Content uploaded by Agnieszka Waclawik
Author content
All content in this area was uploaded by Agnieszka Waclawik on Dec 31, 2014
Content may be subject to copyright.
Effect of conceptus on expression of prostaglandin F
2
a
receptor in the
porcine endometrium
Piotr Kaczynski, Agnieszka Waclawik
*
Institute of Animal Reproduction and Food Research of Polish Academy of Sciences, Olsztyn, Poland
article info
Article history:
Received 8 August 2012
Received in revised form 10 December 2012
Accepted 15 December 2012
Keywords:
Endometrium
Conceptus
Pregnancy
Prostaglandin F
2
a
receptor
Pig
Prostaglandin F
2
a
abstract
Increased synthesis of prostaglandin F
2
a
(PGF
2
a
) in the endometrium and conceptus during
the implantation period results in elevated concentration of PGF
2
a
in the uterine lumen in
pregnant gilts. PGF
2
a
exerts its effects through PGF
2
a
receptor (PTGFR), a G–protein-coupled
receptor. However, besides studies concerning the function of PTGFR in endometrial
abnormalities, the role of PTGFR in the endometrium during early pregnancy has not been
elucidated. Therefore, the aim of this study was: (1) to evaluate the profile of PTGFR gene
and protein expression in the porcine endometrium during early pregnancy and the estrous
cycle; (2) to determine if the effect of conceptus on PTGFR expression is dependent on type
of endometrial cellsdluminal epithelial (LE) or stromal (ST) cells; and (3) to elucidate if the
putative effect of conceptus on endometrial PTGFR expression is mediated by estrogen
receptor. We evaluated the expression pattern of PTGFR gene and protein in the endome-
trium during day 9, 11,12, 15, and 18 of the estrous cycle and pregnancy (N ¼4–6 per group).
The expression of PTGFR mRNA was greateron day 18 of pregnancy and the estrous cycle (vs.
days 9–15 of the estrous cycle and pregnancy, P <0.05). Expression of PTGFR protein was
approximately 10-fold upregulated in the endometrium on day 15 of pregnancy when
compared with day 15 of the estrous cycle (P <0.01). Endometrial expression of PTGFR
protein increased from day 12 to 18 of pregnancy (P <0.05). PTGFR mRNA was expressed in
LE and ST cells. In a subsequent experiment, we used a coculture model in which LE cells
were cultured on collagen-coated inserts placed in wells plated with ST cells. Day 11 or 15
conceptus-exposed medium (CEM) elevated expression of PTGFR mRNA (2- and 1.5-fold,
respectively, P <0.05) in LE cells cocultured with ST cells. CEM did not have an effect on
PTGFR mRNA expression in ST cells. The 11-day CEM-induced increase of PTGFR mRNA was
abolished by incubation of LE cells in the presence of the estrogen receptor antagonist (ICI-
182,780; P <0.01). Summarizing, the conceptus upregulated expression of PTGFR in the
endometrium during the implantation period. Moreover, this study indicates that expres-
sion of PTGFR gene was elevated in LE cells of endometrium by embryonic signal of estradiol.
Our results suggest para- and autocrine effects of PGF
2
a
through its receptor PTGFR in the
porcine endometrium, especially in luminal epithelium which is in direct contact with the
conceptus during the implantation period.
Ó2013 Elsevier Inc. All rights reserved.
1. Introduction
Prostaglandin F
2
a
(PGF
2
a
) as a tissue specific hormone is
involved in many physiologic processes. In most mammals,
PGF
2
a
is claimed to be the main luteolytic factor which
controls progesterone secretion by acting on luteal cells [1–4].
PGF
2
a
exerts its function through PGF
2
a
receptor
(PTGFR) which belongs to the G–protein-coupled receptor
family. Activated PTGFR binds to Gq protein, that leads to
protein kinase C-mediated elevation of intracellular Ca
2þ
concentration [5]. PTGFR can also activate other signal
*Corresponding author. Tel.: þ48 89 5357422; fax: þ48 89 5357421.
E-mail address: waclawik@pan.olsztyn.pl (A. Waclawik).
Contents lists available at SciVerse ScienceDirect
Theriogenology
journal homepage: www.theriojournal.com
0093-691X/$ –see front matter Ó2013 Elsevier Inc. All rights reserved.
http://dx.doi.org/10.1016/j.theriogenology.2012.12.003
Theriogenology 79 (2013) 784–790
transduction pathways such as Rho, focal adhesion kinase
signaling, and mitogen-activated protein kinase [6,7].
PTGFR is approximately a 40 kDa protein with a seven
transmembrane domain that is highly conserved among
prostanoid receptors. PTGFR gene consists of three exons
and two introns [8].
In the porcine corpus luteum (CL) the expression of
PTGFR is lower on days 7 and 8 of the estrous cycle, which is
believed to protect luteal cells from the lytic effects of PGF
2
a
.
The upregulation of PTGFR expression in the porcine CL on
days 13 and 15 of the estrous cycle coincides with onset of
luteolysis [9]. However, during early pregnancy in the pig,
estradiol (E
2
) produced by the conceptus in a biphasic
manner on days 11 to 12 and 15 to 30 of pregnancy prolongs
luteal progesterone production [10].
