Content uploaded by Akua Obeng Forson
Author content
All content in this area was uploaded by Akua Obeng Forson on Aug 26, 2022
Content may be subject to copyright.
This article appeared in a journal published by Elsevier. The attached
copy is furnished to the author for internal non-commercial research
and education use, including for instruction at the authors institution
and sharing with colleagues.
Other uses, including reproduction and distribution, or selling or
licensing copies, or posting to personal, institutional or third party
websites are prohibited.
In most cases authors are permitted to post their version of the
article (e.g. in Word or Tex form) to their personal website or
institutional repository. Authors requiring further information
regarding Elsevier’s archiving and manuscript policies are
encouraged to visit:
http://www.elsevier.com/copyright
Author's personal copy
Antibiotic resistance, phylogenetic grouping and virulence potential
of Escherichia coli isolated from the faeces of intensively farmed and
free range poultry
Akua Serwaah Obeng
a,b
, Heather Rickard
a
, Olasumbo Ndi
a,b
, Margaret Sexton
c
,
Mary Barton
a,b,
*
a
School of Pharmacy and Medical Sciences, University of South Australia, Adelaide, South Australia, Australia
b
Sansom Institute, University of South Australia, Adelaide, South Australia, Australia
c
Biosecurity SA, Primary Industries and Resources SA, Glenside, South Australia, Australia
1. Introduction
Transfer of antimicrobial resistant strains of Escherichia
coli to the food chain from chickens is a well-recognised
phenomenon (Hammerum and Heuer, 2009). Of special
interest are avian pathogenic strains (APEC) that cause
cellulitis, septicaemia and colibacillosis in poultry as well
as being linked to extra-intestinal pathogenic E. coli
(ExPEC) stains in humans (Ewers et al., 2009). These
Veterinary Microbiology 154 (2012) 305–315
ARTICLE INFO
Article history:
Received 18 November 2010
Received in revised form 4 June 2011
Accepted 12 July 2011
Keywords:
Intensive meat chickens
Free range egg layers
Resistance genes
Escherichia coli
ABSTRACT
Antibiotic use in poultry production is a risk factor for promoting the emergence of resistant
Escherichia coli.To ascertain differences in differentclasses of chickens, the resistanceprofile,
some virulence genes and phylogenetic grouping on 251 E. coli isolates from intensive meat
(free range and indoor commercial) and free range egg layer chickens collected between
December 2008 and June 2009 in South Australia were performed. Among the 251 strains,
102 (40.6%) and 67 (26.7%) were found to be resistant to tetracycline and ampicillin
respectively. Resistance was also observed to trimethoprim-sulfamethoxazole (12.4%),
streptomycin (10.8%), spectinomycin (9.6%), neomycin (6.0%) and florfenicol (2.0%) but no
resistance was found to ceftiofur, ciprofloxacin or gentamicin. Amplification of DNA of the
isolates by polymerase chain reaction revealed the presence of genes that code for resistant
determinants: tetracycline (tet(A), tet(B) and tet(C)), ampicillin (bla
TEM
and bla
SHV
),
trimethoprim (dhfrV and dhfrXIII), sulphonamide (sulIandsulII), neomycin (aph(3)-
Ia(aphA1)), and spectinomycin–streptinomycin (aadA2). In addition, 32.3–39.4% of the
isolates were found to belong to commensal groups (A and B1) and 11.2–17.1% belonged to
the virulent groups (B2 and D). Among the 251 E. coli isolates,25 (10.0%) carried two or more
virulence genes typical of Extraintestinal pathogenic E. coli (ExPEC). Furthermore, 17 of the
isolates with multi-resistance were identified to be groups B2 and D. Although no significant
difference was observed between isolates from free range and indoor commercial meat
chickens (P>0.05), significant differences was observed between the different classes of
meat chickens (freerange and indoor commercial) and egg layers (P<0.05). While this study
assessed the presence of a limited number of virulence genes, our study re emphasises the
zoonotic potential of poultry E. coli isolates.
ß2011 Published by Elsevier B.V.
* Corresponding author at: Sansom Institute, School of Pharmacy and
Medical Sciences, University of South Australia, Frome Road, GPO Box
2471, Adelaide, South Australia 5000, Australia. Tel.: +61 8 8302 2933;
fax: +61 8 8302 2389.
E-mail address: mary.barton@unisa.edu.au (M. Barton).
Contents lists available at ScienceDirect
Veterinary Microbiology
journal homepage: www.elsevier.com/locate/vetmic
0378-1135/$ – see front matter ß2011 Published by Elsevier B.V.
doi:10.1016/j.vetmic.2011.07.010
Author's personal copy
ExPEC isolates are characterised by virulence factors that
enable these strains to cause diseases outside the intestinal
tract (Johnson and Russo, 2002). Thus if APECs are resistant
to antimicrobial agents, transfer of antimicrobial resistant
strains via the food chain can have implications for
treatment of urinary tract and other extra-intestinal
infections as well as the established concern about
compromised therapy for salmonellosis and other enteric
infections. Thus it is relevant to evaluate if any changes
have occurred in the resistance profile of avian strains of E.
coli over recent years
In the last 10 years, antibiotic usage in livestock
industries has changed, with use of antimicrobials as
growth promotants banned or severely constrained. This
has lead to distinctive differences between countries in
regard to prevalence (Aarestrup et al., 1998; Adelaide et al.,
2008; Gyles, 2008; Persoons et al., 2010; van den Bogaard
et al., 2001). However these studies assessed antimicrobial
resistance of E. coli isolates from healthy meat chickens
rather than APEC strains or strains from different classes of
chickens (free range and meat chickens). There are few
published studies on selected groups of chickens; Miranda
et al. (2008) reported less resistance in organic poultry
meat, but van den Bogaard et al. (2001) and Ojeniyi (1985)
have reported more widespread resistance in isolates from
meat chickens and free range egg layers from Netherlands
and Africa, respectively. With layer hens, Musgrove et al.
(2006) reported low levels of resistance to tetracycline and
negligible resistance to streptomycin and gentamicin in E.
coli on egg shells. In relation to human infections, Johnson
et al. (2007) reported that antimicrobial resistant human
faecal isolates were very similar to resistant APEC isolates
from chickens in terms of phylogenetic grouping and
virulence genes detected
This study compares resistance patterns and phyloge-
netic profiles of intensive and free-range meat chickens
and free-range layers in relation to phylogenetic types and
phenotypic and genotypic resistance profiles.
2. Materials and methods
2.1. Bacterial culture
A total of 311 faecal samples were sourced from
selected farms (3) and abattoirs (3) in Adelaide, South
Australia between December 2008 and June 2009: 155
from free range meat chickens, 69 from free range egg layer
chickens and 87 from indoor commercial chickens. Faecal
droppings were randomly collected from selected flocks
from each study site into sterile containers using sterile
swab sticks and transported on ice to laboratory within 2 h.
