish
and Shellfish Immunology 25(5):533–541 DOI 10.1016/j.fsi.2008.07.008.
Rakus KŁ, Irnazarow I, Adamek M, Palmeira L, Kawana Y, Hirono I, Kondo H, Matras
M, Steinhagen D, Flasz B, Brogden G, Vanderplasschen A, Aoki T. 2012. Gene
Baloch et al. (2023), PeerJ, DOI 10.7717/peerj.15614 29/31
expression analysis of common carp (Cyprinus carpio L.) lines during Cyprinid
herpesvirus 3 infection yields insights into differential immune responses. Develop-
mental and Comparative Immunology 37(1):65–76 DOI 10.1016/j.dci.2011.12.006.
Rakus K, Wiegertjes GF, Adamek M, Siwicki AK, Lepa A, Irnazarow I. 2009. Resistance
of common carp (Cyprinus carpio L.) to Cyprinid herpesvirus-3 is influenced by
major histocompatibility (MH) class II B gene polymorphism. Fish and Shellfish
Immunology 26(5):737–743 DOI 10.1016/j.fsi.2009.03.001.
Robinson N, Baranski M, Mahapatra KD, Saha JN, Das S, Mishra J, Das P, Kent
M, Arnyasi M, Sahoo PK. 2014. A linkage map of transcribed single nucleotide
polymorphisms in rohu (Labeo rohita) and QTL associated with resistance to
Aeromonas hydrophila. BMC Genomics 15(1):1–23 DOI 10.1186/1471-2164-15-541.
Rombout JHWM, Huttenhuis HBT, Picchietti S, Scapigliati G. 2005. Phylogeny and
ontogeny of fish leucocytes. Fish and Shellfish Immunology 19(5 SPEC. ISS):441–455
DOI 10.1016/j.fsi.2005.03.007.
Roussel P, Delmotte P. 2005. The diversity of epithelial secreted mucins. Current Organic
Chemistry 8(5):413–437 DOI 10.2174/1385272043485846.
Sadler AJ, Williams BRG. 2008. Interferon-inducible antiviral effectors. Nature Reviews
Immunology 8(7):559–568 DOI 10.1038/nri2314.
Salinas I, Zhang YA, Sunyer JO. 2011. Mucosal immunoglobulins and B cells of
teleost fish. Developmental and Comparative Immunology 35(12):1346–1365
DOI 10.1016/j.dci.2011.11.009.
Secombes CJ, Zou J. 2017. Evolution of interferons and interferon receptors. Frontiers in
Immunology 8:2–11 DOI 10.3389/fimmu.2017.00209.
Shapira Y, Magen Y, Zak T, Kotler M, Hulata G, Levavi-Sivan B. 2005. Differential
resistance to koi herpes virus (KHV)/carp interstitial nephritis and gill necrosis
virus (CNGV) among common carp (Cyprinus carpio L.) strains and crossbreds.
Aquaculture 245(1–4):1–11 DOI 10.1016/j.aquaculture.2004.11.038.
Smith SA, Kotwal GJ. 2002. Immune response to poxvirus infections in various animals.
Critical Reviews in Microbiology 28(3):149–185 DOI 10.1080/1040-840291046722.
Soulliere C, Dixon B. 2017. Immune system organs of bony fishes. In: Reference module
in life sciences. Elsevier Ltd. DOI 10.1016/b978-0-12-809633-8.12179-x.
Syakuri H, Adamek M, Brogden G, Rakus KT, Matras M, Irnazarow I, Steinhagen
D. 2013. Intestinal barrier of carp (Cyprinus carpio L.) during a cyprinid her-
pesvirus 3-infection: Molecular identification and regulation of the mRNA ex-
pression of claudin encoding genes. Fish and Shellfish Immunology 34(1):305–314
DOI 10.1016/j.fsi.2012.11.010.