Interestingly, average concentration, amplitude, and the
frequency of PGF
2
a
pulses are lower in the porcine utero-
ovarian vein on day 13 to 17 of pregnancy than in pigs on
day 13 to 17 of the estrous cycle [11]. To avoid luteolytic
influence of PGF
2
a
on the CL in ovary, PGF
2
a
is sequestered
in the uterus probably by redirection of its secretion from
the uterine venous drainage (endocrine) into the uterine
lumen (exocrine) by conceptus signaldE
2
[12]. The anti-
luteolytic mechanism could also involve the retrograde
transfer of PGF
2
a
from the venous blood and uterine lymph
into the uterine lumen and ability of uterine veins and
arterial walls to accumulate PGF
2
a
[13]. Another potential
mechanism by which the conceptus can contribute to
prevention of luteolysis is by changing prostaglandin (PG)
synthesis in favor of PGE
2
during the maternal recognition
of pregnancy, on days 10 to 13 in the pig [14–16]. PGE
2
plays
an important role as a luteoprotective factor and a local
mediator of embryo signal on uterus [15,17–20]. Our
previous study indicated the existence of a putative PGE
2
autoamplification loop in the endometrium that can be
involved in an increase of the PGE
2
/PGF
2
a
ratio on days 10
to 13 of pregnancy [16]. In this period, synthesis of PGF
2
a
seems to be undesired because of its luteolytic effect on the
CL. Indeed, our results indicate low expression of PGF
2
a
synthase mRNA and protein in the porcine embryo and
endometrium on days 10 to 13 of pregnancy. However, in
later periods, during implantation and early placentation
(days between 14 and 25 of pregnancy) expression of PGF
2
a
synthase significantly increases in the endometrium and
conceptus [14,15] resulting in elevated PGF
2
a
content in the
uterine lumen [21]. To our knowledge, until now there is no
information concerning the role of an increased amount of
PGF
2
a
secreted into the uterine lumen during early preg-
nancy in the pig, or in any other species. Therefore, a key
question arises as to whether PTGFR is present in the
porcine endometrium during early pregnancy, especially at
the implantation period, when embryo and endometrium
secrete PGF
2
a
[14,15]. Hereby, the aim of this study was: (1)
to evaluate the profile of PTGFR gene and protein expres-
sion in the porcine endometrium during early pregnancy
and the estrous cycle; (2) to determine if the possible effect
of conceptus on PTGFR expression is dependent on the type
of endometrial cells–the luminal epithelial (LE) and stromal
(ST) cells; and (3) to elucidate if the putative effect of
conceptus on PTGFR expression in endometrial cells is
mediated by estrogen receptor in the endometrium.
2. Materials and methods
2.1. Tissue collection
Peripubertal crossbred gilts (Polish Landrace Duroc)
of similar age (5–5.5 months) and genetic background from
one commercial herd were observed daily for onset of
estrus. After two natural estrous cycles, gilts were divided
randomly in two groups: cyclic and pregnant. Gilts
assigned to the pregnant group were inseminated at 12 and
24 hours after detection of estrus. Animals were slaugh-
tered in a local abattoir on either day 9, 11, 12, 15, or 18 of
the estrous cycle (N ¼4–6 per group) or pregnancy (N ¼
4–6 animals with confirmed pregnancy per group). Preg-
nancy was confirmed by the presence of conceptuses. The
conceptuses were flushed from each uterine horn with
sterile phosphate-buffered saline (137 mmol/L NaCl, 27
mmol/L KCl, 10 mmol/L Na
2
HPO
4
, and 2 mmol/L KH
2
PO
4
,
pH 7.4).
Endometrial fragments were collected from uteri at the
middle part of the uterine horn and were dissected from
myometrium. In pregnant gilts on days 14 and 18, the
endometrium collected from implantation sites was also
separated from trophoblasts.
Endometrial samples weresnap-frozen in liquid nitrogen
and stored at 80
C for further analyses. All procedures
involving animals were approved by the Local Research
Ethics Committee and were conducted in accordance with
the national guidelines for agricultural animal care.
2.2. Incubation of conceptusesdobtaining conceptus-exposed
medium
Day 11 or 15 conceptuseses were recovered from uteri of
pregnant gilts (N ¼5 and N ¼4, respectively) by gentle
flushing of each uterine horn with phenol red-free Medium
199 (M3769; Sigma-Aldrich, St. Louis, MO, USA) containing
0.1% (wt/vol) bovine serum albumin (BSA; ICN Biomedicals,
Inc., Costa Mesa, CA, USA), penicillin (100 IU/mL), and
streptomycin (100
m
g/mL; Sigma-Aldrich), warmed to 37
C. Then, conceptuses were washed two times with fresh
Medium 199 with 0.1% BSA and antibiotics, weighed, and
placed separately in culture flasks containing phenol red-
free Medium 199 (1 mL of medium per 15–30 mg of
conceptus), supplemented with penicillin, streptomycin,
and 10% (vol/vol) charcoal-stripped newborn calf serum
(steroids-free NCS; Sigma-Aldrich). Conceptuses were
incubated with culture medium for 24 hours at 37
Cin
a humidified atmosphere containing 95% air and 5% CO
2
.
