Influence of Genotype and Haplotype of MDR1 (C3435T, G2677A/T, C1236T) on the Incidence of Breast Cancer - a Case-Control Study in Jordan

Abstract

Background: Breast cancer is the leading cause of cancer death among women and the second in humans
worldwide. Many published studies have suggested an association between MDR1 polymorphisms and breast cancer risk. Our aim was to study the association between genetic polymorphism of MDR1 at three sites (C3435T, G2677A/T, and C1236T) and their haplotype and the risk of breast cancer in Jordanian females. Materials and Methods: A case-control study involving 150 breast cancer cases and 150 controls was conducted. Controls were age-matched to cases. The polymerase chain reaction/restriction fragment length polymorphism (PCR-RFLP) technique and sequencing were performed to analyse genotypes. Results: The distribution of MDR1 C3435T genotypes differed between cases and controls [cases, CC 45.3%, CT 41.3%, and TT 13.3%; controls, CC 13.4%, CT 43.3%, and TT 30.2%, p < 0.001]. Similarly, the distribution of G2677A/T significantly differed [cases, GG 43.1 %, GT+GA 50.9% and AA+TT 6%; controls, GG 29.6 %, GT+GA 50.9%, and AA+TT 19.4%, p = 0.004]. On the other hand, genotype and allelotype distribution of C1236T was not statistically different between cases and controls (p=0.56 and 0.26, respectively). The CGC haplotype increased the risk to breast cancer by 2.5-fold compared to others, while TGC and TTC haplotypes carried 2.5- and 5-fold lower risk of breast cancer, respectively. Conclusions: Genetic polymorphisms of MDR1 C3435T and G2677A/T, but not C1236T, are associated with increased risk of breast cancer. In addition, CGC, TGC and TTC haplotypes have different impacts on the risk of breast cancer. Future, larger studies are needed to validate these findings.

Full text

Asian Pacic Journal of Cancer Prevention, Vol 17, 2016 261
DOI:http://dx.doi.org/10.7314/APJCP.2016.17.1.261
MDR1 (C3435T, G2677A/T, C1236T) Genotype and Haplotypes and Incidence of Breast Cancer in Jordan
Asian Pac J Cancer Prev, 17 (1), 261-266
Introduction
Breast cancer is the most common type of cancer
among women (Kim et al., 2014; Payandeh et al., 2015).
Nearly 1.7 million new cases were diagnosed in 2012, and
over 508 000 women died in 2011 due to breast cancer
worldwide (Global Health Estimates, 2013). In Jordan,
breast cancer is the most common among cancers in
females, accounting for 37 % of all female cancers and for
19% of human cancer, and is the leading cause of cancer
deaths among Jordanian women(Al Rifai and Nakamura,
2015; Awwad et al., 2015). Breast cancer cells often spread
undetected by contiguity, lymph channels, and through the
blood early in the course of the disease. The most common
metastatic sites are lymph nodes, skin, bone, liver, lungs,
and brain (Kalinsky et al., 2015).
Numerous studies have inducted that the complex
interplay of genetics, environmental exposures, hormones,
and behaviours may predispose to breast cancer
Department of Biopharmaceutics and Clinical Pharmacy, Faculty of Pharmacy, the University of Jordan, Amman, Jordan *For
correspondence: mr_abuhaliema@yahoo.com
Abstract
Background: Breast cancer is the leading cause of cancer death among women and the second in humans
worldwide. Many published studies have suggested an association between MDR1 polymorphisms and breast
cancer risk. Our aim was to study the association between genetic polymorphism of MDR1 at three sites (C3435T,
G2677A/T, and C1236T) and their haplotype and the risk of breast cancer in Jordanian females. Materials and
Methods: A case-control study involving 150 breast cancer cases and 150 controls was conducted. Controls
were age-matched to cases. The polymerase chain reaction/restriction fragment length polymorphism (PCR-
RFLP) technique and sequencing were performed to analyse genotypes. Results: The distribution of MDR1
C3435T genotypes differed between cases and controls [cases, CC 45.3%, CT 41.3%, and TT 13.3%; controls,
CC 13.4%, CT 43.3%, and TT 30.2%, p < 0.001]. Similarly, the distribution of G2677A/T signicantly differed
[cases, GG 43.1 %, GT+GA 50.9% and AA+TT 6%; controls, GG 29.6 %, GT+GA 50.9%, and AA+TT 19.4%,
p = 0.004]. On the other hand, genotype and allelotype distribution of C1236T was not statistically different
between cases and controls (p=0.56 and 0.26, respectively). The CGC haplotype increased the risk to breast
cancer by 2.5-fold compared to others, while TGC and TTC haplotypes carried 2.5- and 5-fold lower risk of
breast cancer, respectively. Conclusions: Genetic polymorphisms of MDR1 C3435T and G2677A/T, but not
C1236T, are associated with increased risk of breast cancer. In addition, CGC, TGC and TTC haplotypes have
different impacts on the risk of breast cancer. Future, larger studies are needed to validate these ndings.