Approximately 1 g of each faecal sample was inoculated
into 10 ml Gram Negative Broth (Oxoid) and incubated
aerobically at 37 8C for 18–24 h. A loopful of the broth was
subcultured onto MacConkey agar (Oxoid) and incubated
aerobically for 18–24 h at 37 8C. From each plate, a single
colony of typical morphology was picked, subcultured onto
5% horse blood agar (HBA) for purity and biochemical
testing. Pure cultures identified to be urease negative and
indole positive by Urea Motility Indole (UMI) medium,
oxidase negative and positive with Triple Sugar Iron (TSI)
agar were identified as E. coli. The strains were stored snap
frozen in glycerol broth at 70 8C for subsequent
phylogenetic grouping, virulence factors (VFs) determina-
tion, antimicrobial susceptibility testing and resistance
gene identification.
2.2. DNA extraction
A single colony of a fresh bacterial culture from 5% HBA
was picked and resuspended in 200
m
l of sterile milliQ
water. Tubes were heated at 98 8C for 10 min and
subsequently centrifuged at 17 900 gfor 5 min. The
supernatant were recovered and 2
m
l of this was used as a
template in the various polymerase chain reactions (PCR).
2.3. Phylogenetic grouping
The E. coli isolates were phylogenetically grouped into A,
B1, B2 or D using the triplex PCR reaction (Clermont et al.,
2000). Each reaction consisted of 4 mM MgCl
2
,1
m
lof
25 pmol of each primer (TSPE4.C2, chuA and yjaA), 2
m
lof
2mM dNTPs and 5
m
l5PCR buffer, 1U of Taq DNA
polymerase (Bioline, Australia), in a total reaction volume of
25
m
l, including 2
m
l DNA template. The cycling conditions
for the reaction was 95 8C for 10 min, followed by 35 cycles
of denaturation (94 8C, 30 s), annealing (59 8C, 30 s), exten-
sion (72 8C, 30 s) and final extension (72 8C, 10 min)
(Clermont et al., 2000). Samples were electrophoresed in
a 1.5% agarose gel containing ethidium bromide. The sizes of
the amplicon were determined by comparing them with a
100 bp DNA ladder. Any isolate which failed to yield any of
the three amplicons was re-tested. Then any strain still
failing to yield any of the three amplicons was subjected to
PCR amplification for the 365 bp amplicon for the E. coli
beta-galactosidase gene (lacZ), to confirm that the isolate
was E. coli (Higgins et al., 2007). Any strain showing a
positive result for the lacZ gene and a negative result for the
three ampliconfragments, via comparison with the positive
control (ATCC 25922), was then assigned to the phyloge-
netic group A (Clermont et al., 2000). The various primers
used for the PCR are listed in Table 2.
2.4. Virulence factors (VFs) determinations
For this study eight VFs for all the E. coli isolates were
analysed using the primers selected by Johnson and Stell
(2000) as these were reported by those authors to be
sufficient to identify isolates as ExPECs. Isolates were
classified as ExPEC if they were found to be positive for two
or more of the eight virulence genes (Johnson et al., 2009).
The virulence score was calculated using the total number
of VF genes. Each reaction consisted of 4 mM MgCl
2
,1
m
lof
25 pmol of each primer (papAH,papC,afa/draBC,sfa/focDE,
sfaS,aerJ,kpsMT II, focG), 2
m
l of 2 mM dNTPs and 4
m
lof5
PCR buffer, 1U of Taq DNA polymerase (Bioline, Australia)
in a total reaction volume of 25
m
l, including 2
m
l DNA
template. Three primer pools with the eight primers were
utilised: pool 1: papAH (720), afa/draBC (559), sfa/focDE
(410) and iutA (300); pool 2: focG (360), and sfaS (240);
pool 3: kpsMT II (272) and papC (200). The cycling
conditions were as follows: 94 8C for 5 min, followed by
A.S. Obeng et al. / Veterinary Microbiology 154 (2012) 305–315
306
Author's personal copy
30 cycles of denaturation (94 8C, 30 s), annealing (64 8C,
30 s), extension (68 8C, 3 min) and final extension (72 8C,
10 min). PCR products were then electrophoresed on 1.5%
agarose gel containing ethidium bromide.
2.5. Antibiotic sensitivity testing
Minimum inhibitory concentrations (MIC) were deter-
mined using the agar dilution method with Mueller–
Hinton agar (Oxoid) as a culture medium, based on the
Clinical and Laboratory Standard Institute guidelines
(CLSI, 2008). The antimicrobial agents tested were
tetracycline, florfenicol, ceftiofur, ampicillin, gentamicin,
neomycin, ciprofloxacin, trimethoprim-sulfamethoxa-
zole, spectinomycin and streptomycin. Susceptibility
break points used were as established in CLSI guidelines,
while additional break points not covered were sourced
from the Danish Integrated Antimicrobial Resistance
Monitoring and Research Programme (DANMAP, 2007)
(Table 1).
The control strains used for the determination of MIC
values were E. faecalis ATCC 29212, E. coli ATCC 25922,
Pseudomonas aeruginosa ATCC 27853 and Staphylococcus
aureus ATCC 29213. The bacteria were subcultured onto
5% HBA plates (37 8C, 18 h) and then suspended in saline
to a concentration equivalent to 0.5 Mcfarland. The
suspensions were diluted in 1/10 in 0.85% saline to give
110
7
colony forming units, and this was inoculated
with a multipoint inoculator onto Muller–Hinton plates
containing different concentrations of the antibiotics.
Plates were incubated aerobically at 37 8C for 18 h. The
MIC values were defined as the lowest concentrations
producing no visible growth. Antimicrobial-free agar
plates were included as a control for normal growth.
2.6. Antibiotic resistance genes determination
Resistance genes for the various phenotypic resistant
strains were determined using primers and corresponding
annealing temperatures as highlighted in Table 2. Each
reaction mixture consisted of 4 mM MgCl
2
,1
m
l of 25 pmol
of each primer, 2
m
l of 2 mM dNTPs and 4
m
lof5PCR
reaction buffer, 1U of Taq DNA polymerase (Bioline,
Australia) in a total reaction volume of 25
m
l, including
2
m
l DNA template. DNA amplification was carried out
using the following conditions: 7 min initial denaturation
at 95 8C, following 35 cycles of denaturation at 94 8C for
30 s, annealing at various temperatures for 30 s (Table 2)
and extension at 72 8C for 45 s. PCR products were then
electrophoresised on a 1.5% agarose gel containing
ethidium bromide. The size of the various amplicons
was determined by comparison with 100 bp and 1 kb
ladders, as shown in Figs. 1 and 2.
2.7. DNA sequencing
A representative positive amplicon generated with each
primer was sequenced at the SouthPath Sequencing
Facility (Flinders Medical Centre, South Australia), after
PCR products were purified using Ultra clean-up DNA
purification kit (MO BIO, Carlsband) following the man-
ufacturer’s instructions. The sequences were analysed
using FinchTV (http://www.geospiza.com/Products/
finchtv.shtml) and NCBI GeneBlast (http://blast.ncbi.nlm.-
nih.gov/Blast.cgi) programs via the internet.
2.8. Nucleotide accession numbers
The accession number of the various resistance gene
sequences submitted to NCBI GenBank are: aadA2
(JN003414), bla
TEM
(JN003415), dhfrV (JN003416), intII
(JN003417), sulII (JN003418), intI (JN003419), aph(3)’-
Ia(aphA1) (JN003420), sulI (JN003421), Tet(A) (JN003422),
Tet(C) (JN003423), Tet(B) (JN003424), DhfrXIII (JN003425),
and Bla
SHV
(JN037849).
