Content uploaded by Alexander R Moschen
Author content
All content in this area was uploaded by Alexander R Moschen on Apr 04, 2014
Content may be subject to copyright.
Visfatin, an Adipocytokine with Proinflammatory
and Immunomodulating Properties
1
Alexander R. Moschen,* Arthur Kaser,* Barbara Enrich,* Birgit Mosheimer,
†
Milan Theurl,
†
Harald Niederegger,
‡
and Herbert Tilg
2
*
Adipocytokines are mainly adipocyte-derived cytokines regulating metabolism and as such are key regulators of insulin resistance.
Some adipocytokines such as adiponectin and leptin affect immune and inflammatory functions. Visfatin (pre-B cell colony-
enhancing factor) has recently been identified as a new adipocytokine affecting insulin resistance by binding to the insulin receptor.
In this study, we show that recombinant visfatin activates human leukocytes and induces cytokine production. In CD14
ⴙ
mono-
cytes, visfatin induces the production of IL-1

, TNF-
␣
, and especially IL-6. Moreover, it increases the surface expression of
costimulatory molecules CD54, CD40, and CD80. Visfatin-stimulated monocytes show augmented FITC-dextran uptake and an
enhanced capacity to induce alloproliferative responses in human lymphocytes. Visfatin-induced effects involve p38 as well as
MEK1 pathways as determined by inhibition with MAPK inhibitors and we observed activation of NF-
B. In vivo, visfatin induces
circulating IL-6 in BALB/c mice. In patients with inflammatory bowel disease, plasma levels of visfatin are elevated and its mRNA
expression is significantly increased in colonic tissue of Crohn’s and ulcerative colitis patients compared with healthy controls.
Macrophages, dendritic cells, and colonic epithelial cells might be additional sources of visfatin as determined by confocal mi-
croscopy. Visfatin can be considered a new proinflammatory adipocytokine. The Journal of Immunology, 2007, 178: 1748 –1758.
A
dipose tissue has emerged as an important endocrine or-
gan producing a variety of secreted factors including
TNF-
␣
(1), IL-6 and IL-8 (2), plasminogen-activator in-
hibitor type 1 (3), leptin (4), adiponectin (5, 6), resistin (7), and
others. Several of these mediators are predominantly synthesized
by adipose tissue and called adipocytokines. Recently, the adipo-
cytokine family has been extended by a novel member—visfatin
(8). In search of differentially expressed genes in paired samples of
s.c. and visceral fat, Fukuhara et al. (8) detected a transcript that
was more abundantly expressed in visceral fat than in s.c. fat. They
demonstrated that circulating levels of visfatin correlated strongly
with the amount of visceral fat in both humans and mice. More-
over, they reported that recombinant visfatin directly binds to the
insulin receptor (IR)
3
resulting in its tyrosine phosphorylation as
well as phosphorylation of insulin receptor substrate-1 and -2 lead-
ing to enhanced glucose uptake in vitro and in vivo (8). This sug-
gests a possible role for visfatin production as a compensatory
response in diet- or obesity-induced insulin resistance (9). Notably,
Chen and colleagues (10) recently described elevated visfatin
plasma levels in patients with type 2 diabetes mellitus.
Visfatin was originally cloned by Samal et al. (11) in search of
novel cytokine-like molecules secreted from human PBLs. They
described a 52-kDa secreted molecule termed pre-B cell-enhanc-
ing factor (PBEF) that was strongly induced by pokeweed mitogen
and cycloheximide and enhanced the effect of IL-7 and stem cell
factor on pre-B cell colony formation (11). Visfatin (PBEF) is
highly conserved in evolution as homologous proteins have been
described in bacteria (12), invertebrate sponges (13), and fish (14).
Intracellular visfatin (PBEF) acts as a dimeric type II phosphori-
bosyltransferase (nicotinamide adenine dinucleotide biosynthesis)
(12, 15, 16) and growth phase-dependent changes of its subcellular
distribution have been reported (17).
Over the last decade, much evidence has emerged that obesity is
closely linked to systemic inflammation (18). On the one hand,
proinflammatory cytokines such as TNF-
␣
or IL-6 are overexpressed
in adipose tissue of obese patients and contribute to insulin resistance
(19, 20). On the other hand, adipocyte-derived cytokines interfere
with immune processes. Adiponectin, the most abundant adipocyte
protein, has potent anti-inflammatory properties by inhibiting proin-
flammatory TNF-
␣
and by inducing anti-inflammatory cytokines like
IL-10 and IL-1 receptor antagonist (IL-1Ra) (21, 22). Leptin, the other
major product of adipocytes, also affects many aspects of inflam-
mation and immunity (23). We hypothesized that visfatin might
share the ambiguity in metabolic and immune functions of other
adipocytokines. We therefore set out to study immunological and
inflammatory functions of visfatin.
Materials and Methods
Materials and reagents
Culture medium in all experiments was RPMI 1640 (Biochrom) supple-
mented with 10% heat-inactivated FCS (Invitrogen Life Technologies) and
100 U penicillin/streptomycin (Biochrom). Recombinant human soluble
visfatin was purchased from Alexis Biochemicals, and from PeproTech.
*Department of Medicine, Christian Doppler Research Laboratory for Gut Inflam-
mation and Clinical Division of Gastroenterology and Hepatology,
†
Department of
Medicine, Clinical Division of General Internal Medicine, and
‡
Innsbruck Biocentre,
Division of Experimental Pathophysiology and Immunology, Innsbruck Medical Uni-
versity, Innsbruck, Austria
Received for publication August 3, 2006. Accepted for publication November
2, 2006.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
1
This work was supported by a grant from the Austrian Science Foundation
(P17447).
2
Address correspondence and reprint requests to Dr. Herbert Tilg, Department of
Medicine, Clinical Division of Gastroenterology and Hepatology, Innsbruck Medical
University and Christian Doppler Research Laboratory for Gut Inflammation, Anich-
strasse 35, 6020 Innsbruck, Austria. E-mail address: Herbert.Tilg@uibk.ac.at
3
Abbreviations used in this paper: IR, insulin receptor; PBEF, pre-B cell-enhancing
factor; IL-1Ra, IL-1 receptor antagonist; DC, dendritic cell; GUSB, glucuronidase

;
qPCR, quantitative PCR; IBD, inflammatory bowel disease; CD, Crohn’s disease;
UC, ulcerative colitis; SGBS, Simpson Golabi Behmel syndrome; CDAI, CD activity
index; CAI, clinical activity score.
Copyright © 2007 by The American Association of Immunologists, Inc. 0022-1767/07/$2.00
The Journal of Immunology
www.jimmunol.org
Both proteins used were ⬎97% pure (SDS-PAGE analysis) and contained
⬍0.01 ng
g
⫺1
LPS as determined by the Limulus amebocyte lysate
method. Both proteins showed comparable biological activity with respect
to induction of IL-1

, TNF-
␣
, and IL-6. Therefore, for all consecutive
experiments we used visfatin purchased from Alexis Biochemicals. Re-
combinant murine soluble visfatin was from Alexis Biochemicals. LPS
from Escherichia coli 055:B5, polymyxin B, and insulin were obtained
from Sigma-Aldrich. Recombinant human GM-CSF was obtained from
Berlex. Human recombinant IL-4 was supplied by Schering-Plough Re-
search Institute. The following Abs were used: PerCP-conjugated CD14,
allophycocyanin-conjugated CD40, PE-conjugated CD69, PE-conjugated
CD86, FITC-conjugated HLA-DR (BD Biosciences); FITC-conjugated
CD54 and allophycocyanin-conjugated CD80 (ImmunoTools).
Preparation of PBMCs, monocytes, dendritic cells (DCs), and
macrophages
Human peripheral blood from voluntary healthy donors was collected in
heparinized tubes and PBMCs were obtained by Lymphoprep gradient cen-
trifugation (Axis Shield) (24). Monocytes were sorted using immunomag-
netic anti-CD14 MicroBeads (Miltenyi Biotec).
For preparation of DCs, CD14
⫹
cells were grown at a density of 10
6
/ml
in RPMI 1640 medium supplemented with 10% heat-inactivated FCS,
1000 U/ml GM-CSF and 800 U/ml IL-4. Culture mediums and cytokines
were replenished on days ⫹2 and ⫹5. On day 7, DCs were harvested. For
the preparation of macrophages, CD14
⫹
cells seeded at 10
6
/ml in RPMI
1640 supplemented with 5% FCS and 1000 U of GM-CSF, and the medium
and GM-CSF were replenished every third day. After 12 days, macro-
phages were harvested and used for subsequent experiments.
PBMCs, monocytes, DCs, and macrophages were harvested and re-
seeded in culture medium supplemented with polymyxin B (5
g/ml) and
subsequently stimulated with various concentrations of recombinant hu-
man visfatin for 20 h. Additionally, in all experiments, cells were stimu-
lated with 100 ng/ml visfatin in the presence of a specific pharmacologic
inhibitor of the indicated protein kinases (p38 kinase (SB 203580), MEK1
(PD 98059), JNK (JNK inhibitor II), PI3K (LY 294002), and Janus protein
tyrosine kinase (JAK inhibitor I); all from Calbiochem, EMD Biosciences).
Supernatants were harvested and stored at ⫺20°C until measurement of
cytokines.
Detection of cytokine production
Concentrations of IL-1