Keywords: Breast cancer - MDR1 - polymorphism - haplotype - Jordan
RESEARCH ARTICLE
Inuence of Genotype and Haplotype of MDR1 (C3435T,
G2677A/T, C1236T) on the Incidence of Breast Cancer - a
Case-Control Study in Jordan
Ali M Abuhaliema*, Al-Motassem F Yousef, Nirmeen N El-Madany, Nailya R
Bulatova, Nemah M Awwad, Muhammad A Yousef, Khalil Z Al Majdalawi
(Lecarpentier et al., 2015; Payandeh et al., 2015; Suan
et al., 2015). Many studies suggested that polymorphism
of multi-drug resistance 1 (MDR1) gene may modulate
the incidence of cancer risk (Zhu et al., 2013; de Oliveira
et al., 2014). MDR1 gene is a member of the ABC (ATP-
binding cassette) family that encodes a membrane-bound
phosphoglycoprotein (P-gp). The MDR1 gene is located
on chromosome 7 and contains 28 exons, and the coding
region that leads to change in protein sequence accounts
for less than 5% of the total (Ozdemir et al., 2013) . It acts
as an efux pump and provides cell protection against
various substances such as organic cations, amino acids,
polysaccharides, proteins, and some antibiotics (Kreile et
al., 2014; Pongstaporn et al., 2015). Accordingly, kidney,
adrenal gland, liver, blood-brain barrier, placenta, and
testis contain high amount of P-gp (Ozdemir et al., 2013).
It has been suggested that single nucleotide
polymorphisms (SNPs) of MDR1 could inuence the
level of expression of enhancer and promoter sequences

Ali M Abuhaliema et al
Asian Pacic Journal of Cancer Prevention, Vol 17, 2016
262
that may inuence the efcacy of processing of the pre-
mRNAs, and as a consequence, may inuence mRNA
stability(Ozdemir et al., 2013; Du et al., 2014). Modulation
of the P-gp transporting function may contribute to
mutagenesis through accumulation of exogenous toxins
and increase the risk of cancer development. Among
more than 50 SNPs identied in ABC gene, the most
clinically relevant SNPs are C3435T (rs1045642,
NC_000007.14; 87509329) in exon 26, G2677A/ T
in exon 21 (rs2032582, NC_000007.14; 87531302)
and C1236T (rs1128503, NC_000007.13; 87550285).
Synonymous SNPs as C3435T and C1236T decrease
the levels of mRNA expression and, hence, overall P-gp
activity (Pongstaporn et al., 2015), whereas, G 2677A/T
leads to change of alanine amino acid with serine or
threonine. Many studies discussed the relation between
the three SNPs and the incidence of breast cancer (Ji et al.,
2012; Tulsyan et al., 2014; Gutierrez-Rubio et al., 2015;
Kim et al., 2015). However, the ndings of these studies
are still inconclusive (Wang et al., 2013a; Gutierrez-Rubio
et al., 2015).
The aim of this study is to discuss the association
between genetic polymorphism of MDR1 at three sites
(C3435T, G2677A/T, and C1236T) and their haplotype
and the risk of breast cancer among Jordanian women.
Materials and Methods
Study population
A hospital-based study of 150 breast cancer (BC)
women and 150 age-matched healthy individuals was
conducted at Al-Basheer Hospital/Amman which is a
referral hospital for cancer patients. The study lasted
from the 15th of March till the 21st of December 2014.
The research was approved by the Ethics Committee
[Institutional Review Board, (IRB)] at Al-Basheer
Hospital in accordance with the ethical standards on
human experimentation (Institutional and National)
and with the Helsinki Declaration (IRB no. 17443,
28/11/2013). Each subject gave a sample of his/her blood
after detailed explanation of the purpose of the study
followed by obtaining an informed consent.