2.9. Statistical methods
Comparisons of association between phenotypic resis-
tance, resistance genes, class I & II integrons and virulence
genes in E. coli isolates from different classes of poultry
were performed separately by using the chi-square exact
test (GraphPad Prism software, version 5). The various
classes of chickens were compared using the Bonferroni
test. Statistical significance was set at a Pvalue of <0.05. An
association was determined to be positive when the two
genes were found together and negative when not found
together.
3. Results
3.1. Phenotypic resistance
Overall, 251 E. coli isolates comprising 134 from free
range meat chickens, 59 from free range egg layers and 58
from indoor commercial meat chickens were obtained
from 308 chicken faecal samples. The susceptibility of
these isolates to 10 antimicrobials is shown in Table 3.
Phenotypic resistance to ampicillin and tetracycline
varied between the different classes of poultry. Ampicillin
resistance was identified in 48 (35.8%) of free range meat
chicken isolates, 15 (25.8%) indoor commercial meat
chickens and in 4 (6.8%) of the free range egg layers. Whilst
resistance to tetracycline was observed in 53 (39.5%) free
range meat chickens strains, 39 (67.2%) indoor commer-
cial meat chickens, and 10 (16.9%) free range egg layers.
Table 1
Guidelines for interpreting antimicrobial susceptibility results for E. coli.
Antibiotic Susceptibility Resistance
Ampicillin 832
Ceftiofur 28
Ciprofloxacin <1>4
Florfenicol
a
<1>16
Gentamicin 416
Neomycin
a
<1>8
Spectinomycin
a
<8>64
Streptomycin
a
<4>16
Tetracycline 416
TMP/SU 2/38 4/76
TMP/SU, trimethoprim/sulphamethoxazole.
a
DANMAP MIC (
m
g/ml) for E. coli.
A.S. Obeng et al. / Veterinary Microbiology 154 (2012) 305–315
307
Author's personal copy
However, less resistance to spectinomycin, streptomycin,
trimethoprim-sulfamethoxazole, and neomycin was also
observed (Table 3). No resistance was found to ceftiofur,
ciprofloxacin or gentamicin in any of the different groups
of chickens.
In total (n= 251), widespread resistance was detected
to tetracycline (40.6%), ampicillin (26.7%), and less
resistance was detected to streptomycin (10.8%), specti-
nomycin (9.6%), trimethoprim-sulfamethoxazole (12.4%),
neomycin (6.0%) and florfenicol (2.0%) (Table 3). Multiple
resistance to three or more antibiotics was found in 26
(10.6%) of the 251 E. coli isolates. Co-resistance involving
tetracycline, ampicillin, spectinomycin, and streptomycin
was the most prevalent resistance detected. However, a
few isolates were found to be multi resistant to florfenicol,
neomycin, and trimethoprim-sulfamethoxazole as well.
Forty three (17.1%) of the isolates were found to express
co-resistance to two antibiotics with the commonest being
to tetracycline and ampicillin, whilst 76 (30.3%) of the
isolates were found to express resistance to only one
antibiotic.
3.2. Distribution of antimicrobial resistance genes
Aminoglycoside: Neomycin resistance gene aph(3
0
)-
Ia(aphA1) was found in 14 phenotypically resistant
isolates from indoor commercial and free range meat
chickens, however, one resistant isolate from the free
Table 2
Primers used for PCR in this study.
Genes investigated PCR primer sequence (5
0
–3
0
) Amplicon
size (bp)
Annealing
temperature
(8C)
References
Forward Reverse
Beta-lactams
bla
TEM
gagtattcaacattttcgt accaatgcttaatcagtga 857 60 Maynard et al. (2004)
bla
CTX-M-3
aatcactgcgtcagttcac tttatcccccacaacccag 701 60 Maynard et al. (2004)
Bla
CMY-2
ataaccacccagtca cagtagcgagactgcgca 631 60 Maynard et al. (2004)
Bla
SHV
ggttattcttatttgtcgcttctt tacgttacgccacctggcta 1233 52 Rankin et al. (2005)
Tetracycline
tet(A) gtgaaacccaacatacccc gaaggcaagcaggatgtag 888 60 Maynard et al. (2004)
tet(B) ccttatcatgccagtcttgc actgccgttttttcgcc 774 60 Maynard et al. (2004)
tet(C) acttggagccactatcgac ctacaatccatgccaaccc 881 60 Maynard et al. (2004)
tet(D) tgggcagatggtcagataag cagcacaccctgtagttttc 827 60 Maynard et al. (2004)
tet(E) ttaatggcaacagccagc tccatacccatccattccac 853 60 Maynard et al. (2004)
Neomycin
aph(3
0
)-Ia(aphA1) atgggctcgcgataatgtc ctcaccgaggcagttccat 600 60 Maynard et al. (2004)
Gentamicin
aph(3
0
)-IIa (aphA2) gaacaagatggattgcacgc gctcttcagcaatatcacgg 680 60 Maynard et al. (2004)
Trimethoprim
dhfrI aagaatggagttatcgggaatg gggtaaaaactggcctaaaattg 391 Maynard et al. (2004)
dhfrV ctgcaaaagcgaaaaacgg agcaatagttaatgtttgagctaaag 432 60 Maynard et al. (2004)
dhfrXIII caggtgagcagaagattttt cctcaaaggtttgatgtacc 294 60 Maynard et al. (2004)
Sulphonamide
sulI ttcggcattctgaatctcac atgatctaaccctcggtctc 822 60 Maynard et al. (2004)
sulII cggcatcgtcaacataacc gtgtgcggatgaagtcag 722 60 Maynard et al. (2004)
Spectinomycin
aadA2 tgttggttactgtggccgta gctgcgagttccatagcttc 381 60 Ng et al. (1999)
Phenicol
floR cgccgtcattcctcaccttc gatcacgggccacgctgtgtc 215 60 Maynard et al. (2004)
Integrons 1& 2
IntI gggtcaaggatctggatttcg acatgggtgtaaatcatcgtc 483 60 Saenz et al. (2004)
IntII cacggatatgcgacaaaaaggt gtagcaaacgagtgacgaaatg 788 60 Saenz et al. (2004)
Integron variable regions
int1 CS ggcatccaagcagcaag aagcagacttgacctga Variable 64 Bass et al. (1999)
int2 CS cgggatcccggacggcatgcacgatttgta gatgccatcgcaagtacgag 2.2 kb 55 White et al. (2001)
Phylogenetic grouping genes
ChuA gacgaaccaacggtcaggat tgccgccagtaccaaagaca 279 59 Clermont et al. (2000)
YjaA tgaagtgtcaggagacgctg atggagaatgcgttcctcaac 211 59 Clermont et al. (2000)
TspE4C2 gagtaatgtcggggcattca cgcgccaacaaagtattacg 152 59 Clermont et al. (2000)
E. coli beta galactosidase gene
lacZ gcagcgttgttgcagtgc gtcccgcagcgcagac 365 60 Higgins et al. (2007)
Virulence factors genes
papAH atggcagtggtgtcttttggtg cgtcccaccatacgtgctcttc 720 64 Johnson and Stell (2000)
papC gtggcagtatgagtaatgaccgtta atatcctttctgcagggatgcaata 200 64 Johnson and Stell (2000)
Afa/draBC ggcagagggccggcaacaggc cccgtaacgcgccagcatctc 559 64 Johnson and Stell (2000)
sfa/focDE ctccggagaactgggtgcatcttac cggaggagtaattacaaacctggca 410 64 Johnson and Stell (2000)
sfaS gtggatacgacgattactgtg ccgccagcattccctgtattc 240 64 Johnson and Stell (2000)
iutA ggctggacatcatgggaactgg cgtcgggaacgggtagaatcg 300 64 Johnson and Stell (2000)
kpsMT II gcgcatttgctgatactgttg catccagacgataagcatgagca 272 64 Johnson and Stell (2000)
focG cagcacaggcagtggatacga gaatgtcgcctgcccattgct 360 64 Johnson and Stell (2000)
A.S. Obeng et al. / Veterinary Microbiology 154 (2012) 305–315
308
Author's personal copy
range meat chickens was found not to contain the gene. All
isolates from the free range egg layer farm were found to
be susceptible to neomycin and negative for the aph(3
0
)-
Ia(aphA1) resistance gene (Table 3).