, IL-1Ra, IL-6, IL-10, and TNF-
␣
in cell culture
supernatants were determined using commercially available Ab pairs and
protein standards from R&D Systems (IL-1Ra, IL-6) and BD Pharmingen
(IL-1

, IL-10, and TNF-
␣
) according to manufacturer’s instructions. Ab-
sorption was determined with an ELISA reader (Medgenix Diagnostics) at
450 nm.
Proliferation assays
MLRs were done using CD14
⫹
monocytes as stimulators and adhesion
purified allogeneic PBLs as responders. Stimulator monocytes were incu-
bated with indicated concentrations of recombinant visfatin for 20 h.
Thereafter, cells were fixed with 0.05% glutaraldehyde in PBS for 30 s and
then fixation was stopped by addition of an equal volume of 0.4 M glycine.
After washing four times, cells were counted and 0.5 ⫻ 10
5
monocytes
were cultured for 5 days in triplicates in round-bottom 96-well plates with
the indicated ratios of PBLs.
RNA extraction and quantitative real-time RT-PCR
PBMCs were adjusted to 2 ⫻ 10
6
cells/ml and incubated for6hinpresence
or absence of 100 and 250 ng/ml recombinant visfatin for 6 h. Thereafter,
cells were harvested and total RNA extracted using TRIzol reagent (In-
vitrogen Life Technologies). Reverse transcription was performed with
Moloney murine leukemia virus reverse transcriptase (200 U/1
gof
RNA) (Invitrogen Life Technologies) with random hexanucleotide primers
(Roche).
Quantitative PCR (qPCR) was performed in a total volume of 25
lof
Brillant QPCR master mix in 40 cycles of 95°C for 30 s and 60°C for 1 min
with a Mx4000 quantitative PCR system (Stratagene). Optimal concentra-
tions for forward and reverse primers as well as TaqMan probes were
determined before all performed qPCR experiments. Primers used are
listed in Table I. For endogenous controls, mRNA expression of GAPDH
was determined for human and glucuronidase

(GUSB) for murine sam-
ples using predesigned TaqMan control reagents (Applied Biosciences).
Determination of activated NB-
B p65 (RelA)-binding activity
For determination of NF-
B activation, 2 ⫻ 10
6
PBMCs/ml were incu
-
bated with or without 250 ng/ml visfatin or 100 ng/ml LPS. Total (cyto-
plasmatic and nuclear) protein was extracted with M-PER protein extrac-
tion reagent (Pierce) in the presence of a protease inhibitor mixture (Sigma-
Aldrich) after 1, 3, 6, 9, 12, and 20 h. Protein concentrations were
determined by the Bradford protein assay (Bio-Rad). Activated NF-
B p65
was determined using an EZ-Detect chemiluminescent transcription factor
assay (Pierce) that has been described previously by Renard et al. (25).
Briefly, 10
g of total protein was incubated in wells containing biotiny-
lated-consensus DNA duplexes of NF-
B. The captured active transcrip-
tion factor was detected by a specific Ab recognizing NF-
B p65 and then
incubated with a secondary HRP-conjugated Ab. A chemiluminescent sub-
strate was added to each well and the resulting signal was detected using
an Anthos Lucy 1 luminometer (Anthos Labtec Instruments).
Flow cytometry
For four-color surface flow cytometry, 10
6
/ml visfatin-stimulated mono
-
cytes were incubated with indicated FITC-, PE-, PerCP- or allophycocya-
nin-labeled mAbs or the corresponding isotype controls for 20 min. After
washing, cells were acquired with a FACSCalibur and data evaluation was
performed by CellQuest Pro software (BD Biosciences). For determination
of mannose receptor-mediated Ag uptake, freshly isolated monocytes (1 ⫻
10
5
) were incubated with 0.5 mg/ml FITC-dextran (Sigma-Aldrich) for 60
min at 37°C. Thereafter, cells were washed three times with ice-cold PBS
and immediately analyzed by flow cytometry using a FACSCalibur.
Table I. Primer sets used for quantitative real-time PCR
Gene Symbol
(accession no.)
a
Forward Primer (5⬘33⬘)
TaqMan Probe (FAM-5⬘33⬘-TAMRA
(1)
,
BHQ1
(2)
, MGB
(3)
)
Reverse Primer (5⬘33⬘)
Hs_IL-6
(NM_000600)
GGTACATCCTCGACGGCATCT AGCCCTGAGAAAGGAGACATGTAACAAGAGTAACA
(2)
GTGCCTCTTTGCTGCTTTCAC
Hs_IL-10
(NM_000572)
GGGAGAACCTGAAGACCCTCA CTGAGGCTACGGCGCTGTCATCG
(1)
TGCTCTTGTTTTCACAGGGAAG
Hs_TNF
␣
(NM_000594)
ATCTTCTCGAACCCCGAGTGA CCCATGTTGTAGCAAACCCTCAAGCTGA
(1)
CGGTTCAGCCACTGGAGCT
Hs_Visfatin
(NM_005746)
GGTCTGGAATACAAGTTACAT
GATTTTG
TCTCTTCCCAAGAGACTGCTGGCATAGG
(2)
TTGAAGTTAACCAAGTGAGCAGATG
Hs_GAPDH
(NM_002046)
Human GAPDH endogenous control (VIC/TAMRA), 4310884E, Applied Biosystems
Mm_IL-1

(NM_008361)
GATGAGGACATGAGCACC
TTCTT
CATCTTTGAAGAAGAGCCCATCCTCTGTGA
(2)
GCAGGTTATCATCATCATCCCA
Mm_IL-6
(NM_031168)
TGTTCTCTGGGAAATCGTGGA ATGAGAAAAGAGTTGTGCAATGGCAATTCTG
(2)
AAGTGCATCATCGTTGTTCATACA
Mm_TNF
␣
(NM_013693)
AGTTCTATGGCCCAGACCCTC CACTCAGATCATCTTC
(3)
CAGGCTTGTCACTCGAATTTTG
Mm_GUSB
(NM_010368)
TaqMan Gene Expression Assay (FAM/MGB), Mm00446953_m1, Applied Biosystems
a
Hs, Homo sapiens; Mm, Mus musculus. Dyes: FAM, carboxyfluorescein; VIC, artificial name. Quencher: TAMRA, carboxytetramethylrhodamine; BHQ1, black hole
quencher 1; MGB, minor groove binding.
1749The Journal of Immunology
Chemotaxis
Migration of cells into nitrocellulose to gradients of recombinant visfatin
was measured under use of a 48-well Boyden microchemotaxis chamber
(Neuroprobe) in which an upper chamber is separated from a lower cham-
ber by a 5-
m pore-size filter (Sartorius) (26).
As indicated, monocytes or B cells were incubated to increasing con-
centrations of visfatin. After a migration time of 120 –240 min, the filters
were dehydrated, fixed, and stained with H&E. Migration depth of cells
into the filter was quantified by light microscopy, measuring the distance
(in micrometers) from the surface to the leading front of cells, before any
cells had reached the lower surface (leading front assay). Data are ex-
pressed as chemotaxis index, i.e., the ratio of the distance of stimulated and
random migration of cells into the nitrocellulose filters.
Mice and in vivo treatment
Pathogen-free 6- to 8-wk-old BALB/c mice were obtained from Harlan
Winkelmann and maintained under controlled animal care conditions with
free access to standard chow and water. Mice were given two i.p. injections
of pyrogen-free saline or 10
g of recombinant murine visfatin (Alexis
Biochemicals) at 0 and after 12 h. Experimental design was as follows: in
experimental series 1, blood was collected from the tail vein at 15 h (3 h
after the second visfatin injection). The mice were then sacrificed after
20 h. In experimental series 2, the mice were sacrificed at 15 h. The ex-
perimental procedure is schematized in Fig. 6A. Blood was centrifuged at
2500 ⫻ g for 15 min and serum was stored at ⫺80°C until determination
of circulating IL-6 and TNF-
␣
(OptEIA; BD Biosciences). Liver,
spleen, lung, and small intestine from each animal were removed and
flash frozen in liquid nitrogen. mRNA expression levels of IL-1