MDR1 Genotyping
Venous blood (4 mL) was collected from patients and
healthy subjects in K3EDTA-coated tubes. The tubes were
kept in icebox and DNA extraction was performed on the
same day using “DNA Genomic Wizard” purication
kit (Promega Corporation, Wisconsin, USA) according
to manufacturer’s instructions. Amplication of the 3
position was done using primers as shown in Table (1)
(Princess Haya Biotechnology Centre at the King Abdullah
University Hospital, Jordan University for Science and
Technology, Irbid, Jordan). The PCR conditions were: 4
minutes of initial denaturation at 95ºC, followed by 39
cycles of 95ºC for 15 seconds, 60ºC for 12 seconds, and
72ºC for 15 seconds, with a nal extension at 72ºC for
10 minutes (Bio-Rad, S1000 Thermal cycler™, USA).
The PCR products of C3435T were digested with
Dpn II restriction enzyme, the products of C1236T were
digested with Hae II, while the genotyping of G2677A/T
was done by DNA sequencing for all samples (BigDye
Terminator Cycle Sequencing on 3730xl DNA sequences,
Genewiz® Co., USA). The digestion fragment sizes for the
MDR1C3435T genotypes were: 93, 167, and 172 bp bands
for CC; 167, and 265 bp bands for TT; and 93, 167,172,
and 265 bp bands for CT, whereas for C1236T; 35, 87, and
199 bp bands for CC; 87, and 234 bp bands for TT; and
35, 87,199, and 234 bp bands for CT. Resulting fragments
were separated on 2% agarose gel electrophoresis and
visualized using RedSafe™ (New England Biolab, USA)
staining.
Findings of the PCR-RFLP were validated by the
following: 1) A negative control was run simultaneously
with every PCR run. A negative control contained all
PCR components except the DNA template; 2) 20 % of
all samples were repeated to conrm ndings of the PCR-
RFLP; 3) Randomly selected 10 % PCR-RFLP results
were conrmed by DNA sequencing. The concordance
between repeated samples, sequencing and PCR-RFLP
results was 100%.
Haplotype analysis
We analyzed the haplotype frequencies of the three
loci (C3435T, G2677A/T and C1236T) and compared
them between BC cases and controls. Haplotype
frequencies were calculated using Haploview software
for analysis and visualization of LD and haplotype
maps (Barrett et al., 2005), and Multiallelic Interallelic
Disequilibrium Analysis Software (MIDAS®, University
0
25.0
50.0
75.0
100.0
Newly diagnosed without treatment
Newly diagnosed with treatment
Persistence or recurrence
Remission
None
Chemotherapy
Radiotherapy
Concurrent chemoradiation
10.3
0
12.8
30.0
25.0
20.3
10.1
6.3
51.7
75.0
51.1
30.0
31.3
54.2
46.8
56.3
27.6
25.0
33.1
30.0
31.3
23.7
38.0
31.3
Table 1. Primer Sequences Used in Genotyping of MDR1 SNPs
SNP Positiona rs name Primers sequence Tm GC% PCR product size
C3435T 87509329 rs1045642 5’ACATGCTCCCAGGCTGTTTAT’3 59.71 47.62 432 bp
5’TGACAGTTCCTCAAGGCATACA’3 59.36 45.45
G2677T/A 87531302 rs2032582 5’TTTAGTTTGACTCACCTTCCCG’3 58.26 45.45 229 bp
5’TGTTTTGCAGGCTATAGGTGCC’3 61.2 50
C1236T 87550285 rs1128503 5’CTCGAAAAGAAGTTAAGGTACAGTG’3 57.89 40 321 bp
5’ATCTCACCATCCCCTCTGTG’3 58.5 55
a:NC_000007.14; Tm: melting temperature; bp: base pair
Table 2. Characteristics of BC Patients
Patient characteristic Mean ±SD or N (%)
Age, years 49.9±10.8
Median age at diagnosis( range), years 49 (23-74)
BMI, kg/m2 28.8 ± 6.3
Number of children 4.2 ± 3
Age at rst birth, years 19.4 ± 9.9
Nulliparous 22 (16.1)
Age at menarche, years 13.5 ± 1.6
Age at menopause, years 49.0 ± 4.6
SD: standard deviation; BMI: body mass index

Asian Pacic Journal of Cancer Prevention, Vol 17, 2016 263
DOI:http://dx.doi.org/10.7314/APJCP.2016.17.1.261
MDR1 (C3435T, G2677A/T, C1236T) Genotype and Haplotypes and Incidence of Breast Cancer in Jordan
of Southampton, Higheld, Southampton, UK) (Gaunt et
al., 2006) and linkage disequilibrium was represented by
Lewontin’s coefcient; D prime (D’), r2, and Chi square.
Statistical analysis
Data were coded and entered into SPSS software
version 16 (Chicago, IL). Data of categorical nature were
summarized as counts and percentages. Data of continuous
nature were summarized as mean ± standard deviation.