Spectinomycin–streptomycin: Of the 51 phenotypically
resistant isolates, 25 were found to contain aadA2gene
which is able to confer resistance to spectinomycin and
streptomycin. The prevalence was found to be high in
indoor commercial and free range meat chickens.
Beta-lactams: Forty three ampicillin resistant isolates
were found to contain Bla
TEM,
whilst four strains had the
Bla
SHV
gene. Although none of the ampicillin phenotypic
resistant isolates contained the Bla
CTX-M-3
or Bla
CMY-2
genes, six isolates were found to contain Bla
TEM
and Bla
SHV
genes.
Sulphonamides: In this study, sulphonamide resistance
phenotype was associated with two genes: sulI and sulII.
Twenty nine phenotypically resistant isolates were found
to harbour the sulI and/sulII genes. The distributions were
as follows: sulII was found in 12 and sulI was found in 9,
whilst eight isolates were found to have a combination of
sulI and sulII genes.
Tetracyclines: Of the five tetracycline resistance genes
tested, only tet(A), tet(B) and tet(C) were found among the
isolates (Table 3). The distribution were as follows: 48
tet(A), and 7 tet(B), the combination of tet(A) + tet(B) were
found in one isolate, tet(A) + tet(C) in 11 and tet(B) + tet(C)
in 3 isolates. None of the isolates were found to carry tet(C)
alone.
Trimethoprim: The trimethoprim genes dhfrV and
dhfrXIII were found in 26 isolates. Fifteen isolates were
found to mediate resistance with the aid of dhfrV genes
while 10 isolates had dhfrXIII, one isolate was found to
have a combination of dhfrV+dhfrXII genes.
3.3. The incidence of genes and mobile genetic elements
associated with integrons among the E. coli isolates
All E. coli isolates were screened for the presence of intI
and intII. Thirty-three of poultry isolates were positive for
intI, 7 contained intII whilst 211 of the isolates did not
possess either intIorintII. A fragment of the intI variable
region was amplified with primer 3
0
CS and 5
0
CS (Bass et al.,
1999), whilst the remaining 7 intII positive isolates were
[(Fig._1)TD$FIG]
Fig. 1. Agarose gel electrophoresis of PCR products with representative isolates carrying the various tested resistance genes. The PCR was performed as
described in text: lane 1: 100 bp ladder, lane 2: tet(A), lane 3: tet(B), lane 4: tet(C), lane 5: aph(3
0
)-Ia(aphA1), lane 6: sulI, lane7: sulII, lane 8: bla
TEM
, lane 9:
bla
SHV
, lane 10: aadA2, lane 11: dhfrXIII, lane 12: dhfrV.
[(Fig._2)TD$FIG]
Fig. 2. Agarose gel electrophoresis of the PCR products with the integrons and integron conserved variable (CS) regions. The PCR was performed as described
in text. Lane 1: 1 kb ladder, lane 2: intI, lane 3: intI CS (approx. 0.25 kb), lane 4: intI CS (0.8 kb), lane 5: intI CS (1 kb), lane 6: intI CS (2.0 kb), lane 7: intICS
(2.1 kb), lane 8: intII, lane 9: intII CS (2.2 kb), lane 10: intII CS (1.8 kb).
A.S. Obeng et al. / Veterinary Microbiology 154 (2012) 305–315
309
Author's personal copy
Table 3
Prevalence of resistance genes detected in the E. coli isolates in relation to distribution in the various groups of chickens.
Antibiotic Free range meat chickens (n= 134) Free range egg layers (n= 59) Indoor commercial meat chickens (n= 58) Total no. of resistant
isolates (n= 251)
Total no. of
phenotypic
resistant stains
Tested genes No. with
positive
genes
Total no. of
phenotypic
resistant stains
Tested genes No. with
positive
genes
Total no.
of phenotypic
resistant stains
Tested genes No. with
positive
genes
Resistant (%)
Ampicillin 48 (35.8) Bla
TEM
29 4 (6.8) Bla
TEM
3 15 (25.8) Bla
TEM
11 67 (26.7)
Bla
SHV
2Bla
SHV
0Bla
SHV
2
Bla
TEM
&Bla
SHV
4Bla
TEM
&Bla
SHV
0Bla
TEM
&Bla
SHV
2
Florfenicol 4 (3.0) floR 00 floR 0 1 (1.7) floR 0 5 (2.0)
Neomycin 5 (3.7) aph(3
0
)-Ia(aphA1) 4 0 aph(3
0
)-Ia(aphA1) 0 10 (17.2) aph(3
0
)-Ia(aphA1) 10 15 (6.0)
Streptomycin 15 (11.2) aadA2 11 2 (3.4) aadA2 2 10 (17.2) aadA2 12 27 (10.8)
Spectinomycin 13 (9.7) 1 (1.7) 10 (17.2) 24 (9.6)
Sulphamethoxazole 16 (11.9) sulI60sulI 0 15 (25.9) sulI 3 31 (12.4)
sulII 5 sulII 0 sulII 7
sulI&sulII 5 sulI&sulII 0 sulI&sulII 3
Tetracycline 53 (39.5) tet(A) 20 10 (16.9) tet(A) 3 39 (67.2) tet(A) 25 102 (40.6)
tet(B) 1 tet(B) 3 tet(B) 3
tet(A)&tet (B) 0 tet(A)&tet (B) 0 tet(A)&tet (B) 1
tet(A)&tet(C) 4 tet(A)&tet(C) 0 tet(A)&tet(C) 7
tet(B)&tet(C) 2 tet(B)&tet(C) 0 tet(B)&tet(C) 1
Trimethoprim 16 (11.9) dhfrV60 dhfrV 0 15 (25.9) dhfrV 9 31 (12.4)
dhfrXIII 5 dhfrXIII 0 dhfrXIII 5
dhfrV&dhfrXIII 0 dhfrV&dhfrXIII 0 dhfrV&dhfrXIII 1
Integrons intI20 intI0 intI 13 33 (13.1)
intII 6 intII 0 intII 1 7 (2.8)
A.S. Obeng et al. / Veterinary Microbiology 154 (2012) 305–315
310
Author's personal copy
amplified with Hep 74 and Hep51 primers (White et al.,
2001). Among the 33 class 1 integron-positive isolates, five
distinct amplicons of 0.25 kb (11 isolates), 0.8 kb (5
isolates), 1 kb (5 isolates), 2 kb (5 isolates), and 2.1 kb (6
isolates) were obtained. For the class 2 integron-positive
isolates, amplicon sizes 1.8 kb (5 isolates) and 2.2 kb (2
isolates) were obtained. A representation of the various
amplicons generated for the variable regions of the class 1
and class 2 integrons were sequenced and blasted using
the NCBI GeneBlast in order to determine the content of
inserted gene cassettes.