After incubation, media from all conceptuses obtained from
each gilt were pooled together and centrifuged at 200 g
for 5 minutes to separate fragments of conceptus tissue.
Medium was stored at 80
C, and used in in vitro experi-
ments as day 11 or 15 conceptus-exposed medium (11d
CEM or 15d CEM).
2.3. Isolation of luminal epithelial and stromal cells of
endometrium
Luminal epithelial and stromal cells of the porcine
endometrium were isolated as previously described with
P. Kaczynski, A. Waclawik / Theriogenology 79 (2013) 784–790 785
some modifications [22]. Briefly, uterine horns collected
from gilts (N ¼5) after slaughter on day 11 of the estrous
cycle were washed four times with sterile PBS. Endometrial
tissue was separated from the myometrium by scissors.
Separated fragments of endometrium were then digested
with 0.48% (wt/vol) dispase (Life Technologies) in Hanks
balanced salt solution (Ca-, Mg-, and phenol-free, pH 7.4;
Sigma-Aldrich) at 37
C for 50 minutes with gentle shaking.
LE cells released after this digestion were pelleted by
centrifugation at 200 gfor 10 minues at 8
C. LE cells
were then washed with Medium 199 (Sigma-Aldrich)
supplemented with 1% (wt/vol) BSA, 100 IU/mL penicillin,
and 100
m
g/mL streptomycin. Red blood cells were lysed by
Red Blood Cell Lysing Buffer (Sigma-Aldrich). Isolated LE
cells were then washed three times with fresh Medium 199
with 1% (wt/vol) BSA. After washing, LE cells were resus-
pended in culture medium (Medium 199 supplemented
with 1% [wt/vol] BSA, 10% (vol/vol) steroids-free NCS, 100
IU/mL penicillin, and 100
m
g/mL streptomycin) and coun-
ted. The cell viability was assessed by 0.5% (wt/vol) Trypan
blue dye exclusion and was greater than 90%.
Endometrial tissue remaining after digestion in dispase
was minced with a lancet and digested in 0.06% (wt/vol)
collagenase (Sigma-Aldrich) in Medium 199 supplemented
with 1% (wt/vol) BSA, for 1.5 hours at 37
C. ST cells were
pelleted by centrifugation at 200 gfor 10 minutes at 8
C.
Red blood cells were removed with the same procedure
described for LE cells. ST cells were then washed three
times with fresh Medium 199 supplemented with 1% (wt/
vol) BSA. Isolated cells were resuspended with culture
medium and counted. Cell viability was assessed by the
method described for LE cells and was greater than 90%.
Isolated ST cells were washed 24 hours after plating to
remove contaminating epithelial cells.
2.4. Incubation of luminal epithelial and stromal cells with
CEM in a coculture model
To study the effect of conceptus products on PTGFR
expression, isolated endometrial cells, obtained from gilts
(N ¼5) on day 11 of the estrous cycle, were plated in
a coculture model, in which ST cells were cultured at the
bottom of six-well culture plates and LE cells were cultured
on collagen-coated inserts placed inside each well (Biocoat
Cell Culture Inserts Collagen Type I; BD Biosciences, Bed-
ford, MA USA; apical compartment). We used the coculture
model, established previously by our group [23] because it
corresponds more adequately to in vivo conditions in which
interactions of LE and ST cells are enabled than culturing
these cells separately. ST and LE cells were cultured for
72 hours in a phenol-red free Medium 199 containing 10%
(vol/vol) steroids-free NCS, 1% (wt/vol) BSA, antibiotics
(100 IU/mL penicillin and 100
m
g/mL streptomycin), addi-
tionally supplemented with E
2
(10 nmol/L) and proges-
terone (100 nmol/L). After reaching full confluence, LE cells
were pretreated for 1 hour with phenol red-free Medium
199 containing 10% (vol/vol) steroids-free NCS and antibi-
otics with or without 1
m
M estrogen receptor antagonist
(ICI-182,78; Sigma-Aldrich). After pretreatment, LE cells
were treated with: conditioned control medium without
any contact with conceptus (phenol red-free Medium 199
supplemented with 10% steroid-free NCS, and antibiotics)
or CEM mixed 3:1 with the fresh control medium in
presence or absence of ICI-182,78. ICI-182,780 was only
used in incubation with 11d CEM but not with 15d CEM. ST
cells plated in the basal compartment were treated with
the control medium only. Moreover, to study a direct effect
of conceptus products on ST cell expression of PTGFR gene,
ST cells were cultured in six-well plates (Nunc, Rochester,
NY, USA), and stimulated with 11d CEM or 15d CEM in
the same way as LE cells in apical compartments in the
coculture model. Both types of treatments were per-
formed for 24 hours, at 37
C in a humidified atmosphere
containing 95% air and 5% CO
2
. After incubation, cells were
lysed with Fenozol buffer (A&A Biotechnology, Gdansk,
Poland), harvested, and stored at 80
C until total RNA
isolation.