The relation between categorical vs. categorical variables
were evaluated by Chi-square or Fisher exact test as
appropriate. The strength of association was assessed by
calculating odds ratio (OR) and 95% condence interval
(95% CI) (Cochran, 1954). The relationship between
categorical and continuous variables were evaluated
by independent sample t-test, ANOVA, Mann Whitney
or Kruskal Wallis tests as appropriate. Normality of
distribution was assessed by Kolmogorov-Smirnov
or Shapiro-Wilk test as appropriate. Homogeneity of
variance was evaluated by Levene’s test. A p value<0.05
was considered statistically signicant. Hardy-Weinberg
Equilibrium was assessed for genotypes assuming degree
of freedom =1 (Rodriguez et al., 2009).
Results
A total of 150 breast cancer patients and 150 control
subjects were included in this study. BC patients and
control groups were of the same age (49.9±10.8 years).
Among BC patients, the median age at diagnosis was
49 years, that at menarche was 13.5±1.6 years and
at menopause 49±4.6 years. Table 2 summarizes the
demographic and clinical characteristicsof BC patients.
Genotype distribution
Study of MDR1 C3435T polymorphism revealed
that the homozygote mutant type was found in 13.3%
among cases, while among controls wild 30.2%, and
higher prevalence of wild type in BC patients compared to
controls (p < 0.001). Subjects with (C3435T) T allele were
2 time less likely to suffer from breast cancer (p< 0.0001).
As for G2677A/T polymorphism, the prevalence of wild
type (GG) was higher among cases compared to controls
[50 (43.1%) vs 32 (29.6%), respectively], while the mutant
type (AA+TT) was lower in BC [7(6%) vs 21 (19.4%) in
controls], (p = 0.004). On the other hand, genotype and
allelotype distribution of C1236T was not signicantly
different between cases and controls (p=0.56) (Table 3).
MDR1 Haplotype
The most common haplotypes were CGC and TTT,
while the least common haplotypes were TTC and CTC
among both cases and controls. Three haplotypes were
distributed differently between cases and controls. CGC
haplotype is associated with 2-fold increase in the risk
of breast cancer compared to others [OR=2.5, 95%CI
(1.8-3.6), p <0.001] while the TGC and TTC haplotypes
were protective. Carriers of TGC had 2.5times lower
risk of breast cancer compared to others [OR=0.4, 95%
CI (0.2-0.7), p <0.001], while carriers of TTC haplotype
had 5 times lower risk of breast cancer [OR=0.2, 95%CI
(0.08-0.7), p=0.007]. Table 4 summarises the association
between haplotypes and incidence of breast cancer.
Additionally, every two SNPs were analyzed together.
Considering C3435T and G2677A/T haplotypes, patients
who carry CT and TG haplotype were 5 times less likely to
develop breast cancer than those who carry CG haplotypes.
Considering C3435T and C1236T haplotypes, patients
who carry TC haplotype were 6.4 times less likely to
develop breast cancer than those who carry CC haplotypes.
Regarding G2677A/T and C1236T haplotypes, patients
who carry TC haplotypes are 10.6 times less likely to
develop breast cancer than those carrying GC haplotypes.