With the exception of the 1.8 kb amplicon obtained
with the class 2 variable regions, all sequences were found
to have a 95–99% identity to submitted sequences in the
gene bank database. The class 1 integron variable region
amplicon 0.25 kb contained aadA2 and dhfr12 gene
cassettes (GenBank accession no. GU120477.1) and the
0.8 kb amplicon possessed only dhfrV gene (GenBank
accession no. AJ419169.1). PCR was used to confirm the
presence of aadA2 and dhfrV genes in the strains that
amplified the various respective regions. The 1.0 kb
amplicon contained aadA gene cassettes (GenBank acces-
sion no. GQ924770.1) and the 2.0 kb amplicons contained
the dhfrI, aadA2, and sulI gene cassettes (GenBank
accession no. AM040710.1). The generated 2.1 kb had
dfrA12, aadA2 with hypothetical protein orfF (GenBank
accession no. GU001949.1). The sequenced variable
regions of the strains that amplified 1.0 kb, 2.0 kb and
2.1 kb variable regions were confirmed by PCR for the
presence of streptomycin and trimethoprim resistant
genes. In addition, the two strains with 2.2 kb amplicon
produced with primers for the variable region of class 2
integron was found to harbour dhfr1, streptothricin
acetyltransferase 2 (sat2), and the aadA gene (GenBank
accession no. EU339237.1). The isolates were confirmed to
contain the aadA2 gene by PCR.
3.4. Association between antimicrobial resistance genes
A statistically significant (P<0.05) association was
found between the occurrence of various resistance and
integrase genes among all the poultry E. coli strains tested.
Within the isolates, there was a marked association of
aadA2, Bla
TEM
,Bla
SHV
,sulI, sulII, dhfrV, and dhfrXIII. Out of
the several different associations in the strains, a strong
correlation between the aadA2,sulI, sulII, dhfrV, and
dhfrXIII genes with the various tet and integrase genes
was found. Such findings might be an explanation for the
high levels of resistance genes among the phenotypically
resistant strains. Additionally, analysis of the various
farms revealed a separate significant association between
tetracycline and integrase 1 genes only. Furthermore, no
association was found in the ExPEC strains with regards to
resistance genes, or virulence factors (data not shown).
3.5. Distribution of virulence factor genes in relation to
phylogenetic grouping and various chicken types
PCR analysis of the 251 isolates revealed 39.4% of the
isolates belongs to phylogenetic group A, followed by
group B1 (32.3%), D (17.1%), and B2 (11.2%) (Table 4).
Isolates from free range meat chickens were spread over
all four phylogenetic groups. Those from the free range
egg layers and indoor commercial chickens were
predominantly from phylogenetic groups A and B.
The distribution of the 251 E. coli isolates in relation to
virulence genes and phylogenetic groups from the various
classes of chickens revealed that out of the 80 isolates
containing virulence factors, 24 belonged to group A, 23 to
group D, 17 to group B1, and 16 to B2 (Table 5). The
virulence score used to classify the ExPEC isolates was
calculated using the total number of VFs genes. The iutA
(aerobactin acquisition), papC (P fimbriae) and kpsMTII
(group 2 capsule synthesis) genes were the commonly
detected genes, whereas sfa/foc (S/FIC fimbriae) was not
identified in any of bacterial strains. The following
prevalent virulence genes (VFs) were detected: iutA (44
isolates), papC (8 isolates), iutA+papC (7 isolates),
iutA+kpSMTII (3 isolates) and papAH +iutA (2 isolates).
Interestingly, two isolates in groups B2 and D were found
to contain papAH +iutA+KpsMTII + papC respectively
whilst two other strains in groups B1 and D were found
to harbour iutA + papAH + KpsMTII. With respect to the
various groups of chickens, free range meat chicken
isolates were found to contain more of the tested VFs,
followed by indoor commercial chickens and free range
layers. Among the different classes of poultry birds, 20
strains from free range meat chickens were identified as
ExPEC strains, and five were found in indoor commercial
meat chickens.
3.6. Incidence of virulence genes (ExPEC markers) and
antimicrobial resistance genes in groups A, B1, B2 and D
Out of the 25 ExPEC isolates detected, 11 (44.0%) were
found to belong to group D, while 6 (24.0%) were group B2
(Table 6). Among the 11 ExPEC isolates in group D, the
commonly detected antimicrobial resistance genes were
aadA2,sulI,tet(A), and tet(C). Although a few isolates were
found to harbour genes for neomycin resistance (aph(3
0
)-
Ia(aphA1)), sulphonamide resistance (sulII), and class 1
integron, three of the isolates were found to be negative for
Table 4
Phylogenetic grouping in the different groups of chickens.
Groups of chickens Phylogenetic group (n= 251)
A B1 B2 D Total
Free range meat chickens 42 36 22 34 134
Free range egg layers 23 34 0 2 59
Indoor commercial chickens 34 11 6 7 58
Total (%) 99 (39.4) 81 (32.3) 28 (11.222) 43 (17.1) 251 (100%)
A.S. Obeng et al. / Veterinary Microbiology 154 (2012) 305–315
311
Author's personal copy
resistant genes and/integrons. Contrary to findings in
group D, most ExPEC strains in group B2 did not contain the
antimicrobial resistance genes investigated. Only three
isolates were found to contain tet resistant genes, whilst
one stain was associated with sulI, sulII, dhfrXIII, and aadA2.
In addition, 3 (12.0%) strains in group A and 5 (20.0%) in
group B1 found to contain VFs were mostly associated with
tet(A), tet(B), tet(C), and Bla
TEM
(Table 6).
4. Discussion
This appears to be the first study to systematically
compare phylogenetic grouping and antimicrobial resis-
tance in E. coli isolates from meat chickens (intensive and
free-range) and free-range egg layers in Australia. Pheno-
typic resistance encoded by resistance genes was more
widespread in the meat chickens than egg layers. These
Table 5
Distribution of virulence factors (Vfs) and phylogenetic groups among the different groups of chickens.