2.5. Total RNA isolation
Total RNA was isolated using the Total RNA Prep Plus kit
(A&A Biotechnology) and treated with DNase I (Life Tech-
nology Inc., Carlsbad, CA, USA) according to the manufac-
turer’s protocol to exclude possible DNA contamination.
After isolation, the amount of RNA and its quality were
analyzed with an Agilent 2100 Bioanalyzer (Agilent Tech-
nologies, Waldbronn, Germany) and Nanodrop 1000
(Thermo Fisher Scientific Inc.). Isolated RNA was stored at
80
C for further analyses.
2.6. Reverse transcription
Isolated RNA was used to generate cDNA for real-time
polymerase chain reaction (PCR). Total RNA sample (1
m
g)
was reverse transcribed with MultiScribe Reverse Tran-
scriptase kit (Life Technologies) according to the manu-
facturers protocol. cDNA samples were stored at 80
C for
further real-time PCR analyses.
2.7. Real-time PCR
Real-time PCR was performed with the Applied Bio-
systems 7900 Real-Time PCR system (Life Technlogies)
using Power SYBR Green master mix (Life Technlogies).
Reverse transcribed cDNA was amplificated in the 25
m
Lof
reaction mixture (12.5
m
L Power SYBR Green master mix,
2.5
m
L of each sense and antisense primer (1
m
mol/L), 3.5
m
L
of cDNA, and 4
m
L of water). Specific primers used for real-
time PCR are listed in Table 1. For quantification, standard
Table 1
Primers used for real-time polymerase chain reaction.
Gene Primer sequence (5
0
–3
0
) Reference
PTGFR Sense: TCAGCAGCACAGACAAGG [24]
Antisense: TTCACAGGCATCCAGATAATC
b
-actin Sense: ACATCAAGGAGAAGCTCTGCTACG [14]
Antisense: GAGGGGCGATGATCTTGATCTTCA
GAPDH Sense: CAGCAATGCCTCCTGTACCA [25]
Antisense: GATGCCGAAGTTGTCATGGA
Cyclophylin Sense: TAACCCCACCGTCTTCTT [26]
Antisense: TGCCATCCAACCACTCAG
P. Kaczynski, A. Waclawik / Theriogenology 79 (2013) 784–790786
curves based on serial dilutions of the cDNA were included.
Before amplification samples were initially denaturated at
95
C for 15 minutes. The PCR program for PTGFR gene was
performed as follows: 36 cycles of denaturation ( 95
C for
15 seconds), and annealing and elongation (60
C for 1
minute). For
b
-actin amplification the PCR program was:
36 cycles of denaturation (95
C for 15 seconds), annealing
(55
C for 30 seconds), and elongation (72
C for 1 minute).
After PCR, melting curves were acquired by gradual
increases in the temperature from 60
Cto95
C to ensure
that a single product was amplified in the PCR reaction.
Obtained products were then sent for sequencing.
Sequences were checked by nBLAST to confirm the
sequence homology with the sequence present in Gene-
Bank. Stability of the reference gene was assessed using the
statistical algorythms Normfinder 2.0 [27]. Three reference
genes were analyzed: GAPDH,cyclophylin, and
b
-actin. The
most stably expressed gene was
b
-actin.
2.8. Western blot
Endometrial tissues were homogenized on ice in buffer
containing 50 mmol/L TRIS-HCl, pH 8.0; 150 mmol/L NaCl,
and 1 mmol/L EDTA supplemented with protease inhibitor
cocktail (Sigma-Aldrich). Homogenates were then centri-
fuged for 15 minutes at 800 gat 8
C and stored at 80
C
for further analysis. The protein concentration was deter-
mined by Bradford Assay [28].
Protein samples from endometrial tissue homogenates
(40
m
g) were dissolved in SDS gel-loading buffer (50 mmol/L
TRIS-HCl, pH 6.8; 4% SDS, 20% glycerol, and 2%
b
-mercap-
toethanol), heated at 95
C for 4 minutes, and separated on
10% SDS-PAGE. Separated proteins were electroblotted
onto 0.2 mm nitrocellulose membrane in transfer buffer
(20 mmol/L TRIS-HCl buffer, pH 8.2; 150 mmol/L glycine,
and 20% methanol). After blocking in 5% nonfat dry milk in
TRIS-buffered saline buffer (TBS-T, containing 0.1% Tween-
20) for 1.5 hours at 25.6
C, the membranes were incu-
bated overnight with polyclonal anti-PTGFR antibodies at
4
C (Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA;
sc-67029). After incubation membranes were washed three
times in TBS-T and incubated with anti-rabbit secondary
antibodies (A8025; Sigma-Aldrich) dissolved 1:20,000 in
TBS-T, in room temperature for 90 minutes. After incuba-
tion membranes were also washed three times in TBS-T.
Immune complexes were visualized using alkaline phos-
phatase visualization procedure. Western blots were
quantified using Kodak 1D software (Eastman Kodak).