, IL-6,
and TNF-
␣
were determined by quantitative real-time RT-PCR essen-
tially as described above (for primer and probes see Table I). All animal
experiments described were performed in accordance with Austria’s
legal requirement.
Human samples
A total of 74 patients with an established diagnosis of inflammatory bowel
disease (IBD) (39 Crohn’s disease (CD), 35 ulcerative colitis (UC)) were
included in the study. The control group was recruited from 38 age- and
sex-matched healthy individuals. Patients’ baseline characteristics are
shown in Table II. Informed consent was obtained from each patient in-
volved in the study that has been reviewed and approved by the local ethics
committee.
For the determination of circulating visfatin, blood was collected into
Sarstedt Monovette serum containers, centrifuged at 1200 ⫻ g for 15 min,
aliquoted into 1-ml portions, and stored at ⫺80°C until assayed. Serum
visfatin concentrations were determined using a human visfatin (C-termi-
nal) enzyme immunometric assay (Phoenix Pharmaceuticals).
Visfatin mRNA levels were determined in inflamed and noninvolved
colonic biopsy specimens that were collected from nine CD and nine UC
patients undergoing diagnostic colonoscopy. The involved character was
first identified by gross endoscopic appearance and then further confirmed
by histologic evaluation of biopsies taken in parallel. Eight patients under-
going screening colonoscopy served as healthy controls. Biopsy specimens
were immediately placed into RNAlater RNA stabilization reagent (Qia-
gen). RNA extraction, reverse transcription, and qPCR were essentially
performed as described above. Sequences of primers and probe are listed
in Table I.
Fluorescence microscopy
Colonic tissue specimens were obtained from patients undergoing surgical
resection. The tissue samples were immediately embedded in Tissue-Tek
OCT compound (Sakura). Six-micrometer sections were prepared on a
Leica Cryomicrotom. After fixation in 4°C acetone and rehydration in PBS,
nonspecific binding sites were blocked with Image-iT FX signal enhancer
(Molecular Probes) and serum-free protein block (DakoCytomation). For
detection of visfatin, all sections were stained with two commercially avail-
able rabbit anti-visfatin Abs raised either against the entire protein or an
N-terminal peptide (both Alexis Biochemicals). For double-labeling, the
following mouse Abs were used: anti-human DC-SIGN (CD209) (R&D
Systems), anti-human CD3, CD20, CD31, MHC class II, CK18, and
smooth muscle actin (all DakoCytomation), and CD163 (BMA Biomedi-
cals). Isotype-matched control Abs were used to exclude nonspecific stain-
ing. All primary Abs were diluted in PBS containing 1% BSA and incu-
bated at 4°C overnight. After washing, visfatin was visualized with Alexa
Fluor 568-conjugated goat anti-rabbit IgG (Molecular Probes). Subse-
quently, mouse Abs were detected with Alexa Fluor 488 conjugated goat
anti-mouse IgG (Molecular Probes). Nuclear counterstaining was per-
formed with 4⬘,6⬘-diamidino-2-phenylindole (DAPI) 1/7000 in PBS for 4
min. Finally, sections were mounted in Dako fluorescent mounting medium
and stored at 4°C until and viewed on a Zeiss Axiovert 100 M microscope
with scanning head LSM 510 with the Zeiss Plan-Apochromat objective,
⫻40 oil, numerical aperture of 1.4. Laser lines at 488, 364, and 543 nm
were used for excitation. Acquisition was done with the Zeiss LSM Im-
aging Software version 2.81.
Table III. Recombinant visfatin induces IL-6 production in CD14
⫹
monocyte-derived DCs and macrophages
a
Visfatin (ng/ml)
DCs Macrophages (Mf)
IL-6 IL-6
Control 11.54 ⫾ 1.72 396.86 ⫾ 53.69
5 33.34 ⫾ 5.8* 1031.3 ⫾ 264.7
50 57.73 ⫾ 14.5* 1957.1 ⫾ 678.6
100 136.56 ⫾ 72.18* 2043.9 ⫾ 522.0*
250 615.92 ⫾ 412.78* 3823.3 ⫾ 1033.8*
a
Freshly isolated CD14
⫹
monocytes were cultured in presence of either GM-
CSF ⫹ IL-4 for 7 days (DCs) or GM-CSF alone for 10 days (Mf). Subsequently cells
were harvested and 1 ⫻ 10
6
/ml cells were treated with the indicated concentrations of
recombinant visfatin as described in Materials and Methods. IL-6 levels in the su-
pernatant were assayed by ELISA. Data are expressed as mean IL-6 levels in pico-
grams per milliliter ⫾ SD (DCs: n ⫽ 4, Mf: n ⫽ 3; ⴱ, p ⬍ 0.05).
Table II. Patient characteristics
Crohn’s Disease Ulcerative Colitis Controls
n 39 35 45
Age (years)
a
35.3 (13.4) 关18.3–70.8兴 36.0 (12.2) 关18.9 –59.0兴 37.8 (12.8) 关23.1–71.4兴
Sex (M/F) 14/25 19/16 22/23
Disease duration (years)
a
3.47 (5.97) 关0.13–24.2兴 4.5 (3.3) 关0.83–11.28兴
Activity score
a
243 (59)
b
8.1 (2.7)
c
Medication
d
None 3 4 45
Aminosalicylate 15 21
Systemic steroid 10 13
Azathioprine 11 3
Antibiotic 2
Anti-TNF 6
a
Values are mean (SD) 关range兴.
b
Crohn’s disease activity index (CDAI).
c
Rachmilewitz clinical activity index (CAI).
d
Some patients had combined therapy.
1750 VISFATIN AND INFLAMMATION
Statistical analysis
Unless otherwise noted, results are expressed as mean ⫾ SEM. The dif-
ferences among groups were analyzed by Mann-Whitney U test and, where
appropriate, by Kruskal-Wallis ANOVA. Significance was assumed for p
values ⬍0.05. All data analyses were performed with the SPSS 12.0 soft-
ware package.
Results
Recombinant visfatin induces the production of cytokines in
human PBMCs
To determine the effect of recombinant visfatin on human leuko-
cytes, freshly isolated PBMCs were incubated with visfatin. Stim-
ulation with visfatin resulted in a dose-dependent induction of IL-1

,
IL-1Ra, IL-6, IL-10, and TNF-
␣
(Fig. 1, A–E). The most pronounced
effects were observed for IL-6 production, reaching statistical signif-
icance at a concentration as low as 5 ng/ml when compared with
untreated controls (Fig. 1C; ⴱ, p ⬍ 0.05; ⴱⴱ, p ⬍ 0.01). A total of 50
ng/ml visfatin significantly up-regulated the release of IL-1

and
TNF-
␣
(Fig. 1, A and E; ⴱ, p ⬍ 0.05). IL-1Ra and IL-10 induction
became significant at visfatin concentrations of 100 and 250 ng/ml,
respectively (Fig. 1, B and D; ⴱ, p ⬍ 0.05; ⴱⴱ, p ⬍ 0.01).
Recombinant visfatin was derived from E. coli and endotoxin con-
tent was below 0.1 EU/
g(⬃10 pg of endotoxin/
g of protein) as
determined by Limulus amebocyte lysate testing. Culture medium was
therefore supplemented with 5
g/ml polymyxin B in all experiments.
This concentration efficiently blocked endotoxin-induced cytokine
production up to a concentration of 1 ng/ml (data not shown).
FIGURE 1. Recombinant visfatin
induces cytokine production in hu-
man leukocytes. A total of 2 ⫻
10
6
/ml human PBMCs (n ⫽ 6) were
treated with saline or increasing con-
centrations of visfatin for 16 h and
cytokines were determined by
ELISA. Polymyxin B was present at
all conditions. A, IL-1