Tadmor-Levi R, Doron-Faigenboim A, Marcos-Haddad J, Petit J, Hulata G, Forlenza
M, Wiegertjes G, David L. 2019. Different transcriptional response between suscep-
tible and resistant common carp (Cyprinus carpio) fish hints on the mechanism of
CyHV-3 disease resistance. BMC Genomics 20:1–17 DOI 10.21203/rs.2.16693/v1.
Taechavasonyoo A, Hirono I, Kondo H. 2013. The immune-adjuvant effect of Japanese
flounder Paralichthys olivaceus IL-1β.Developmental and Comparative Immunology
41(4):564–568 DOI 10.1016/j.dci.2013.07.003.
Baloch et al. (2023), PeerJ, DOI 10.7717/peerj.15614 30/31
Tafalla C, Figueras A, Novoa B. 2001. Viral hemorrhagic septicemia virus alters turbot
Scophthalmus maximus macrophage nitric oxide production. Diseases of Aquatic
Organisms 47(2):101–107 DOI 10.3354/dao047101.
Tortorella D, Gewurz BE, Furman MH, Schust DJ, Ploegh HL. 2000. Viral sub-
version of the immune system. Annual Review of Immunology 18:861–926
DOI 10.1146/annurev.immunol.18.1.861.
Tumang JR, Francés R, Yeo SG, Rothstein TL. 2005. Cutting edge: spontaneously Ig-
secreting B-1 cells violate the accepted paradigm for expression of differentiation-
associated transcription factors. The Journal of Immunology 174(6):3173–3177
DOI 10.4049/jimmunol.174.6.3173.
Van der Marel M, Adamek M, Gonzalez SF, Frost P, Rombout JHWM, Wiegertjes GF,
Savelkoul HFJ, Steinhagen D. 2012. Molecular cloning and expression of two β-
defensin and two mucin genes in common carp (Cyprinus carpio L.) and their up-
regulation after β-glucan feeding. Fish and Shellfish Immunology 32(3):494–501
DOI 10.1016/j.fsi.2011.12.008.
Wang Y, Wang Q, Baoprasertkul P, Peatman E, Liu Z. 2006. Genomic organi-
zation, gene duplication, and expression analysis of interleukin-1βin chan-
nel catfish (Ictalurus punctatus). Molecular Immunology 43(10):1653–1664
DOI 10.1016/j.molimm.2005.09.024.
Way K, Stone D. 2013. Emergence of carp edema virus-like (CEV-like) disease in the UK.
In: CEFAS Finfish News. 32–34.
Wei X, Li B, Wu L, Yin X, Zhong X, Li Y, Wang Y, Guo Z, Ye J. 2018. Interleukin-6 gets
involved in response to bacterial infection and promotes antibody production in
Nile tilapia (Oreochromis niloticus). Developmental and Comparative Immunology
89:141–151 DOI 10.1016/j.dci.2018.08.012.
Whyte SK. 2007. The innate immune response of finfish—a review of current knowledge.
Fish and Shellfish Immunology 23(6):1127–1151 DOI 10.1016/j.fsi.2007.06.005.
Yamaguchi T, Takizawa F, Furihata M, Soto-Lampe V, Dijkstra JM, Fischer U.
2019. Teleost cytotoxic T cells. Fish and Shellfish Immunology 95:422–439
DOI 10.1016/j.fsi.2019.10.041.
Zamoyska R. 1998. CD4 and CD8: Modulators of T-cell receptor recognition of
antigen and of immune responses? Current Opinion in Immunology 10(1):82–87
DOI 10.1016/S0952-7915(98)80036-8.
Zhang X, Ni Y, Ye J, Xu H, Hou Y, Luo W, Shen W. 2017. Carp edema virus, an
emerging threat to the carp (Cyprinus carpio) industry in China. Aquaculture
474(900):34–39 DOI 10.1016/j.aquaculture.2017.03.033.
Zou J, Secombes CJ. 2016. The function of fish cytokines. Biology 5(2):23
DOI 10.3390/biology5020023.
Baloch et al. (2023), PeerJ, DOI 10.7717/peerj.15614 31/31