Sample loading was standardized to expression of GAPDH
using specific antibodies (1:100; A4312; Sigma-Aldrich).
2.9. Statistical analysis
All statistical analyses were conducted using GraphPad
Prism v. 5.02 software (GraphPad Software, Inc., San Diego,
CA, USA). To study the endometrial expression of PTGFR
mRNA and protein on days 9,11,12, 15, and 18 of the estrous
cycle and pregnancy, two-way ANOVA followed by Bon-
ferroni post hoc test was performed. This analysis included
the effect of day, reproductive status (the estrous cycle or
pregnancy), and day by reproductive status interaction. To
test the effect of 11d CEM and 15d CEM on PTGFR gene
abundance in endometrial cells, one-way ANOVA followed
by Bonferroni post hoc test was conducted. To study the
effect of CEM in the presence or absence of ICI-182,780 on
PTGFR mRNA abundance in LE cells, statistical analysis was
performed using two-way ANOVA followed by Bonferroni
post hoc test. This analysis included the effect of ICI pres-
ence, CEM treatment, and ICI presence by CEM treatment
interaction.
3. Results
3.1. Expression of PTGFR mRNA in the porcine endometrium
during early pregnancy and the estrous cycle
Real-time reverse transcription PCR analysis did not
reveal significant differences in PTGFR gene expression in
the porcine endometrium between pregnant and cyclic
gilts. However, effect of day on PTGFR gene expression was
observed (P <0.05). On day 18 of pregnancy and the
estrous cycle PTGFR mRNA levels were increased when
compared with previous (9–15) days (Fig. 1A). PTGFR mRNA
Fig. 1. Relative expression of PGF
2
a
receptor (PTGFR) mRNA (A) and protein
(B) in the porcine endometrium during early pregnancy and the estrous
cycle. The representative samples of Western blots are shown in the upper
panels. Values from Western blot analyses were normalized to GAPDH. Data
are represented as the mean SEM. Bars with different letters differ
significantly (P <0.05) within the estrous cycle (a and b) and the pregnancy
(x and y). Asterisks indicate differences (P <0.05) between animals during
the estrous cycle and animals during pregnancy.
P. Kaczynski, A. Waclawik / Theriogenology 79 (2013) 784–790 787
was expressed in luminal epithelial and stromal cells of the
endometrium (Fig. 2, upper panel).
3.2. Expression of PTGFR protein in the porcine endometrium
during early pregnancy and the estrous cycle
The effects of reproductive status and day on PTGFR
protein expression were detected in the endometrium
(P <0.05). During the estrous cycle expression of PTGFR
was low on day 9, intermediate on day 12, and elevated on
day 18 (vs. days 9, 11, and 15; P <0.05). During early
pregnancy, content of PTGFR protein was greater starting at
day 12, and until day 18 (P <0.05; Fig. 1B). The endometrial
expression of PTGFR protein was upregulated on day 15 of
pregnancy when compared with that of nonpregnant
animals on day 15 (Fig. 1B).
3.3. Effect of conceptus (CEM) on expression of PTGFR mRNA
in luminal epithelial and stromal cells of endometrium
cultured in vitro
We further studied if the embryo regulates PTGFR
expression in the different types of endometrial cellsdLE
and ST. Incubation with CEM from day 11 (P <0.01), and
from day 15 of pregnancy (P <0.05) increased expression
of PTGFR mRNA in LE cells cultured in inserts of the
coculture model with stromal cells (Fig. 2A). Moreover,
expression of PTGFR mRNA was higher in LE incubated with
11d CEM than in LE incubated with 15d CEM (P <0.01).
There was no effect of treatment with 11d CEM or 15d CEM
on the expression of PTGFR mRNA in ST cells in the cocul-
ture model with LE cells (data not shown), and in ST cells
cultured separately in six-well plates (Fig. 2B).
3.4. Effect of products secreted by conceptus on PTGFR mRNA
expression in luminal epithelial cells is mediated through
estrogen receptor
Since secretion of E
2
and expression of estrogen
receptor are elevated on day 11 of pregnancy, we studied
further the effect of 11d CEM with the presence of estrogen
receptor antagonist (ICI-182,780) on PTGFR expression. The
11d CEM-induced increase of PTGFR mRNA was abolished
by incubation LE cells in the presence of ICI-182,780
(P <0.01; Fig. 3). There were no differences in PTGFR
mRNA abundance in LE cells treated with control medium
with or without the estrogen receptor antagonist (Fig. 3).
4. Discussion
During establishment of pregnancy autocrine and
paracrine interactions between the conceptus and endo-
metrium are required for implantation and the establish-
ment of pregnancy [20,29]. Appropriate balance between
PG synthesis and secretion is important either during
the luteolysis initiation or the establishment of pregnancy
[29]. Despite the differences in mechanisms of placentation
in diverse species of animals, the inhibition of PG synthesis
before the implantation led to the failure of pregnancy
development [30–32].