Table 3. MDR1 Genotype and Allelotype Distribution among Cases and Controls
Variables Genotypes Alleles
Cases Controls P OR Allele Cases, Controls, P OR (95% CI)
N (%) N (%) (95% CI) N (%) N (%)
MDR1 C3435T 150 150 < 0.0001 C 198 (66) 145 (48.3) < 0.0001 2(1.49- 2.88)
CC 68 (45.3) 40 (26.7) 2.28(1.41-3.70)
CT 62 (41.3) 65 (43.3) 0.92(0.58-1.45) T 102 (34) 155 (51.7)
TT 20 (13.3) 45 (30) 0.36(0.19-0.65)
MDR1 G2677A/T 116 108 0.004 G 159(67.3) 119(55.1) 0.026 1.68(1.15- 2.46)
GG 50(43.1) 32(29.6) 1.79(1.03-3.12)
GT+AT 59(50.9) 55(50.9) 0.99(0.59-1.68) T 73(31) 93(43.1) 0.59(0.4-0.87)
AA+TT 7(6.0) 21(19.4) 0.26(0.11-0.65) A 4(1.7) 4(1.8) 0.91(0.23-3.69)
MDR1 C1236T 148 126 0.56 C 169 (57.1) 132 (52.4) 0.26 1.2(0.86-1.7)
CC 56(37.8) 40(31.7) 1.3(0.79-2.16)
CT 57(38.5) 52(41.3) 0.89(0.55-1.44) T 127 (42.9) 120 (47.6)
TT 35(23.6) 34(27) 0.83(0.48-1.44)
N: sample size; P: P value based on chi square or sher exact test; OR: odd ratio; CI: Condence Interval
Table 4. Haplotype Distribution of MDR1 3435, 2677,
and 1236 among Cases and Controls
Haplotype total Cases, Controls, OR
(%) N=300 N=286 (95% CI)
C3435T-G2677A/T-C1236T N (%) N (%)
CGC 35 135 (45) 70 (24.4) 2.5 (1.8-3.6)
TTT 19 54 (18) 57 (20) 0.9 (0.6-1.3)
CTT 13.9 37 (12.4) 45 (15.6) 0.8 (0.5-1.2)
TGC 13.9 25 (8.4) 55 (19.4) 0.4 (0.2-0.7)
TGT 6.4 18 (6) 20 (6.9) 0.8 (0.4-1.6)
CGT 5.8 21 (7) 13 (4.5) 1.6 (0.8-3.2)
TTC 3.2 4 (1.3) 15 (5.2) 0.2 (0.08-0.7)
CTC 2.8 5 (1.6) 12 (4.2) 0.4 (0.1-1.1)
N: No of chromosomes; OR: odd ratio; CI: Condence Interval

Ali M Abuhaliema et al
Asian Pacic Journal of Cancer Prevention, Vol 17, 2016
264
The strongest linkage disequilibrium (LD) was
observed between SNPs at 2677 and 1236 in cases and
controls [cases: D’=0.92; controls: D’=0.54] (Table 5).
The linkage disequilibrium was signicant between all
pairs of SNPs among cases but not among controls.
Discussion
MDR1 gene is a member of the ABC family that
encodes P-gp, an ATP-dependent efux pump that helps
the cell to get rid of toxins and exogenous materials (Kreile
et al., 2014). Many studies suggested that polymorphism
of MDR1 gene may modulate risk of breast cancer due
to the absence of protective effect provided by this pump
(Ikeda et al., 2015). We studied the association between
genetic polymorphism of MDR1 and the risk of breast
cancer among Jordanian patients.
Our results indicate that C3435T CC genotype is
signicantly associated with increased risk of breast
cancer. Zubor et al. (2007), reported that, among patients
in Slovak Republic, those carrying CC genotype of
C3435T had increased risk of breast cancer. In a study by
Macias-Gomez et al. (2014) conducted among Mexicans
the prevalence of the TT genotype was 8% for patients
with brocystic changes (FCC), 13% for inltrating ductal
breast cancer (IDBC) and 24% for control samples.
In a meta-analysis published in 2012 that involved 7
studies, MDR1 C3435T polymorphism was signicantly
associated with increased risk of breast cancer (TT vs
CC, OR = 1.66, 95% CI (1.24-2.21) (Wang et al., 2012).
A meta-analysis published in 2013 based on 52 studies,
included 9 studies that analysed the association of breast
cancer and C3435T polymorphism showed similar results
[TT vs CC: OR=1.18, 95%CI (0.869-1.621), p=0.001]
(Wang et al., 2013b). There are some limitations in this
meta-analysis including asymmetry of its funnel plot
suggesting potential publication bias, a language bias,
and lack of publication of trials with opposite results. The
pre-existing publication bias would question the ndings
of this meta-analysis. Additionally, this meta-analysis
suffered from signicant heterogeneity.
On the other hand, a meta-analysis conducted in 2011
did not nd any association between MDR1 C3435T
polymorphism and risk of breast cancer (Lu et al., 2011).
Fawzy et al. (2014) studied 190 Egyptian females with
breast cancer and showed that the frequency of TT
genotype of C3435T and T allele were significantly
higher in breast cancer patients compared to the controls
(P < 0.05) while no signicant differences were found
between the frequencies of MDR1 G2677A/T and C1236T
genotypes and haplotypes.
The conicting results of many studies may be caused
by multi gene interactions. It may be assumed that TT
genotype leads to defect in P-gp function resulting
in increasing drug accumulation inside the cells, and
resistance to the chemotherapy, though it may be a
consequence from other mechanisms. On the other hand,
in patients with the CC genotype, there might be a strong
linkage disequilibrium with other polymorphisms in the
MDR1 gene as well as alterations in the post translational
pathway which inuences the efcacy and stability of
P-gp.