(ⴱ, p ⬍ 0.05;
ⴱⴱ, p ⬍ 0.01); B, IL-1Ra (ⴱ, p ⬍
0.05); C, IL-6 (ⴱ, p ⬍ 0.05; ⴱⴱ, p ⬍
0.01); D, IL-10 (ⴱ, p ⬍ 0.05; ⴱⴱ, p ⬍
0.01); E, TNF-
␣
(ⴱ, p ⬍ 0.05;
ⴱⴱ, p ⬍ 0.01). Preadipocytes from
SGBS were differentiated into ma-
ture adipocytes and glucose uptakes
were performed to test for visfatin’s
insulin mimetic effect (F).
FIGURE 2. Increased expression of cytokine mRNA
in visfatin-treated leukocytes. Freshly isolated PMBCs
were incubated in presence or absence of the indicated
concentrations of recombinant human visfatin. Total
mRNA was extracted after 5 h, and cytokine expres-
sion levels were analyzed by quantitative real-time
PCR. A, IL-6 mRNA expression in human PBMCs. B,
IL-10 mRNA expression in human PBMCs. C,
TNF-
␣
mRNA expression in human PBMCs. All ex-
pression levels are normalized to GAPDH (n ⫽ 5; ⴱ,
p ⬍ 0.05; ⴱⴱ, p ⬍ 0.01).
1751The Journal of Immunology
Visfatin has been shown to bind to the IR and to mimic insulin
action (8). Therefore, PBMCs were incubated with 10 nM insulin
alone or in combination with 100 ng/ml recombinant visfatin. Incu-
bation with insulin alone did not induce cytokine production in human
PBMCs nor did the presence of insulin alter the visfatin-induced in-
duction of cytokines (n ⫽ 3, data not shown).
2-Deoxy-
D-glucose transport measurements were performed to
confirm visfatin’s biological activity. Preadipocytes from Simpson
FIGURE 3. Visfatin activates CD14
⫹
monocytes. A–C, CD14
⫹
monocytes (n ⫽ 6) were treated with the indicated concentrations of recombinant visfatin for
16 h. Supernatants were harvested and levels of IL-1

(A), IL-6 (B), and TNF-
␣
(C) were determined by ELISA (ⴱ, p ⬍ 0.05). D–F, For the detection of cell surface
markers monocytes were incubated with saline or 250 ng/ml visfatin and subsequently analyzed for CD54 (ICAM) (D), CD40 (E), and CD80 (B7-1) (F)byflow
cytometry. Representative stainings of three independent experiments are shown (dotted line: isotype control; thin line: solvent-treated cells; thick line: visfatin-
treated cells). G–I, Mannose receptor-mediated endocytosis was detected as uptake of FITC-dextran at 37°C, and threshold was set according to baseline uptake
of control monocytes that were simultaneously incubated on ice (n ⫽ 3). The FITC-dextran uptake of CD14
⫹
monocytes was elevated 4.4-fold at
100 ng/ml (H) and 5.9-fold at 250 ng/ml (I) recombinant visfatin when compared with unstimulated controls (G). J, Visfatin significantly enhanced the
alloproliferative response as determined by ANOVA with post hoc Bonferroni (ⴱ, p ⬍ 0.05). Thymidine incorporation in a MLR using 0.5 ⫻ 10
5
visfatin-preincubated CD14
⫹
monocytes as stimulator cells and MHC-mismatched PBLs in the indicated stimulator:responder ratios (n ⫽ 3).
1752 VISFATIN AND INFLAMMATION
Golabi Behmel syndrome (SGBS), a gift from Dr. M. Wabitsch
(University of Ulm, Ulm, Germany), were grown and differenti-
ated as described previously (27). The SGBS is a rare X-linked
recessive disorder characterized by pre- and postnatal overgrowth.
The molecular defect causing this syndrome has not yet been ex-
actly characterized although mutations in the glypican 3 gene have
been associated with the syndrome in some reported patients (27).
As depicted in Fig. 1F, 100 nM insulin significantly up-regulated
glucose uptake in SGBS adipocytes. An equimolar concentration
of 100 nM (⫽5.2 ng/ml) visfatin also induced glucose uptake yet
to a lesser extent. A high visfatin concentration of 2
M(⫽100
ng/ml) could not further enhance glucose uptake in SGBS adipo-
cytes (Fig. 1F). These data indicate that visfatin activates the IR
but activation of the IR does not interfere with cytokine production.
Recombinant visfatin modulates cytokine gene expression in
human PBMCs
Quantitative real-time PCR was performed to confirm the protein
data. Again, visfatin dose-dependently induced IL-6, IL-10, and
TNF-
␣
mRNA expression levels in PBMCs (Fig. 2; ⴱ, p ⬍ 0.05;
ⴱⴱ, p ⬍ 0.01). As for protein levels, the strongest mRNA up-
regulation was seen for IL-6, with an 83.5-fold induction at 100
ng/ml and a 316-fold induction at 250 ng/ml (Fig. 2A, ⴱ, p ⬍ 0.05;
ⴱⴱ, p ⬍ 0.01). As shown in Fig. 2, B and C, stimulation with 100
and 250 ng/ml visfatin resulted in a 4.4- and 10.5-fold induction
of IL-10 and a 3.3- and 6.9-fold induction of TNF-
␣
, respec-
tively (ⴱ, p ⬍ 0.05; ⴱⴱ, p ⬍ 0.01).
Visfatin activates effector functions of human APCs
Monocytes, DCs, and macrophages are critical regulators of innate
as well as adaptive immune responses. Their functions comprise
effector tasks with secretion of pro- and anti-inflammatory cyto-
kines, phagocytosis of microorganisms and foreign Ags, Ag pre-
sentation, and provision of costimulatory molecules. We therefore
studied the effect of visfatin on APCs. As shown in Fig. 3, A–C,
visfatin was able to induce the secretion of IL-1

, IL-6, and
TNF-
␣
from freshly isolated CD14
⫹
monocytes in a dose-depen
-
dent manner.
FIGURE 4. Human CD14
⫹
monocytes were
stimulated with 100 ng/ml recombinant visfatin
in the presence of either solvent (DMSO) or
three times IC
50
of the indicated specific kinase
inhibitor for p38 kinase (p38) (SB203580),
MEK (MEK1) (PD98059), JNK (Inhibitor II),
and PI3K (LY204002). Concentrations of IL-1

(A), IL-1Ra (B), IL-6 (C), IL-10 (D), and TNF-
␣
(E) in supernatants were determined by ELISA
(ⴱ, p ⬍ 0.05). Visfatin-induced cytokine produc-
tion in human monocytes (n ⫽ 6) is abrogated in
the presence of a selective inhibitor of p38 ki-
nase. Inhibition of MEK1 significantly down-
regulated the production of proinflammatory cy-
tokines IL-1

, IL-6, and TNF-
␣
. Blockade of
PI3K significantly suppressed the induction of
TNF-
␣
as well as the anti-inflammatory cyto-
kine IL-10. JNK inhibitor II significantly re-
duced visfatin-induced TNF release from human
monocytes. Visfatin increases NF-
B p65
(RelA) DNA binding capacity in human leuko-
cytes (F). PBMCs were incubated with visfatin
or LPS and p65 DNA-binding capacity was de-
termined by a chemiluminescent transcription
factor assay at the indicated time points (n ⫽ 3).
Data are expressed as relative light units (RLU)
(ⴱ, p ⬍ 0.05).
1753The Journal of Immunology
Interestingly, visfatin was not able to induce IL-1

and TNF-
␣
in GM-CSF-differentiated monocyte-derived macrophages and
DCs (data not shown). However, visfatin also induced IL-6 in
these cell types (Table III).
Expression of cell surface markers in freshly isolated visfatin-
stimulated monocytes was studied by flow cytometry. As pre-
sented in Fig. 3, D–F, visfatin efficiently up-regulated cell surface
expression of CD54 (Fig. 3D), CD40 (Fig. 3E), and CD80 (Fig.
3F). No significant changes were observed for the expression of
MHC class II, CD69, and CD86 (data not shown). Mannose re-
ceptor-mediated uptake of soluble Ag was measured in visfatin-
stimulated as well as control monocytes (Fig. 3, G–I). Treatment
with 100 or 250 ng/ml recombinant visfatin significantly enhanced
FITC-dextran uptake 4.4- and 5.9-fold, respectively.
To elucidate whether the observed changes in surface expres-
sion of costimulatory molecules might alter T cell activation, we
performed MLR with CD14
⫹
monocytes as stimulator and PBLs
as allogeneic responder cells. To exclude that visfatin might di-
rectly affect accessory cells, especially B cells, monocytes were
stimulated with visfatin overnight and consequently fixed with glu-
taraldehyde. Indeed, consistent with their altered immunopheno-
type, visfatin-stimulated monocytes exhibited a significantly in-
creased allostimulatory capacity (Fig. 3J). As depicted in Fig. 3J,
a dose-dependent increase in proliferative response of PBLs was
seen more obvious at lower stimulator/responder ratios of 1:1 and
1:3 but was still present at a higher ratio of 1:5. Taken together,
these results indicate that visfatin is a potent activator of human
monocytes by inducing effector functions and enhancing T cell
responses.
Inhibition of p38 MAPK abrogates visfatin-induced cytokine
production
Fukuhara et al. (8) demonstrated that visfatin binds to the IR and
mimics insulin effects. We speculated that visfatin might activate
additional signaling pathways. Thus, CD14
⫹
monocytes were in
-
cubated with recombinant visfatin and several specific pharmaco-
logic kinase inhibitors were used to gain insight into possible up-
stream mechanisms. Inhibition of the p38 MAPK by SB203580
almost completely abrogated all observed changes in visfatin-in-
duced cytokine production indicating a central role for p38 in vis-
fatin signal transduction (Fig. 4, A–E; ⴱ, p ⬍ 0.05; ⴱⴱ, p ⬍ 0.01).
Inhibition of MEK1 (MAP2K) through PD 98059 also signifi-
cantly prevented the production of IL-1