Fig. 2. Effect of medium exposed to conceptuses from day 11 and 15 of pregnancy (11d CEM and 15d CEM, respectively) on expression of PTGFR mRNA in luminal
epithelial cells (A) in the coculture model with stromal cells, and in stromal cells cultured separately (B). Data are represented as the mean SEM. Asterisks
indicate differences between cells treated with 11d CEM and 15d CEM in comparison with the cells treated with control medium (* P <0.05; ** P <0.01).
Expression of PTGFR mRNA was detected by reverse transcription PCR in luminal epithelial (LE) and stromal (ST) cells as indicated in the upper panel. C, control
medium.
P. Kaczynski, A. Waclawik / Theriogenology 79 (2013) 784–790788
In this study, we demonstrated elevated PTGFR protein
expression in the porcine endometrium during initializa-
tion of implantation and during the implantation period
when compared with the preimplanation period (Fig. 1).
These results correspond with the findings which revealed
elevation of PGF
2
a
synthase protein expression in porcine
endometrium and trophoblasts on days 14 to 25 of preg-
nancy [14,15]. Moreover, the upregulation of PTGFR on
day 15 and 18 of pregnancy correspond to the increased
concentrations of PGF
2
a
in uterine flushings from preg-
nant gilts on day 14 to 18 of pregnancy than those from
cyclic animals [21]. Moreover, increased expression of
PTGFR on day 15 of pregnancy coincides with greater
expression of vascular endothelial growth factor A at the
peri-implantation period and elevated expression of its
receptor fms-related tyrosine kinase 1 on day 15 of preg-
nancy in the porcine endometrium [33]. Interestingly,
activation of PTGFR by PGF
2
a
mediates expression of
angiogenic factors in other cell typesdhuman endometrial
adenocarcinomas [7]. Therefore, it can be speculated that
the increase of PTGFR in the porcine endometrium during
implantation could be involved in angiogenesis. However, it
requires further studies.
Presence of PTGFR in the porcine endometrium is in
agreement with detection of this receptor in uterus of other
species [30,34–36]. Immunohistochemical analysis of
PTGFR in the ovine endometrium revealed strong signals in
the endometrium on days 14 and 20 of pregnancy [30].
Interestingly, abundance of PTGFR mRNA was greater in the
endometrium which had a direct contact with conceptus
(in placentome caruncles) when compared with intercar-
uncles in the bovine uterus through the whole pregnancy
period [35]. Elevated expression of PTGFR mRNA was
observed in pregnant when compared with nonpregnant
rat uterus [36]. In contrast to our results, in the mare
endometrium expression of PTGFR was decreased on days
14 to 15 of pregnancy when compared with days 14 to 15 of
the estrous cycle [34].
Based on the present results indicating upregulation of
PTGFR protein during implantation period in the pig, we
further studied if the embryo regulates PTGFR expression in
the different types of endometrial cellsdLE and ST. Our
results demonstrated that the medium obtained during
incubation with conceptuses from day 11 or 15 of preg-
nancy stimulated expression of PTGFR mRNA in LE but not
in ST cells of the porcine endometrium. This finding is
interesting considering that pigs have a true epi-
theliochorial placenta in which luminal epithelium remains
intact and the conceptus has a direct contact with LE but
not with ST cells in vivo.
We hypothesized that if PGF
2
a
and PTGFR indeed exerts
a pivotal role during early pregnancy, then the porcine
conceptus, especially acting through the primary porcine
embryonic signal E
2
, might regulate expression of PTGFR.
Since secretion of estradiol and estrogen receptor expres-
sion in LE are elevated on day 11 of pregnancy [10,37],we
further studied the effect of CEM obtained during incuba-
tion with day 11 conceptuses on endometrial PTGFR
expression in presence of estrogen receptor antagonist ICI-
182,780. Our study indicated that the porcine conceptus
mediates its effect by E
2
because blocking its receptor
abolished the effect of CEM on luminal epithelial cells.
Moreover, our results are in agreement with earlier studies
showing that E
2
administrated for ovariectomized rats
enhances the PTGFR mRNA expression in rat uterus [36].
4.1. Conclusions
Our findings indicate an important role of PTGFR in the
porcine endometrium during the implantation period.
Upregulation of PTGFR gene expression in luminal epithe-
lial cells mediated through estrogen receptor suggests
regulation of PTGFR by embryonic signaldE
2
. Moreover,
our results suggest a paracrine and autocrine effect of PGF
2
a
through its receptor PTGFR on the porcine endometrium,
especially on luminal epithelium which is in a direct
contact with conceptus during the implantation period.
The presented results support the hypothesis of a local
influence of PGF
2
a
on the endometrium to promote uterine
function during this period and verify the established view
on the role of PGF
2
a
during early pregnancy as an undesired
factor. Thus, this potential role of PGF
2
a
and its receptor in
pregnancy establishment requires further studies.
Acknowledgments
The authors thank J. Klos and M. Blitek for help in care
and handling of animals. This research was supported by
the Ministry for Science and Higher Education in Poland
(grant 717/N-COST/2010/0) and National Science Centre in
Poland (grant 2012/05/E/NZ9/03493). A. Waclawik was
awarded by Stipendium for Outstanding Young Researchers
from the Ministry of Science and Higher Education in
Poland.