Genotypes distribution of C3435T vary widely
among different populations. In Caucasians, the 3435
frequency was reported as CC (22%), CT (50%), and TT
(28%) (Hamidovic et al., 2010). In a study conducted
among Spanish breast cancer patients MDR1 C3435T
allele distribution was (C) 0.52 and (T) 0.48 which
were not different from controls, while genotypes were
distributed as CC 14 (28%), CT 24 (48%) and TT 12
(24%) (Henriquez-Hernandez et al., 2009). On the other
hand, in Korean population, CC, CT, and TT genotypes
were found in 50.9%, 10.2%, and 38.9% BC patients,
respectively. A study conducted among Jordanian and
Sudanese population by Salem, et al (2014) reported that T
allele was more prevalent among Jordanians than C allele
(CC: 20.7%, CT: 51.7%, TT: 27.6%; C: 47%, T: 53%).
Jordanians resembled Asians and Europeans but were
different signicantly from Africans (Salem et al., 2014).
Our results indicate that the wild type of 2677G
polymorphism is associated with increased risk of breast
cancer. These ndings are concordant with those in a study
by Rubis et al. (2012) that involved 209 patients and 202
controls from Poland [cases: GG = 43.5, GT+GA = 44.5
and AA+TT = 12%; controls: GG = 34%, GT+GA = 52.5%
and AA+TT = 13.5%]. On the other hand, six studies (2
involving BC patients and 4 involving patients with all
cancers) from seventeen studies that evaluated G2677A/T
polymorphism that were included in a meta-analysis
revealed TT genotypes of G2677A/T to be associated
with cancer risk in general (Wang et al., 2013a). Wu et al.
(2012), reported that T allele of G2677A/T carried 1.83
higher risk of developing breast carcinoma.
Regarding C1236T polymorphism, our results showed
no signicant association with the incidence of breast
cancer. These ndings are consistent with a recent meta-
analysis, which reported lack of association between
C1236T genetic polymorphism and the incidence of cancer
in general (Wang et al., 2013a). In a study conducted by
Alsaif et al. (2013) indicated that C1236T CC genotype is
protective against breast cancer, while mutant genotypes
of CT, and TT were more prevalent in cases compared to
controls (p < 0.001). Gutierrez-Rubio et al. (2015), a study
involved BC patients reported C1236T CT genotype is
protective against breast cancer.
Little is known regarding the inuence of MDR1
C3435T- G2677A/T- C1236T haplotypes in terms of
the potential impact on risk of breast cancer. Our results
revealed that CGC, TGC and TTC haplotypes strongly
modulate the risk of breast cancer. CGC haplotype
increases the risk to breast cancer by 2.5 folds compared
to others while, TGC and TTC haplotypes were protective
Table 5. Haplotype Distribution for Each two SNPs
Variable Cases Controls
Haplotype D’ r2 X2 D’ r 2 X2
3435-2677 0.6 0.31 36.6 0.05 0.002 0.21
3435-1236 0.57 0.22 32.4 0.004 0 0.0017
2677-11236 0.92 0.52 60.6 0.54 0.29 26.11
D’: theoretical range of the linkage disequilibrium coefcient; r2: the
square of the correlation coefcient between two indicator variables;
X2: Chi-Squared with one degree of freedom

Asian Pacic Journal of Cancer Prevention, Vol 17, 2016 265
DOI:http://dx.doi.org/10.7314/APJCP.2016.17.1.261
MDR1 (C3435T, G2677A/T, C1236T) Genotype and Haplotypes and Incidence of Breast Cancer in Jordan
against breast cancer. On the other hand, Wu et al. (2012)
reported that TTT haplotype is signicantly increases the
risk of breast carcinoma. The frequencies of haplotypes
reported in this study are in line with a recently published
MDR1 haplotypes among apparently healthy Jordanians
by Al-Diab et al. (2015) with the most prominent haplotype
being CGC (37.6%), followed by TTT (18.6%), and the
least frequent haplotype being CTC (1.8%).
Acknowledgements
The authors would like to thank the staff nurses and
physicians of the Oncology Department at Al-Basheer
Hospital for their huge assistance and patience. The
authors would like to extend their gratitude to all the
research participants for their wonderful participation
and cooperation. This study was supported, in part, by
unconditional grant from the Deanship of Scientific
Research (The University of Jordan, Jordan).
References
Al-Diab O, Yousef A-M, Al Manassrah E, et al (2015). Genotype
and Haplotype analysis of ABCB1 at 1236, 2677 and 3435
among Jordanian population. Trop J Pharm Res, 14, 1013-9.