, IL-6, and TNF-
␣
but not
IL-1Ra and IL-10 (Fig. 4, A–E). JNK inhibitor II that selectively
blocks JNK activity, which activates AP-1 and related transcrip-
tion factors like ATF2 (28, 29), significantly inhibited TNF release
from visfatin-stimulated monocytes. Inhibition of PI3K by
LY294002 significantly down-regulated TNF-
␣
as well as the anti-
inflammatory cytokine IL-10 (Fig. 4, D and E). Because PI3K is
critically involved in the control of cell death by activating the
survival kinase Akt (30), induction of PI3K could be a possible
mechanism involved in visfatin’s antiapoptotic properties as re-
ported in previously published data (31, 32). Blockade of Janus
tyrosine protein kinase activity (JAK1–3) did not alter visfatin-
induced cytokine production for any of the observed mediators
(Fig. 4, A–E).
Activation of NF-
B transcription factors is a central event in
the initiation and amplification of inflammatory responses (33).
We therefore analyzed the time-dependent activation of p65
(RelA), part of the p50:RelA dimer that is activated by the classical
pathway, in freshly isolated leukocytes. As depicted in Fig. 4F,
visfatin significantly increased active DNA-binding p65 (RelA)
reaching a peak 6 h after stimulation compared with untreated
control monocytes (ⴱ, p ⬍ 0.05).
Recombinant visfatin induces chemotaxis in monocytes and
B cells
As depicted in Fig. 5, visfatin dose-dependently induced a migra-
tory response in Boyden chamber microchemotaxis experiments.
We found a visfatin-induced migratory response in CD14
⫹
mono
-
cytes (Fig. 5A) and in CD19
⫹
B cells (Fig. 5B), but not in CD3
⫹
T cells (data not shown). The observed response was particularly
strong reaching levels comparable with fMLP and IL-8 (CXCL8)
that were used as positive controls.
Recombinant visfatin induces IL-6 in mice
To understand the in vivo biological relevance of visfatin, we in-
jected recombinant murine visfatin i.p. to BALB/c mice, deter-
mined levels of circulating cytokines, and measured cytokine
mRNAs in various tissues. Ten mice were treated with either 10
g of visfatin or saline at 0 and after 12 h. In experimental series
1, blood was collected from the tail vein of five visfatin and five
control animals after 15 h and the animals were sacrificed at 20 h.
In experimental series 2, five visfatin and five control animals were
sacrificed at 15 h (experimental structure is outlined in Fig. 6A).
Evaluation of circulating cytokines showed that visfatin-treated
animals had significantly elevated serum concentrations of IL-6
after 15 h (3 h after the second visfatin challenge) (Fig. 6B; ⴱ, p ⬍
0.05). Elevation of IL-6 serum levels was less pronounced after the
first visfatin injection (data not shown). Elevated IL-6 concentra-
tions rapidly declined to control levels and no difference was seen
at 20 h (Fig. 6B). Notably, we did not observe any differences in
FIGURE 5. Effect of visfatin on leukocyte chemotaxis. Freshly isolated
CD14
⫹
monocytes and CD19
⫹
B cells were allowed to migrate into ni
-
trocellulose toward various concentrations of visfatin in the lower wells of
a Boyden microchemotaxis chamber. Direct chemotaxis of CD14
⫹
mono
-
cytes (n ⫽ 5) (A), and CD19
⫹
B cells (n ⫽ 5) (B). fMLP and IL-8
(CXCL8) served as positive controls. Data are expressed as the chemotaxis
index: the ratio of the distance of stimulated and random migration of
leukocytes into nitrocellulose filters (ⴱ, p ⬍ 0.05).
1754 VISFATIN AND INFLAMMATION
circulating TNF concentrations. To test whether visfatin could in-
duce expression of cytokines in vivo, total tissue RNA was ex-
tracted from liver, spleen, lung, and small intestine that were col-
lected from visfatin-treated and control animals of experimental
series 2. Consequently, IL-1

, IL-6, and TNF-
␣
mRNA transcripts
were analyzed by quantitative PCR. mRNA expression of IL-6 was
significantly higher in the small intestine of visfatin-treated mice
(Fig. 6D; ⴱ, p ⬍ 0.05). Both IL-1

and TNF-
␣
mRNA expression
were elevated in the liver of visfatin-treated animals although they
did not reach statistical significance (Fig. 6, C and E; p ⫽ 0.076).
High circulating visfatin levels are observed in patients
with IBD
IBD, in particular CD, is known to express high levels of IL-6 in
the gut mucosa, and IL-6 trans-signaling is considered a key factor
FIGURE 6. In vivo treatment of mice with murine visfatin leads to increased levels of serum IL-6 and induction of IL-6 gene expression. BALB/c mice
(n ⫽ 10) were injected i.p. twice at 0 and 12 h with 10
g of visfatin or saline (A). Blood was taken at 15 (experimental series 1: tail vein (n ⫽ 5);
experimental series 2: cardiac puncture (n ⫽ 5)) and 20 h (experimental series 1: cardiac puncture (n ⫽ 5)). Organs were harvested and immediately flash
frozen together with cardiac puncture. Serum IL-6 levels were determined by ELISA (B). Total RNA was extracted from individual tissues and IL-1

(C), IL-6 (D), and TNF-
␣
(E) mRNAs were quantified by real-time PCR as described in Materials and Methods. Data are normalized to GUSB
expression (ⴱ, p ⬍ 0.05; ⴱⴱ, p ⬍ 0.001).
FIGURE 7. Circulating visfatin protein and colonic
visfatin mRNA expression are elevated in patients with
IBD. A, Visfatin serum concentrations were determined
in patients with CD and UC and compared with healthy
controls. CD and UC patients were divided with respect
to disease activity as determined by CDAI for CD and
Rachmilewitz CAI for UC patients. The number of pa-
tients included is given below the x-axis. B, Total RNA
was extracted from IBD (involved and noninvolved)
and healthy control colonic biopsy specimen and visfa-
tin mRNA expression was quantified by real-time PCR.
Data are expressed as visfatin/GAPDH ratios. The num-
ber of patients is indicated below the abscissa.
1755The Journal of Immunology
in apoptosis resistance of lamina propria T cells (34). We therefore
investigated the activation state of visfatin in IBD patients.
As shown in Fig. 7A, circulating levels of visfatin were signif-
icantly elevated in IBD patients compared with healthy controls. In
CD patients, serum visfatin levels were elevated irrespective of
disease activity (active disease: CD activity index (CDAI) (35)
⬎150; remission: CDAI ⬍150). In UC, however, visfatin concen-
trations appeared to be higher in active UC (Rachmilewitz clinical
activity score (CAI) (36) ⬎4) compared with UC patients in re-
mission (CAI ⬍4) (Fig. 7A).
Visfatin mRNA expression is increased in CD and UC
Real-time PCR analysis was performed to quantitate visfatin
mRNA expression in colonic biopsy specimens of patients with
IBD and healthy controls. Data were normalized to human
GAPDH. A significant up-regulation of visfatin mRNA expression
was observed in inflammatory colonic biopsy specimens of both
CD and UC patients compared with control subjects (Fig. 7B;
ⴱ, p ⬍ 0.05). Visfatin mRNA expression in noninvolved CD and
UC biopsy specimens was still elevated when compared with
healthy control specimens, but this difference did not reach statis-
tical significance (Fig. 7B).
Cellular sources of visfatin in inflammatory colonic tissue
To identify cellular sources of human visfatin, we performed con-
focal microscopy with double-immunofluorescence staining of vis-
fatin with several specific cellular markers. As depicted in Fig. 8A,
we detected visfatin in adipocytes of mesenteric tissue adjacent to
the colonic wall (white arrows). Furthermore, Fig. 8A shows
CD163
⫹
double-positive tissue macrophages that reside between
adipocytes (arrowheads). Fig. 8B also displays double-positive
CD163
⫹
tissue macrophages within the submucosa. Moreover,
visfatin colocalized with DCs (Fig. 8D), detected by an Ab di-
rected against CD209 (DC-SIGN), and cytokeratin 18-positive
epithelial cells (Fig. 8C). Although visfatin expression has been
described in PBLs, we did not colocalize visfatin within mu-
cosa-infiltrating CD3
⫹
T cells (Fig. 8E), nor in secondary fol
-
licle-associated CD20
⫹
B cells (Fig. 8F). No colocalization was
found in CD31
⫹
endothelial cells (Fig. 8G). Smooth muscle cells
as identified by staining for smooth muscle actin were slightly
positive for visfatin (data not shown).
Discussion
We have reported proinflammatory activities exerted by the re-
cently characterized adipocytokine visfatin. We have demonstrated
that visfatin, initially described as PBEF, dose-dependently up-
regulated the production of the pro- and anti-inflammatory cyto-
kines IL-1