References
[1] McCracken JA, Custer EE, Lamsa JC. Luteolysis: a neuroendocrine-
mediated event. Pysiol Rev 1999;79:263–323.
[2] Sakamoto K, Ezashi T, Miwa K, Okuda-Ashitaka E, Houtani T,
Sugimoto T, et al. Molecular cloning and expression of a cDNA of
the bovine prostaglandin F2a receptor. J Biol Chem 1994;269:
3881–8.
Fig. 3. Effect of the day 11 conceptus-exposed medium (CEM) in presence or
absence of 1
m
mol/L estrogen receptor antagonist ICI-182,780 (ICI) on relative
expression of PTGFR mRNA in porcine luminal epithelial (LE) cells of endo-
metrium cultured in a coculture model of LE and stromal cells. Data are
represented as the mean SEM. Asterisks indicate differences between cells
treated with CEM containing ICI-182,780 in comparison with cells treated
with control medium without ICI-182,780 (** P <0.01). C, control medium.
P. Kaczynski, A. Waclawik / Theriogenology 79 (2013) 784–790 789
[3] Sugimoto Y, Hasumoto K, Namba T, Irie A, Katsuyama M, Negishi M,
et al. Cloning and expression of a cDNA for mouse prostaglandin F2
a
receptor. J Biol Chem 1994;269:1356–60.
[4] Tsai SJ, Anderson LE, Juengel J, Niswender GD, Wiltbank MC.
Regulation of prostaglandin F2 alpha and E receptor mRNA by
prostaglandin F 2 alpha in ovine corpora lutea. J Reprod Fertil 1998;
114:69–75.
[5] Bos CL, Richel DJ, Ritsema T, Peppelenbosch MP, Versteeg HH.
Prostanoids and prostanoid receptors in signal transduction. Int J
Biochem Cell Biol 2004;36:1187–205.
[6] Pierce KL, Fujino H, Srinivasan D, Regan JW. Activation of FP pros-
tanoid receptor isoforms leads to Rho-mediated changes in cell
morphology and in the cell cytoskeleton. J Biol Chem 1999;274:
35944–9.
[7] Sales KJ, List T, Boddy SC, Williams AR, Anderson RA, Naor Z, et al. A
novel angiogenic role for prostaglandin F2alpha-FP receptor inter-
action in human endometrial adenocarcinomas. Cancer Res 2005;
65:7707–16.
[8] Narumiya S, Sugimoto Y, Ushikubi F. Prostanoid receptors: struc-
tures, properties, and functions. Physiol Rev 1999;79:1193–226.
[9] Boonyaprakob U, Gadsby JE, Hedgpeth V, Routh P, Almond GW.
Cloning of pig prostaglandin F2alphaFP receptor cDNA and expres-
sion of its mRNA in the corpora lutea. Reproduction 2003;125:53–64.
[10] Geisert RD, Zavy MT, Moffatt RJ, Blair RM, Yellin T. Embryonic
steroids and the establishment of pregnancy in pigs. J Reprod Fertil
Suppl 1990;40:293–305.
[11] Moeljono MP, Thatcher WW, Bazer FW, Frank M, Owens LJ,
Wilcox CJ. A study of prostaglandin F2a as the luteolysin in swine: II.
Characterization and comparison of prostaglandin F, estrogens and
progestin concentrations in utero-ovarian vein plasma of
nonpregnant and pregnant gilts. Prostaglandins 1977;14:543–55.
[12] Bazer FW, Thatcher WW. Theory of maternal recognition of preg-
nancy in swine based on estrogen controlled endocrine versus
exocrine secretion of prostaglandin F2a by the uterine endome-
trium. Prostaglandins 1977;14:397–400.
[13] Krzymowski T, Stefanczyk-Krzymowska S. The oestrous cycle and
early pregnancy–a new concept of local endocrine regulation. Vet J
2004;168:285–96.
[14] Waclawik A, Rivero-Muller A, Blitek A, Kaczmarek MM, Brokken LJ,
WatanabeK, et al. Molecular cloning and spatiotemporal expressionof
prostaglandin F synthase and microsomal prostaglandinE synthase-1
in porcine endometrium. Endocrinology 2006;147:210–21.
[15] Waclawik A, Ziecik AJ. Differential expression of prostaglandin (PG)
synthesis enzymes in conceptus during peri-implantation period
and endometrial expression of carbonyl reductase/PG 9-
ketoreductase in the pig. J Endocrinol 2007;194:499–510.
[16] Waclawik A, Jabbour HN, Blitek A, Ziecik AJ. Estradiol-17beta,
prostaglandin E2 (PGE2), and the PGE2 receptor are involved in
PGE2 positive feedback loop in the porcine endometrium. Endo-
crinology 2009;150:3823–32.
[17] Akinlosotu BA, Diehl JR, Gimenez T. Sparing effects of intrauterine
treatment with prostaglandin E2 on luteal function in cycling gilts.
Prostaglandins 1986;32:291–9.
[18] Christenson LK, Farley DB, Anderson LH, Ford SP. Luteal mainte-
nance during early pregnancy in the pig: role for prostaglandin E2.