Al Rifai RO, Nakamura K (2015). Differences in breast and
cervical cancer screening rates in Jordan among Women
from different socioeconomic strata: analysis of the 2012
population-based household survey. Asian Pac J Cancer
Prev, 16, 6697-704.
Alsaif AA, Hasan TN, Sha G, et al (2013). Association of
multiple drug resistance-1 gene polymorphism with multiple
drug resistance in breast cancer patients from an ethnic Saudi
Arabian population. Cancer Epidemiol, 37, 762-6.
Awwad N, Yousef AM, Abuhaliema A, et al (2015). Relationship
between Genetic Polymorphisms in MTHFR (C677T,
A1298C and their Haplotypes) and the Incidence Of Breast
Cancer among Jordanian Females--Case-Control Study.
Asian Pac J Cancer Prev, 16, 5007-11.
Barrett JC, Fry B, Maller J, et al (2005). Haploview: analysis
and visualization of LD and haplotype maps. Bioinformatics,
21, 263-5.
Cochran G (1954). Some methods for strengthening the common
χ tests. Biometrics, 10, 417-51.
de Oliveira J, Felipe AV, Neto RA, et al (2014). Association
between ABCB1 immunohistochemical expression and
overall survival in gastric cancer patients. Asian Pac J
Cancer Prev, 15, 6935-8.
Du Y, Su T, Zhao L, et al (2014). Associations of polymorphisms
in DNA repair genes and MDR1 gene with chemotherapy
response and survival of non-small cell lung cancer.
Fawzy MS, Awad HA, Ahmad HS, et al (2014). Multi-drug
resistance 1 genetic polymorphisms gene expression and
prediction of chemotherapy response in breast cancer
Egyptian patients. Egypt J Biochem Mol Biol, 32, 75-98.
Gaunt TR, Rodriguez S, Zapata C, et al (2006). MIDAS: software
for analysis and visualisation of interallelic disequilibrium
between multiallelic markers. BMC Bioinformatics, 7, 227.
Global Health Estimates, WHO. 2013. [Accessed 14 June 2015].
Gutierrez-Rubio SA, Quintero-Ramos A, Duran-Cardenas A,
et al (2015). 1236 C/T and 3435 C/T polymorphisms of the
ABCB1 gene in Mexican breast cancer patients. Genet Mol
Res, 14, 1250-9.
Hamidovic A, Hahn K, Kolesar J (2010). Clinical signicance
of ABCB1 genotyping in oncology. J Oncol Pharm Pract,
16, 39-44.
Henriquez-Hernandez LA, Murias-Rosales A, Hernandez
Gonzalez A, et al (2009). Gene polymorphisms in TYMS,
MTHFR, p53 and MDR1 as risk factors for breast cancer:
a case-control study. Oncol Rep, 22, 1425-33.
Ikeda M, Tsuji D, Yamamoto K, et al (2015). Relationship
between ABCB1 gene polymorphisms and severe
neutropenia in patients with breast cancer treated with
doxorubicin/cyclophosphamide chemotherapy. Drug Metab
Pharmacokinet, 30, 149-53.
Ji M, Tang J, Zhao J, et al (2012). Polymorphisms in genes
involved in drug detoxication and clinical outcomes of
anthracycline-based neoadjuvant chemotherapy in Chinese
Han breast cancer patients. Cancer Biol Ther, 13, 264-71.
Kalinsky K, Mayer JA, Xu X, et al (2015). Correlation of
hormone receptor status between circulating tumor cells,
primary tumor, and metastasis in breast cancer patients. Clin
Transl Oncol, 17, 539-46.
Kim HJ, Im SA, Keam B, et al (2015). ABCB1 polymorphism
as prognostic factor in breast cancer patients treated with
docetaxel and doxorubicin neoadjuvant chemotherapy.
Cancer Sci, 106, 86-93.
Kim JL, Cho KH, Park EC, et al (2014). A single measure of
cancer burden combining incidence with mortality rates for
worldwide application. Asian Pac J Cancer Prev, 15, 433-9.
Kreile M, Rots D, Piekuse L, et al (2014). Lack of association
between polymorphisms in genes MTHFR and MDR1 with
risk of childhood acute lymphoblastic leukemia. Asian Pac
J Cancer Prev, 15, 9707-11.
Lecarpentier J, Nogues C, Mouret-Fourme E, et al (2015). Breast
cancer risk associated with estrogen exposure and truncating
mutation location in BRCA1/2 Carriers. Cancer Epidemiol
Biomarkers Prev, 24, 698-707.