Prevalence of Vfs Free range meat chickens Free range egg layers Indoor commercial chickens Total (%)
(n= 251)
Phylogenetic group (n= 134) Phylogenetic group (n= 59) Phylogenetic group (n= 58)
A B1 B2 D Total A B1 B2 D Total A B1 B2 D Total
iutA 4 10 7 9 30 1 0 0 0 1 11 1 0 1 13 44 (17.5)
papC 2 1 1 0 4 1 0 0 0 1 2 0 1 0 3 8 (3.2)
KpMT 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 1 (0.4)
sfa 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 1 (0.4)
iutA+papC 1 1 2 3 7 0 0 0 0 0 0 0 0 0 0 7 (2.8)
sfa +iutA 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 1 (0.4)
papAH +iutA 1 0 0 0 1 0 0 0 0 0 0 0 0 1 1 2 (0.8)
iutA + focG 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 1 (0.4)
iutA+KpSMTII 0 1 1 1 3 0 0 0 0 0 0 0 0 0 0 3 (1.2)
KpSMTII + papC 0 0 0 0 0 1 0 0 0 1 0 0 0 0 0 1 (0.4)
iutA+kpsMT + papC 0 2 0 2 4 0 0 0 0 0 0 0 0 0 0 4 (1.6)
sfa +iutA+kpsMT 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 1 (0.4)
afaA+iutA+KpMTII 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 1 (0.4)
iutA+focG +KpsMTII 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 1 (0.4)
iutA+ papAH +KpsMTII 0 0 0 0 0 0 0 0 0 0 0 1 0 1 2 2 (0.8)
papAH +iutA+KpsMT II + papC 0 0 0 0 0 0 0 0 0 0 0 0 1 1 2 2 (0.8)
Total no. of isolates with Vfs 8 15 14 19 56 3 0 0 0 3 13 2 2 4 21 80 (32.2)
No of isolates without Vfs 34 21 8 15 78 20 34 0 2 56 21 9 4 3 37 171 (68.1)
Table 6
Distribution of virulence genes (ExPEC markers) and resistance genes in groups A, B1, B2 and D.
Phylogenetic groups No. of isolates with Vfs/or resistant genes in the various groups
Prevalence of Vfs Prevalence of resistant genes/integrons No. of isolates
Group A iutA+papCtet(A) + Bla
TEM
1
papAH +iutABla
TEM
1
KpSMTII + papC no resistant genes 1
Group B1 iutA+papC no resistant genes 1
iutA+ kpsMT tet(B) + Bla
TEM
1
papAH +iutA+KpsMT sulII 1
iutA+KpsMT +papC No resistant genes 1
iutA+KpsMT +papCtet(B) + tet(C) + sulII + aph(3
0
)-Ia(aphA1) + aadA21
Group B2 iutA+focGtet(A) 1
iutA + papC tetA+sulI+sulII + dhfrXIII + aadA2+intI1
iutA+papC No resistant genes 1
iutA+ kpsMT No resistant genes 1
iutA+focG +KpsMT No resistant genes 1
papAH +iutA+KpsMT +papCtet(B) 1
Group D papAH +iutAtet(A) + sulI 1
iutA+KpSMTII sulI+dhfrV+int11
iutA+papCtet(A) + aadA2+int11
iutA+papC No resistant genes 1
sfaS+iutA No resistant genes 1
iutA+kpsMT + papC tet(B) + tet(C) + sulII + aph(3
0
)-Ia(aphA1) 1
iutA+kpsMT + papC tet(A) + tet(C) + aadA21
iutA+focG +KpsMT tet(A) 1
sfaS+iutA+kpsMT No resistant genes 1
afaA+iutA+KpMTII No resistant genes 1
papAH +iutA+KpsMT +papCtet(B) + Bla
TEM
1
A.S. Obeng et al. / Veterinary Microbiology 154 (2012) 305–315
312
Author's personal copy
results are comparable to those in a Canadian study
reported by Gyles (2008), but generally lower than the
resistances reported for isolates from France (Bywater
et al., 2004) or Belgium (Persoons et al., 2010). In contrast
to Gyles (2008), no gentamicin or ciprofloxacin resistance
was detected in our isolates. Resistance to neomycin has
been reported in bacteria from meat chickens (Maynard
et al., 2004). In addition, the results from this study show a
substantial reduction in resistance compared with pre-
vious study in our laboratory of intensively raised
chickens, where 85% of isolates were resistant to tetra-
cycline, 40% resistant to ampicillin and 47% resistant to
streptomycin (Barton and Wilkins, 2001).
It is clear that resistance profiles are determined by the
antibiotics used (Gyles, 2008; Smith et al., 2007). Australia
permits the use of ionophores and flavophospholipol as
non-prescription antimicrobials in poultry. Only chlorte-
tracycline is registered for treatment of egg-producing
birds and a wider range including amoxicillin, neomycin,
lincomycin, spectinomycin, and oxytetracycline is regis-
tered for use in meat chickens. Virginiamycin and zinc-
bacitracin can be used under prescription for restricted
time intervals for the prevention and treatment of necrotic
enteritis. It is possible that other antimicrobials such as
ceftiofur could be legally used ‘‘off-label’’ if registered for
use in food producing animals but not specifically
prohibited for use in poultry. Gentamicin and all fluor-
oquinolones are prohibited for use in all food-producing
animals, including poultry in Australia. Furthermore,
neomycin and apramcycin is permitted in meat chickens.
The resistance genes we detected have previously been
reported in resistant E. coli strains from chickens (Guerra
et al., 2003; Saenz et al., 2004; Soufi et al., 2009) and
Maynard et al. (2004) found aph(3
0
)-Ia (aphA1) in
neomycin resistant ExPEC strains. The most frequently
found integrase gene in our study was intI, in keeping with
previous findings (Bass et al., 1999; Smith et al., 2007).
A small number of isolates were resistant to florfenicol
and this is not registered for use in poultry in Australia. The
failure to detect floR indicates that a wider range of genes
should be investigated and also might reflect persistence of
chloramphenicol resistance genes. Use of chloramphenicol
was banned in the early 1980s. It may also be that
resistance to florfenicol (or residual resistance to chlor-
amphenicol) is due to co-selection from the presence of
genetic determinants to resistance for a number of
antibiotics on a single plasmid or transposon. For example,
co-location of resistance to sulphamethoxazole, tetracy-
cline, kanamycin and chloramphenicol, ampicillin, tetra-
cycline, streptomycin and the sulphonamides associated
with a class 1 integron have been reported by Scaletsky
et al. (2010).
The lack of significant difference between intensive and
free-range chickens is at first surprising. Miranda et al.
(2008) reported lower levels of resistance in E. coli isolates
from organic poultry meat. However, the free-range
chicken producers in our study are supplied from the
same hatcheries as intensive producers and this may
indicate that resistance genes are passed vertically from
breeder flocks as it is more likely that antibiotics would be
used in breeder flocks than the meat chickens.
The low level of resistance in the free-range layers was
not surprising as antibiotic treatment is rare in this class of
poultry and is restricted to chlortetracycline anyway. This
could account for the presence of the tet(A) and tet(B)
genes but cannot account for the origin of the bla
TEM
and
aadA2 genes which may have been vertically transferred
from the breeder flock or acquired from environmental
exposure to other resistant bacteria.