Prostaglandins 1994;47:61–75.
[19] Waclawik A, Blitek A, Ziecik AJ. Oxytocin and tumor necrosis factor
alpha stimulateexpression of prostaglandin E2 synthase and secretion
of prostaglandin E2 by luminal epithelial cells of the porcine endo-
metrium during early pregnancy. Reproduction 2010;140:613–22.
[20] Waclawik A. Novel insights into the mechanisms of pregnancy
establishment: regulation of prostaglandin synthesis and signaling.
Reproduction 2011;142:389–99.
[21] Zavy MT, Bazer FW, Thatcher WW, Wilcox CJ. A study of prosta-
glandin F2a as the luteolysin in swine: V. Comparison of prosta-
glandin F, progestins, estrone and estradiol in uterine flushings from
pregnant and nonpregnant gilts. Prostaglandins 1980;20:837–51.
[22] Blitek A, Ziecik AJ. Prostaglandins F2
a
and E2 secretion by porcine
epithelial and stromal endometrial cells on different days of the
oestrous cycle. Reprod Domest Anim 2004;39:340–6.
[23] Blitek A, Morawska E, Kiewisz J, Ziecik AJ. Effect of conceptus
secretions on HOXA10 and PTGS2 gene expression, and PGE2
release in co-cultured luminal epithelial and stromal cells of the
porcine endometrium at the time of early implantation. Ther-
iogenology 2011;76:954–66.
[24] Zannoni A, Bernardini C, Rada T, Ribeiro LA, Forni M, Bacci ML.
Prostaglandin F2-alpha receptor (FPr) expression on porcine corpus
luteum microvascular endothelial cells (pCL-MVECs). Reprod Biol
Endocrinol 2007;5:31.
[25] Vallée M, Beaudry D, Roberge C, Matte JJ, Blouin R, Palin MF.
Isolation of differentially expressed genes in conceptuses and
endometrial tissue of sows in early gestation. Biol Reprod 2003;69:
1697–706.
[26] Dozois CM, Oswald E, Gautier N, Serthelon JP, Fairbrother JM,
Oswald IP. A reverse transcription-polymerase chain reaction
method to analyze porcine cytokine gene expression. Vet Immunol
Immunopathol 1997;58:287–300.
[27] Andersen CL, Jensen JL, Ørntoft TF. Normalization of real-time
quantitative reverse transcription-PCR data: a model-based vari-
ance estimation approach to identify genes suited for normalization,
applied to bladder and colon cancer data sets. Cancer Res 2004;64:
5245–50.
[28] Bradford MM. A rapid and sensitive method for the quantitation of
microgram quantities of protein utilizing the principle of protein-
dye binding. Anal Biochem 1976;72:248–54.
[29] Waclawik A, Blitek A, Kaczmarek MM, Kiewisz J, Ziecik AJ. Anti-
luteolytic mechanisms and the establishment of pregnancy in the
pig. Soc Reprod Fertil Suppl 2009;66:307–20.
[30] Dorniak P, Bazer FW, Spencer TE. Prostaglandins regulate conceptus
elongation and mediate effects of interferon tau on the ovine
uterine endometrium. Biol Reprod 2011;84:1119–27.
[31] Erdem H, Guzeloglu A. Effect of meloxicam treatment during early
pregnancy in Holstein heifers. Reprod Domest Anim 2010;45:
625–8.
[32] Kraeling RR, Rampacek GB, Fiorello NA. Inhibition of pregnancy with
indomethacin in mature gilts and prepuberal gilts induced to
ovulate. Biol Reprod 1985;32:105–10.
[33] Kaczmarek MM, Waclawik A, Blitek A, Kowalczyk AE, Schams D,
Ziecik AJ. Expression of the vascular endothelial growth factor –
receptor system in the porcine endometrium throughout the oes-
trous cycle and early pregnancy. Mol Reprod Dev 2008;75:362–72.
[34] Atli MO, Kurar E, Kayis SA, Aslan S, Semacan A, Celik S, et al. Eval-
uation of genes involved in prostaglandin action in equine endo-
metrium during estrous cycle and early pregnancy. Anim Reprod Sci
2010;122:124–32.
[35] Fortier MA, Arosh JA, Banu SA, Chapdelaine P. Temporal and tissue-
specific expression of prostaglandin receptors EP2, EP3, EP4, FP, and
cyclooxygenases 1 and 2 in uterus and fetal membranes during
bovine pregnancy. Endocrinology 2004;145:407–17.
[36] Yallampalli C, Dong YL. Pregnancy and exogenous steroid treat-
ments modulate the expression of relaxant EP(2) and contractile FP
receptors in the rat uterus. Biol Reprod 2000;62:533–9.
[37] Geisert RD, Brenner RM, Moffatt J, Harney JP, Yellin T, Bazer FW.
Changes in oestrogen receptor protein, mRNA expression and
localization in the endometrium of cyclic and pregnant gilts. Reprod
Fertil Dev 1993;5:247–60.
P. Kaczynski, A. Waclawik / Theriogenology 79 (2013) 784–790790