Lu PH, Wei MX, Yang J, et al (2011). Association between two
polymorphisms of ABCB1 and breast cancer risk in the
current studies: a meta-analysis. Breast Cancer Res Treat,
125, 537-43.
Macias-Gomez NM, Gutierrez-Angulo M, Leal-Ugarte E, et al
(2014). MDR1 C3435T polymorphism in Mexican patients
with breast cancer. Genet Mol Res, 13, 5018-24.
Ozdemir S, Uludag A, Silan F, et al (2013). Possible roles of
the xenobiotic transporter P-glycoproteins encoded by the
MDR1 3435 C>T gene polymorphism in differentiated
thyroid cancers. Asian Pac J Cancer Prev, 14, 3213-7.
Payandeh M, Sadeghi M, Sadeghi E (2015). Differences in
prognostic factors between early and late recurrence breast
cancers. Asian Pac J Cancer Prev, 16, 6575-9.
Pongstaporn W, Pakakasama S, Chaksangchaichote P, et al
(2015). MDR1 C3435T and C1236T polymorphisms:
association with high-risk childhood acute lymphoblastic
leukemia. Asian Pac J Cancer Prev, 16, 2839-43.
Rodriguez S, Gaunt TR, Day IN (2009). Hardy-Weinberg
equilibrium testing of biological ascertainment for
Mendelian randomization studies. Am J Epidemiol, 169,
505-14.
Rubis B, Holysz H, Barczak W, et al (2012). Study of ABCB1
polymorphism frequency in breast cancer patients from
Poland. Pharmacol Rep, 64, 1560-6.
Salem AH, Ali M, Ibrahim A, et al (2014). Genotype and Allele
Frequencies of MDR-1 Gene Polymorphism in Jordanian
and Sudanese Populations. American Journal of Medicine
Studies, 2, 19-23.
Suan SN, Masroor I, Mirza W, et al (2015). Evaluation of
common risk factors for breast carcinoma in females: a
hospital based study in karachi, Pakistan. Asian Pac J Cancer
Prev, 16, 6347-52.
Tulsyan S, Chaturvedi P, Singh AK, et al (2014). Assessment

Ali M Abuhaliema et al
Asian Pacic Journal of Cancer Prevention, Vol 17, 2016
266
0
25.0
50.0
75.0
100.0
Newly diagnosed without treatment
Newly diagnosed with treatment
Persistence or recurrence
Remission
None
Chemotherapy
Radiotherapy
Concurrent chemoradiation
10.3
0
12.8
30.0
25.0
20.3
10.1
6.3
51.7
75.0
51.1
30.0
31.3
54.2
46.8
56.3
27.6
25.0
33.1
30.0
31.3
23.7
38.0
31.3
0
25.0
50.0
75.0
100.0
Newly diagnosed without treatment
Newly diagnosed with treatment
Persistence or recurrence
Remission
None
Chemotherapy
Radiotherapy
Concurrent chemoradiation
10.3
0
12.8
30.0
25.0
20.3
10.1
6.3
51.7
75.0
51.1
30.0
31.3
54.2
46.8
56.3
27.6
25.0
33.1
30.0
31.3
23.7
38.0
31.3
of clinical outcomes in breast cancer patients treated with
taxanes: multi-analytical approach. Gene, 543, 69-75.
Wang J, Wang B, Bi J, et al (2012). MDR1 gene C3435T
polymorphism and cancer risk: a meta-analysis of 34 case-
control studies. J Cancer Res Clin Oncol, 138, 979-89.
Wang LH, Song YB, Zheng WL, et al (2013a). The association
between polymorphisms in the MDR1 gene and risk of
cancer: a systematic review and pooled analysis of 52 case-
control studies. Cancer Cell Int, 13, 46.
Wang Z, Wang T, Bian J (2013b). Association between MDR1
C3435T polymorphism and risk of breast cancer. Gene,
532, 94-9.
Wu H, Kang H, Liu Y, et al (2012). Roles of ABCB1 gene
polymorphisms and haplotype in susceptibility to breast
carcinoma risk and clinical outcomes. J Cancer Res Clin
Oncol, 138, 1449-62.
Zhu CY, Lv YP, Yan DF, et al (2013). Knockdown of MDR1
increases the sensitivity to adriamycin in drug resistant
gastric cancer cells. Asian Pac J Cancer Prev, 14, 6757-60.
Zubor P, Lasabova Z, Hatok J, et al (2007). A polymorphism
C3435T of the MDR-1 gene associated with smoking or
high body mass index increases the risk of sporadic breast
cancer in women. Oncol Rep, 18, 211-7.