, IL-1Ra, IL-6, IL-10, and TNF-
␣
in human mono-
cytes. These cytokines play a substantial role in a wide range of
infectious and inflammatory diseases (37–39).
APCs such as monocytes, DCs, and macrophages execute one of
the central processes inducing and regulating immune functions by
establishing cell-cell contacts with T cells. Besides the interaction
of the peptide-Ag-MHC complex with the TCR, additional signals
delivered by costimulatory cell surface molecules are crucial for
effective lymphocyte activation. On the one hand, APC-derived
CD80 (B7-1) and CD86 (B7-2) provide important costimulatory
signals to augment and sustain T cell response via ligation with
CD28 (40). On the other hand, ligation of T cell-derived CD154
(CD40L) with CD40 activates APCs and induces their persistence
(41). We demonstrate that visfatin induces expression of the co-
stimulatory molecules CD80 (B7-1) and CD40 in human mono-
cytes. Moreover, we observed a significant induction of ICAM-1
(CD54), another costimulatory ligand that binds to LFA-1, thereby
FIGURE 8. Double-immunofluorescence microscopy on frozen sec-
tions of visceral adipose tissue and colonic wall from CD resections. Cel-
lular localization of visfatin was identified by indirect staining (red) to
identify visfatin
⫹
cell types. Cell nuclei are shown in blue (DAPI).
Costainings for identification of specific cell types are stained in green. A,
Visfatin
⫹
adipocytes (white arrows) of visceral fat from CD patients.
CD163 double-positive tissue macrophages (green to yellow; red ⫹
green ⫽ yellow; white arrowheads) reside within the adipose tissue next to
the adipocytes. B, CD163 double-positive tissue macrophages in the sub-
mucosa of the inflamed colonic wall. C, Cytokeratin 18 (CK18) double-
positive colonic epithelial cells from colonic crypts. D, CD209 (DC-SIGN)
double-positive DCs in the submucosa. E, CD3
⫹
T cells (green) adjacent
to visfatin single-positive cells (red). Some T cell are penetrating into
colonic crypts consisting of visfatin
⫹
epithelial cells. F, CD19 slightly
double-positive B cells of a submucosal secondary follicle. G, CD31
⫹
(PECAM) endothelial cells. H, MHC class II (MHC II) single- and double-
positive cells. Specificity of staining was confirmed by omitting the first Ab
(for visfatin) and isotype-matched irrelevant monoclonal control Abs for
all other Abs used (data not shown).
1756 VISFATIN AND INFLAMMATION
promoting the activation of T cells (42). Evidence that visfatin
affects primary lymphocyte responses was demonstrated by an in-
creased dose-dependent proliferative response after preincubating
monocytes with visfatin. Notably, visfatin was able to increase
significantly mannose receptor-mediated phagocytosis by human
monocytes. Altogether, we provide evidence that visfatin activates
APCs, up-regulates the expression of costimulatory molecules and
provokes an enhanced proliferative response in the MLR therefore
regulating and affecting these central immune functions. Finally, in
accordance with previous data (31), APCs might be a major source
of visfatin themselves as identified by immunofluorescence double
staining with macrophage and DC markers (CD163, DC-SIGN,
MHC class II
high
) in colonic tissue samples of IBD patients. Traf
-
ficking of cells to the sites of inflammation is another critical func-
tion of the immune system and largely orchestrated by chemokines
(43). We provide evidence that visfatin is a potent chemotactic
factor particularly for CD14
⫹
monocytes and CD19
⫹
B cells.
Various extracellular signals are integrated and processed by
MAPK cascades (44). p38 MAPK, ERK, and JNK are three dis-
tinct MAPK pathways. Our results indicate a central role for p38
and MEK-1 for visfatin-induced signal transduction. Visfatin has
originally been defined as cytokine which acts on pre-B cell for-
mation together with IL-7 (11). Notably, IL-7 is a key cytokine for
early B and T cell development (45) and recently Wan and co-
workers (46) demonstrated that p38 activation can be found upon
IL-7 stimulation. Further studies are required to exactly character-
ize a possible role of IL-7- and visfatin-induced p38 activation in
pre-B cell formation. NF-
B plays an important role in triggering
and coordinating immune responses including regulation of cyto-
kines like IL-1, IL-6, and TNF (47). Activators of NF-
B induce
rapid, I
B kinases dependent, phosphorylation, polyubiquitination,
and finally proteasomal degradation of I
B (48). Visfatin up-reg-
ulated NF-
B p65 (RelA) DNA-binding activity in human leuko-
cytes. However, it remains to be determined whether the observed
NF-
B activation is a direct effect or caused secondary due to
induction of other cytokines. Visfatin binds to and activates the
insulin receptor but insulin does not interact with its cytokine-
inducing effects (data not shown). Our observations support the
hypothesis that cytokine induction by visfatin might be induced by
engagement of another so far unidentified receptor (49). Treatment
of human monocytes with recombinant visfatin leads to p38- and
MEK-1-dependent induction of IL-1

, IL-6, and TNF-
␣
and iden-
tifies visfatin as a new upstream activator of these stress-activated
kinases.
When administered to mice, murine visfatin significantly in-
creased the level of circulating IL-6. We did not detect elevated
levels of TNF-
␣
or IL-1