Comparing the two main classes of chickens, there was
a significant difference between meat chickens and free
range egg layers. van den Bogaard et al. (2001) and Ojeniyi
(1985) have reported such prevalence of resistance in the
Netherlands and Africa. The possible use of antibiotics in
breeder flocks coupled with the greater density of birds in
intensive chicken farming might explain such high levels
of resistance in meat chickens when compared to egg
producing birds.
Though most of our resistant strains were identified as
belonging to phylogenetic group A, resistance patterns did
not differ significantly between the phylogenetic groups
(P<0.05) (data not shown).
4.1. Virulence factors and phylogenetic grouping
Presently, special attention is being focused on the
association of retail meat as a vehicle for transmission of
ExPEC from animals to humans (Johnson et al., 2005b).
ExPEC strains lack the ability to cause gastroenteritis and
they are characterised by the presence of specialised
virulence factors (VFs) which enables them to colonise
the host gastro intestinal tract and scavenge essential
nutrients while evading the immune system. Examples
of such VFs include afa/drab (Dr-binding adhesins),
papAH and papC (P fimbriae), sfa/focCD (S/F1 C fimbriae),
sfaS (bacterial adhesion), iutA (aerobactin acquisition)
and kpsMT II (group 2 capsule synthesis) (Johnson et al.,
2003, 2009).
In this study we recognised a considerable number of
the bacteria harboured the iutA gene with a few having
papC, papAH, focG and kpSMTII (Johnson et al., 2005a,
2009). The phylogenetic groups A1 and B1 are more
prevalent in poultry, followed by groups B2 and D (Unno
et al., 2009). The majority of our E. coli isolates belonged to
groups A1 (39.4%) and B1 (32.3%). But in contrast to
Maynard et al. (2004), most of our isolates carrying two or
more VFs belonged to group D or B2 as previously observed
by Cortes et al. (2010).
5. Conclusion
This study demonstrates that antibiotic resistance has
declined in E. coli isolates from the level detected in
intensive meat chickens by an earlier study in 2000. In
addition it demonstrates that, at least under Australian
conditions there is no significant difference in resistance in
E. coli between intensively and free range raised meat
chickens. Although antibiotics are not used extensively in
meat chickens, resistance may be vertically transmitted
from breeder flocks or alternatively there may be co-
selection of resistance to a wide range of antibiotics
from the use of a single antibiotic. However, resistance in
A.S. Obeng et al. / Veterinary Microbiology 154 (2012) 305–315
313
Author's personal copy
free-range layers was substantially lower than the
resistance observed in meat chickens. ExPEC strains were
detected mainly in both free-range and intensive meat
chickens indicating that poultry meat is a potential source
of these strains. There was no difference in carriage of
resistance genes between ExPEC and non-pathogenic E. coli
in this study. From a public health perspective consumers
need to ensure that chicken meat is cooked properly and
that raw poultry meat is handled appropriately and does
not contaminate ready-to-eat foods.
Acknowledgements
We would like to acknowledge all the staff of the
Microbiology Department in the University of South
Australia for their technical support during the processing
and analysis of the samples. Special thanks go to Dr. James
R. Johnson, Adam L. Stell and Brian Johnston of the
University of Minnesota, Department of Medicine and
Infectious Diseases for providing the positive controls for
the virulence factors. We would like to acknowledge Dr.
Leslie Barker, Dr. Justine Gibson and Dr. Darren Trott of the
School of Veterinary Science (University of Queensland) for
supplying the control for Bla
SHV
resistance gene. We are
also grateful to all the staff in the various farms and
abattoirs in South Australia who cooperated with us during
the sample collection.
References
Aarestrup, F.M., Bager, F., Jensen, N.E., Madsen, M., Meyling, A., Wegener,
H.C., 1998. Resistance to antimicrobial agents used for animal therapy
in pathogenic-, zoonotic- and indicator bacteria isolated from differ-
ent food animals in Denmark: a baseline study for the Danish Inte-
grated Antimicrobial Resistance Monitoring (DANMAP). APMIS 106,
745–770.
Adelaide, O.A., Bii, C., Okemo, P., 2008. Antibiotic resistance and virulence
factors in Escherichia coli from broiler chicken slaughtered at tigoni
processing plant in Limuru, Kenya. East African Medical Journal 85,
597–606.
Barton, M.D., Wilkins, J., 2001. Antibiotic resistance in bacteria isolated
from poultry. In: A Report for the Rural Industries Research and
Development Corporation, RIRDC Publication No. 01/105, Canprint.
Bass, L., Liebert, C.A., Lee, M.D., Summers, A.O., White, D.G., Thayer, S.G.,
Maurer, J.J., 1999. Incidence and characterization of integrons, genetic
elements mediating multiple-drug resistance, in avian Escherichia
coli. Antimicrobial Agents and Chemotherapy 43, 2925–2929.
Bywater, R., Deluyker, H., Deroover, E., de Jong, A., Marion, H., McConville,
M., Rowan, T., Shryock, T., Shuster, D., Thomas, V., Valle, M., Walters, J.,
2004. A European survey of antimicrobial susceptibility among zoo-
notic and commensal bacteria isolated from food-producing animals.
Journal of Antimicrobial Chemotherapy 54, 744–754.
Clermont, O., Bonacorsi, S., Bingen, E., 2000. Rapid and simple determina-
tion of the Escherichia coli phylogenetic group. Applied and Environ-
mental Microbiology 66, 4555–4558.
CLSI, 2008. Performance Standards for Antimicrobial Disk and Dilution
Susceptibility Tests for Bacterial Isolated from Animals, Approved
Standard-Third Edition. CLSI Document M31-A3 28, pp. 1–95.
Cortes, P., Blanc, V., Mora, A., Dahbi, G., Blanco, J.E., Blanco, M., Lopez, C.,
Andreu, A., Navarro, F., Alonso, M.P., Bou, G., Blanco, J., Llagostera, M.,
2010. Isolation and characterization of potentially pathogenic anti-
microbial-resistant Escherichia coli strains from chicken and pig farms
in Spain. Applied and Environmental Microbiology 76, 2799–2805.
DANMAP, 2007. Use of antimicrobial agents and occurrence of antimi-
crobial resistance in bacteria from food animals, foods and humans in
Denmark. ISSN 1600-2032.
Ewers, C., Antao, E.M., Diehl, I., Philipp, H.C., Wieler, L.H., 2009. Intestine
and environment of the chicken as reservoirs for extraintestinal
pathogenic Escherichia coli strains with zoonotic potential. Applied
and Environmental Microbiology 75, 184–192.
Guerra, B., Junker, E., Schroeter, A., Malorny, B., Lehmann, S., Helmuth, R.,
2003. Phenotypic and genotypic characterization of antimicrobial
resistance in German Escherichia coli isolates from cattle, swine
and poultry. Journal of Antimicrobial Chemotherapy 52, 489–492.
Gyles, C.L., 2008. Antimicrobial resistance in selected bacteria from
poultry. Animal Health Research Reviews/Conference of Research
Workers in Animal Diseases 9, 149–158.