after visfatin administration. Fukuhara
et al. (8) demonstrated that acute administration of recombinant
visfatin resulted in a significant fall of plasma glucose levels
within 30 min that quickly returned to control levels after 60 min.
Their results suggest a short plasma half-life for visfatin whose
biological activity might be regulated by enzymatic inactivation or
potential natural occurring antagonists that might be a rationale for
the comparably weak in vivo effects. The increase in IL-6 levels
was paralleled by an up-regulation of IL-6 mRNA levels in the
intestine that seemed to be the major source because no differences
were observed in liver, spleen, or lung. This result fits well with
our in vitro data in human leukocytes where IL-6 was the cytokine
most prominently up-regulated. Moreover, it is notable that IL-6
was the only cytokine found to be up-regulated in human macro-
phages and DCs after visfatin stimulation (Table III). IL-6 is
known to be a pleiotropic cytokine that is critically involved in a
variety of immunological processes, such as activation of acute
phase responses (50), hemopoiesis (51), final B cell maturation, T
cell activation and proliferation (52), induction of chemokines and
leukocyte recruitment (53), and liver and neuronal regeneration
(54, 55). Moreover, visfatin-induced IL-6 expression might be in-
volved in the pathogenesis of insulin resistance associated with
visceral obesity (56). IL-6 has been demonstrated to promote in-
sulin resistance via induction of suppressor of cytokine signaling
proteins (57). Our results raise the possibility that obesity-related
enhanced visfatin expression (8, 56) induces IL-6 production
which is likely to promote insulin resistance.
The proinflammatory cytokine IL-6 is also highly expressed in
patients with IBD (58). By binding to its soluble receptor IL-6 can
stimulate cells lacking the IL-6R. This IL-6 trans-signaling acti-
vates STAT3, bcl-2, and bcl-x
L
and mediates resistance of T cells
to apoptosis (34). Thus, we investigated the activation state of
visfatin in CD and UC. We observed significantly increased vis-
fatin serum levels in IBD patients compared with control subjects.
This is in accordance with recent reports that demonstrated high
circulating visfatin levels in rheumatoid arthritis and acute lung
injury (59, 60). Significantly higher visfatin mRNA expression in
inflamed IBD colonic biopsies suggests that the colonic mucosa is
a potential source of elevated visfatin plasma levels. By histolog-
ical examination, we identified potential cellular sources of visfatin
in inflamed colonic tissue that included APCs, like DCs and mac-
rophages, as well as epithelial cells. There are several reports dem-
onstrating enhanced tissue expression of visfatin in inflammatory
conditions including acute lung injury (60), clinical sepsis (31),
and severe generalized psoriasis (61). However, with serum con-
centrations between 1 and 3 ng/ml circulating visfatin levels are
low, even in patients with active IBD when compared with the
effective concentrations required for in vitro cytokine induction. It
remains to be established whether the enhanced tissue-specific vis-
fatin expression might be sufficient to propose a role for visfatin as
an autocrine/paracrine inflammatory cytokine. Visfatin was shown
to be more abundantly expressed in visceral compared with s.c.
adipose tissue (8). As expected, visfatin could be detected in adi-
pocytes of the mesenteric adipose tissue. Notably, adipose tissue-
infiltrating macrophages also stained positive for visfatin and
should be considered to contribute to the overall visfatin expres-
sion level at this location.
The functional profile of visfatin reported in this study would
suggest a potential role of this adipocytokine in the pathogen-
esis of inflammatory disorders. Further studies focusing on the
identification of a potential cellular receptor apart from the in-
sulin receptor and its pharmacological manipulation in experi-
mental and human disease will further illuminate the role of this
novel proinflammatory adipocytokine.
Disclosures
The authors have no financial conflict of interest.
References
1. Hotamisligil, G. S., N. S. Shargill, and B. M. Spiegelman. 1993. Adipose ex-
pression of tumor necrosis factor-
␣
: direct role in obesity-linked insulin resis-
tance. Science 259: 87–91.
2. Fain, J. N., A. K. Madan, M. L. Hiler, P. Cheema, and S. W. Bahouth. 2004.
Comparison of the release of adipokines by adipose tissue, adipose tissue matrix,
and adipocytes from visceral and subcutaneous abdominal adipose tissues of
obese humans. Endocrinology 145: 2273–2282.
3. Shimomura, I., T. Funahashi, M. Takahashi, K. Maeda, K. Kotani, T. Nakamura,
S. Yamashita, M. Miura, Y. Fukuda, K. Takemura, et al. 1996. Enhanced ex-
pression of PAI-1 in visceral fat: possible contributor to vascular disease in obe-
sity. Nat. Med. 2: 800 –803.
4. Friedman, J. M., and J. L. Halaas. 1998. Leptin and the regulation of body weight
in mammals. Nature 395: 763–770.
5. Maeda, K., K. Okubo, I. Shimomura, T. Funahashi, Y. Matsuzawa, and K.
Matsubara. 1996. cDNA cloning and expression of a novel adipose specific col-
lagen-like factor, apM1 (AdiPose Most abundant Gene transcript 1). Biochem.
Biophys. Res. Commun. 221: 286 –289.
1757The Journal of Immunology
6. Scherer, P. E., S. Williams, M. Fogliano, G. Baldini, and H. F. Lodish. 1995. A
novel serum protein similar to C1q, produced exclusively in adipocytes. J. Biol.
Chem. 270: 26746 –26749.
7. Steppan, C. M., S. T. Bailey, S. Bhat, E. J. Brown, R. R. Banerjee, C. M. Wright,
H. R. Patel, R. S. Ahima, and M. A. Lazar. 2001. The hormone resistin links
obesity to diabetes. Nature 409: 307–312.
8. Fukuhara, A., M. Matsuda, M. Nishizawa, K. Segawa, M. Tanaka, K. Kishimoto,
Y. Matsuki, M. Murakami, T. Ichisaka, H. Murakami, et al. 2005. Visfatin: a
protein secreted by visceral fat that mimics the effects of insulin. Science 307:
426 –430.
9. Sethi, J. K., and A. Vidal-Puig. 2005. Visfatin: the missing link between intra-
abdominal obesity and diabetes? Trends Mol. Med. 11: 344 –347.
10. Chen, M. P., F. M. Chung, D. M. Chang, J. C. Tsai, H. F. Huang, S. J. Shin, and
Y. J. Lee. 2006. Elevated plasma level of visfatin/pre-B cell colony-enhancing
factor in patients with type 2 diabetes mellitus. J. Clin. Endocrinol. Metab. 91:
295–299.
11. Samal, B., Y. Sun, G. Stearns, C. Xie, S. Suggs, and I. McNiece. 1994. Cloning
and characterization of the cDNA encoding a novel human pre-B-cell colony-
enhancing factor. Mol. Cell. Biol. 14: 1431–1437.
12. Martin, P. R., R. J. Shea, and M. H. Mulks. 2001. Identification of a plasmid-
encoded gene from Haemophilus ducreyi which confers NAD independence.
J. Bacteriol. 183: 1168–1174.
13. Muller, W. E., S. Perovic, J. Wilkesman, M. Kruse, I. M. Muller, and R. Batel.
1999. Increased gene expression of a cytokine-related molecule and profilin after
activation of Suberites domuncula cells with xenogeneic sponge molecule(s).
DNA Cell Biol. 18: 885– 893.
14. Fujiki, K., D. H. Shin, M. Nakao, and T. Yano. 2000. Molecular cloning and
expression analysis of the putative carp (Cyprinus carpio) pre-B cell enhancing
factor. Fish Shellfish Immunol. 10: 383–385.
15. Wang, T., X. Zhang, P. Bheda, J. R. Revollo, S. Imai, and C. Wolberger. 2006.
Structure of Nampt/PBEF/visfatin, a mammalian NAD
⫹
biosynthetic enzyme.
Nat. Struct. Mol. Biol. 13: 661–662.
16. Rongvaux, A., R. J. Shea, M. H. Mulks, D. Gigot, J. Urbain, O. Leo, and F.
Andris. 2002. Pre-B-cell colony-enhancing factor, whose expression is up-regulated
in activated lymphocytes, is a nicotinamide phosphoribosyltransferase, a cytosolic
enzyme involved in NAD biosynthesis. Eur. J. Immunol. 32: 3225–3234.
17. Kitani, T., S. Okuno, and H. Fujisawa. 2003. Growth phase-dependent changes in the
subcellular localization of pre-B-cell colony-enhancing factor. FEBS Lett. 544: 74 –78.
18. Wellen, K. E., and G. S. Hotamisligil. 2005. Inflammation, stress, and diabetes.
J. Clin. Invest. 115: 1111–1119.
19. Hotamisligil, G. S., P. Arner, J. F. Caro, R. L. Atkinson, and B. M. Spiegelman.
1995. Increased adipose tissue expression of tumor necrosis factor-
␣
in human
obesity and insulin resistance. J. Clin. Invest. 95: 2409 –2415.
20. Fried, S. K., D. A. Bunkin, and A. S. Greenberg. 1998. Omental and subcuta-