Hammerum, A.M., Heuer, O.E., 2009. Human health hazards from anti-
microbial-resistant Escherichia coli of animal origin. Clinical Infectious
Diseases 48, 916–921.
Higgins, J., Hohn, C., Hornor, S., Frana, M., Denver, M., Joerger, R., 2007.
Genotyping of Escherichia coli from environmental and animal sam-
ples. Journal of Microbiological Methods 70, 227–235.
Johnson, J.R., Delavari, P., O’Bryan, T.T., Smith, K.E., Tatini, S., 2005a.
Contamination of retail foods, particularly Turkey, from community
markets (Minnesota, 1999–2000) with antimicrobial-resistant and
extraintestinal pathogenic Escherichia coli. Foodborne Pathogens and
Disease 2, 38–49.
Johnson, J.R., Kuskowski, M.A., Smith, K., O’Bryan, T.T., Tatini, S., 2005b.
Antimicrobial-resistant and extraintestinal pathogenic Escherichia
coli in retail foods. Journal of Infectious Diseases 191, 1040–1049.
Johnson, J.R., McCabe, J.S., White, D.G., Johnston, B., Kuskowski, M.A.,
McDermott, P., 2009. Molecular analysis of Escherichia coli from retail
meats (2002–2004) from the United States national antimicrobial
resistance monitoring system. Clinical Infectious Diseases 49, 195–
201.
Johnson, J.R., Murray, A.C., Gajewski, A., Sullivan, M., Snippes, P., Kus-
kowski, M.A., Smith, K.E., 2003. Isolation and molecular characteriza-
tion of nalidixic acid-resistant extraintestinal pathogenic Escherichia
coli from retail chicken products. Antimicrobial Agents and Che-
motherapy 47, 2161–2168.
Johnson, J.R., Russo, T.A., 2002. Extraintestinal pathogenic Escherichia coli:
the other bad E. coli. Journal of Laboratory and Clinical Medicine 139,
155–162.
Johnson, J.R., Sannes, M.R., Croy, C., Johnston, B., Clabots, C., Kuskowski,
M.A., Bender, J., Smith, K.E., Winokur, P.L., Belongia, E.A., 2007. Anti-
microbial drug-resistant Escherichia coli from humans and poultry
products, Minnesota and Wisconsin, 2002–2004. Emerging Infectious
Diseases 13, 838–846.
Johnson, J.R., Stell, A.L., 2000. Extended virulence genotypes of Escherichia
coli strains from patients with urosepsis in relation to phylogeny and
host compromise. Journal of Infectious Diseases 181, 261–272.
Maynard, C., Bekal, S., Sanschagrin, F., Levesque, R.C., Brousseau, R.,
Masson, L., Lariviere, S., Harel, J., 2004. Heterogeneity among viru-
lence and antimicrobial resistance gene profiles of extraintestinal
Escherichia coli isolates of animal and human origin. Journal of Clinical
Microbiology 42, 5444–5452.
Miranda, J.M., Vazquez, B.I., Fenti, C.A., Calo-Mata, P., Cepeda, A., Franco,
C.M., 2008. Comparison of antimicrobial resistance in Escherichia coli,
Staphylococcus aureus, and Listeria monocytogenes strains isolated
from organic and conventional poultry meat. Journal of Food Protec-
tion 71, 2537–2542.
Musgrove, M.T., Jones, D.R., Northcutt, J.K., Cox, N.A., Harrison, M.A.,
Fedorka-Cray, P.J., Ladely, S.R., 2006. Antimicrobial resistance in
Salmonella and Escherichia coli isolated from commercial shell eggs.
Poultry Science 85, 1665–1669.
Ng, L.K., Mulvey, M.R., Martin, I., Peters, G.A., Johnson, W., 1999. Genetic
characterization of antimicrobial resistance in Canadian isolates of
Salmonella serovar Typhimurium DT104. Antimicrobial Agents and
Chemotherapy 43, 3018–3021.
Ojeniyi, A.A., 1985. Comparative bacterial drug resistance in a modern
battery and free-range poultry in a tropical environment. Veterinary
Record 117, 11–12.
Persoons, D., Dewulf, J., Smet, A., Herman, L., Heyndrickx, M., Martel, A.,
Catry, B., Butaye, P., Haesebrouck, F., 2010. Prevalence and persistence
of antimicrobial resistance in broiler indicator bacteria. Microbial
Drug Resistance 16, 67–74.
Rankin, S.C., Whichard, J.M., Joyce, K., Stephens, L., O’Shea, K., Aceto, H.,
Munro, D.S., Benson, C.E., 2005. Detection of a Bla
SHV
extended-
spectrum
b
-lactamase in Salmonella enterica serovar Newport
MDR-AmpC. Journal of Clinical Microbiology 43, 5792–5793.
Saenz, Y., Brinas, L., Dominguez, E., Ruiz, J., Zarazaga, M., Vila, J., Torres, C.,
2004. Mechanisms of resistance in multiple-antibiotic-resistant
Escherichia coli strains of human, animal, and food origins. Antimi-
crobial Agents and Chemotherapy 48, 3996–4001.
Scaletsky, I.C., Souza, T.B., Aranda, K.R., Okeke, I.N., 2010. Genetic ele-
ments associated with antimicrobial resistance in enteropathogenic
Escherichia coli (EPEC) from Brazil. BMC Microbiology 1, 0.
Smith,J.L.,Drum,D.J.V.,Dai,Y.,Kim,J.M.,Sanchez,S.,Maurer,J.J.,
Hofacre, C.L., Lee, M.D., 2007. Impact of antimicrobial usage on
A.S. Obeng et al. / Veterinary Microbiology 154 (2012) 305–315
314
Author's personal copy
antimicrobial resistance in commensal Escherichia coli strains colo-
nizing broiler chickens. Applied and Environmental Microbiology
73, 1404–1414.
Soufi, L., Abbassi, M.S., Saenz, Y., Vinuae, L., Somalo, S., Zarazaga, M.,
Abbas, A., Dbaya, R., Khanfir, L., Ben Hassen, A., Hammami, S., Torres,
C., 2009. Prevalence and diversity of integrons and associated resis-
tance genes in Escherichia coli isolates from poultry meat in Tunisia.
Foodborne Pathogens and Disease 6, 1067–1073.
Unno, T., Han, D., Jang, J., Lee, S.N., Ko, G., Ha, Y.C., Joon, H.K., Sadowsky,
M.J., Hur, H.G., 2009. Absence of Escherichia coli phylogenetic group B2
strains in humans and domesticated animals from Jeonnam Province,
Republic of Korea. Applied and Environmental Microbiology 75,
5659–5666.
van den Bogaard, A.E., London, N., Driessen, C., Stobberingh, E.E., 2001.
Antibiotic resistance of faecal Escherichia coli in poultry, poultry
farmers and poultry slaughterers. Journal of Antimicrobial Che-
motherapy 47, 763–771.
White, P.A., McIVER, C.J., Rawlinson, W.D., 2001. Integrons and gene
cassettes in the Enterobacteriaceae. Antimicrobial Agents and Che-
motherapy 45, 2658–2661.
A.S. Obeng et al. / Veterinary Microbiology 154 (2012) 305–315
315