neous adipose tissues of obese subjects release interleukin-6: depot difference and
regulation by glucocorticoid. J. Clin. Endocrinol. Metab. 83: 847– 850.
21. Maeda, N., I. Shimomura, K. Kishida, H. Nishizawa, M. Matsuda, H. Nagaretani,
N. Furuyama, H. Kondo, M. Takahashi, Y. Arita, et al. 2002. Diet-induced insulin
resistance in mice lacking adiponectin/ACRP30. Nat. Med. 8: 731–737.
22. Wolf, A. M., D. Wolf, H. Rumpold, B. Enrich, and H. Tilg. 2004. Adiponectin
induces the anti-inflammatory cytokines IL-10 and IL-1RA in human leukocytes.
Biochem. Biophys. Res. Commun. 323: 630– 635.
23. La Cava, A., and G. Matarese. 2004. The weight of leptin in immunity. Nat. Rev.
Immunol. 4: 371–379.
24. Boyum, A. 1968. Separation of leukocytes from blood and bone marrow: intro-
duction. Scand. J. Clin. Lab. Invest. 97(Suppl.): 7.
25. Renard, P., I. Ernest, A. Houbion, M. Art, H. Le Calvez, M. Raes, and J. Remacle.
2001. Development of a sensitive multi-well colorimetric assay for active NF
B.
Nucleic Acids Res. 29: E21.
26. Mosheimer, B. A., N. C. Kaneider, C. Feistritzer, D. H. Sturn, and C. J.
Wiedermann. 2004. Expression and function of RANK in human monocyte che-
motaxis. Arthritis Rheum. 50: 2309 –2316.
27. Wabitsch, M., R. E. Brenner, I. Melzner, M. Braun, P. Moller, E. Heinze,
K. M. Debatin, and H. Hauner. 2001. Characterization of a human preadipocyte
cell strain with high capacity for adipose differentiation. Int. J. Obes. Relat.
Metab. Disord. 25: 8–15.
28. Hibi, M., A. Lin, T. Smeal, A. Minden, and M. Karin. 1993. Identification of an
oncoprotein- and UV-responsive protein kinase that binds and potentiates the
c-Jun activation domain. Genes Dev. 7: 2135–2148.
29. Gupta, S., D. Campbell, B. Derijard, and R. J. Davis. 1995. Transcription factor
ATF2 regulation by the JNK signal transduction pathway. Science 267: 389–393.
30. Amaravadi, R., and C. B. Thompson. 2005. The survival kinases Akt and Pim as
potential pharmacological targets. J. Clin. Invest. 115: 2618–2624.
31. Jia, S. H., Y. Li, J. Parodo, A. Kapus, L. Fan, O. D. Rotstein, and J. C. Marshall.
2004. Pre-B cell colony-enhancing factor inhibits neutrophil apoptosis in exper-
imental inflammation and clinical sepsis. J. Clin. Invest. 113: 1318–1327.
32. Ognjanovic, S., T. L. Ku, and G. D. Bryant-Greenwood. 2005. Pre-B-cell colony-
enhancing factor is a secreted cytokine-like protein from the human amniotic
epithelium. Am. J. Obstet. Gynecol. 193: 273–282.
33. Li, Q., and I. M. Verma. 2002. NF-
B regulation in the immune system. Nat. Rev.
Immunol. 2: 725–734.
34. Atreya, R., J. Mudter, S. Finotto, J. Mullberg, T. Jostock, S. Wirtz, M. Schutz,
B. Bartsch, M. Holtmann, C. Becker, et al. 2000. Blockade of interleukin 6 trans
signaling suppresses T-cell resistance against apoptosis in chronic intestinal in-
flammation: evidence in Crohn disease and experimental colitis in vivo. Nat.
Med. 6: 583–588.
35. Best, W. R., J. M. Becktel, J. W. Singleton, and F. Kern, Jr. 1976. Development
of a Crohn’s disease activity index: National Cooperative Crohn’s Disease Study.
Gastroenterology 70: 439 – 444.
36. Rachmilewitz, D. 1989. Coated mesalazine (5-aminosalicylic acid) versus sul-
phasalazine in the treatment of active ulcerative colitis: a randomised trial. Br.
Med. J. 298: 82–86.
37. Dinarello, C. A. 1996. Biologic basis for interleukin-1 in disease. Blood 87:
2095–2147.
38. Peters, M., S. Jacobs, M. Ehlers, P. Vollmer, J. Mullberg, E. Wolf, G. Brem,
K. H. Meyer zum Buschenfelde, and S. Rose-John. 1996. The function of the
soluble interleukin 6 (IL-6) receptor in vivo: sensitization of human soluble IL-6
receptor transgenic mice towards IL-6 and prolongation of the plasma half-life of
IL-6. J. Exp. Med. 183: 1399–1406.
39. Rothe, J., W. Lesslauer, H. Lotscher, Y. Lang, P. Koebel, F. Kontgen, A. Althage,
R. Zinkernagel, M. Steinmetz, and H. Bluethmann. 1993. Mice lacking the tu-
mour necrosis factor receptor 1 are resistant to TNF-mediated toxicity but highly
susceptible to infection by Listeria monocytogenes. Nature 364: 798 –802.
40. Lenschow, D. J., T. L. Walunas, and J. A. Bluestone. 1996. CD28/B7 system of
T cell costimulation. Annu. Rev. Immunol. 14: 233–258.
41. Miga, A. J., S. R. Masters, B. G. Durell, M. Gonzalez, M. K. Jenkins, C.
Maliszewski, H. Kikutani, W. F. Wade, and R. J. Noelle. 2001. Dendritic cell
longevity and T cell persistence is controlled by CD154-CD40 interactions. Eur.
J. Immunol. 31: 959–965.
42. Lebedeva, T., M. L. Dustin, and Y. Sykulev. 2005. ICAM-1 co-stimulates target
cells to facilitate antigen presentation. Curr. Opin. Immunol. 17: 251–258.
43. Esche, C., C. Stellato, and L. A. Beck. 2005. Chemokines: key players in innate
and adaptive immunity. J. Invest. Dermatol. 125: 615–628.
44. Kumar, S., J. Boehm, and J. C. Lee. 2003. p38 MAP kinases: key signalling
molecules as therapeutic targets for inflammatory diseases. Nat. Rev. Drug Dis-
cov. 2: 717–726.
45. Freeden-Jeffry, U., P. Vieira, L. A. Lucian, T. McNeil, S. E. Burdach, and R.
Murray. 1995. Lymphopenia in interleukin (IL)-7 gene-deleted mice identifies
IL-7 as a nonredundant cytokine. J. Exp. Med. 181: 1519–1526.
46. Wan, Y. Y., H. Chi, M. Xie, M. D. Schneider, and R. A. Flavell. 2006. The kinase
TAK1 integrates antigen and cytokine receptor signaling for T cell development,
survival and function. Nat. Immunol. 7: 851– 858.
47. Ghosh, S., and M. Karin. 2002. Missing pieces in the NF-
B puzzle. Cell
109(Suppl.): S81–S96.
48. Karin, M., and Y. Ben Neriah. 2000. Phosphorylation meets ubiquitination: the
control of NF-
B activity. Annu. Rev. Immunol. 18: 621– 663.
49. Stephens, J. M., and A. J. Vidal-Puig. 2006. An update on visfatin/pre-B cell
colony-enhancing factor, an ubiquitously expressed, illusive cytokine that is reg-
ulated in obesity. Curr. Opin. Lipidol. 17: 128–131.
50. Kishimoto, T., S. Akira, M. Narazaki, and T. Taga. 1995. Interleukin-6 family of
cytokines and gp130. Blood 86: 1243–1254.
51. Peters, M., A. M. Muller, and S. Rose-John. 1998. Interleukin-6 and soluble
interleukin-6 receptor: direct stimulation of gp130 and hematopoiesis. Blood 92:
3495–3504.
52. Kishimoto, T. 1989. The biology of interleukin-6. Blood 74: 1–10.
53. Romano, M., M. Sironi, C. Toniatti, N. Polentarutti, P. Fruscella, P. Ghezzi,
R. Faggioni, W. Luini, V. van Hinsbergh, S. Sozzani, et al. 1997. Role of IL-6
and its soluble receptor in induction of chemokines and leukocyte recruitment.
Immunity 6: 315–325.
54. Cressman, D. E., L. E. Greenbaum, R. A. DeAngelis, G. Ciliberto, E. E. Furth,
V. Poli, and R. Taub. 1996. Liver failure and defective hepatocyte regeneration
in interleukin-6-deficient mice. Science 274: 1379–1383.
55. Penkowa, M., M. Giralt, J. Carrasco, H. Hadberg, and J. Hidalgo. 2000. Impaired
inflammatory response and increased oxidative stress and neurodegeneration after
brain injury in interleukin-6-deficient mice. Glia 32: 271–285.
56. Berndt, J., N. Kloting, S. Kralisch, P. Kovacs, M. Fasshauer, M. R. Schon,
M. Stumvoll, and M. Bluher. 2005. Plasma visfatin concentrations and fat depot-
specific mRNA expression in humans. Diabetes 54: 2911–2916.
57. Senn, J. J., P. J. Klover, I. A. Nowak, T. A. Zimmers, L. G. Koniaris, R. W.
Furlanetto, and R. A. Mooney. 2003. Suppressor of cytokine signaling-3 (SOCS-
3), a potential mediator of interleukin-6-dependent insulin resistance in hepato-
cytes. J. Biol. Chem. 278: 13740–13746.
58. Gross, V., T. Andus, I. Caesar, M. Roth, and J. Scholmerich. 1992. Evidence for
continuous stimulation of interleukin-6 production in Crohn’s disease. Gastro-
enterology 102: 514 –519.
59. Otero, M., R. Lago, R. Gomez, F. Lago, C. Dieguez, J. J. Gomez-Reino, and
O. Gualillo. 2006. Changes in plasma levels of fat-derived hormones adiponectin,
leptin, resistin and visfatin in patients with rheumatoid arthritis. Ann. Rheum. Dis.
65: 1198 –1201.
60. Ye, S. Q., B. A. Simon, J. P. Maloney, A. Zambelli-Weiner, L. Gao, A. Grant,
R. B. Easley, B. J. McVerry, R. M. Tuder, T. Standiford, et al. 2005. Pre-B-cell
colony-enhancing factor as a potential novel biomarker in acute lung injury.
Am. J. Respir. Crit. Care Med. 171: 361–370.
61. Koczan, D., R. Guthke, H. J. Thiesen, S. M. Ibrahim, G. Kundt, H. Krentz,
G. Gross, and M. Kunz. 2005. Gene expression profiling of peripheral blood
mononuclear leukocytes from psoriasis patients identifies new immune regulatory
molecules. Eur. J. Dermatol. 15: 251–257.
1758 VISFATIN AND INFLAMMATION
