Content uploaded by Achim Jörres
Author content
All content in this area was uploaded by Achim Jörres
Content may be subject to copyright.
Content uploaded by John D. Williams
Author content
All content in this area was uploaded by John D. Williams
Content may be subject to copyright.
2192 Volume 7 .Number 10 .1996
Establishment and Functional Characterization of Human
Peritoneal Fibroblasts in Culture: Regulation of Interleukin-#{243}
Production by Proinflammatory Cytokine&
Achim J#{244}rres,2Klaus Ludat, Janine Lang, Kai Sander, Gerhard M. GahI, Ulrich Frei, Koen DeJonge,
John D. Williams, and Nicholas Topley
A. J#{244}rres, K. Ludat, K. Sander, GM. GahI, U. Frei,
Abteilung fCr Innere Medizin mit Schwerpunkt Neph-
rologie und lnternistische lntensivmedizin, Virchow-
Klinikum. Berlin. Germany
K. DeJonge. Abteilung fCr Chirurgie. Virchow-Klinikum,
Berlin, Germany
J. Lang. J. D. Williams, N. Topley, Institute of Nephrol-
ogy. K.R.U.F., University of Wales College of Medicine,
Royal Infirmary, Cardiff, Wales, United Kingdom
(J. Am. Soc. Nephrol. 1996; 7:2192-2201)
ABSTRACT
The functional and morphologic integrity of the pen-
toneal membrane is of major importance for the
successful treatment of patients with chronic perito-
neal dialysis. This study aimed at the establishment
and functional characterization of human peritoneal
fibroblasts (HPFB) in cell culture. HPFB were isolated
from human omentum by enzymatic digestion and
cultured. Confluent HPFB could be identified as spin-
dIe-shaped cells, growing in parallel arrays and
whorls which stained positive for vimentin and nega-
tive for factor VIII, cyfokeratin 18, and desmin. Maxi-
mum cell growth was observed after 24 h in medium
supplemented with 10% fetal calf serum. HPFB could
be growth arrested and maintained in fetal calf se-
rum-depleted medium (0. 1%) for >48 h without loss of
cell viability as evaluated by intracellular AlP deter-
mination. Stimulation of resting HPFB for 0.5 to 48 h with
increasing doses of interleukin (lL)-i3 and/or tumor
necrosis factor-a (1 to 10,000 pg/mL) resulted in a
dose- and time-dependent induction of lL-6 messen-
ger RNA and an increase in immunoreactive IL-6
protein secreted into HPFB supernatants, which was
significant with IL-i j3 or tumor necrosis factor-a doses
as low as 1 pg/mL. HPFB IL-6 production could be
inhibited by both actinomycin D or cycloheximide,
which suggests that the induction of lL-6 occurs both
on a transcriptional and a post-transcriptional level. In
1Received November 2, 1995. Accepted May 20, 1996.
2Correspondence to Dr. A. J#{244}rres,Abteilung f#{252}rInnere Medizin mit Schwerpunkt,
Nephrologie und lnternisfische Intensivmedizin. Virchow-Klinlkum, Augusten-
burger Platz 1, 0-13353 Berlin, Germany.
1046-6673/07 10-2 192$03.OO/O
Journal of the American Society of Nephroiogy
Copyright C 1996 by the American 5ociety of Nephroiogy
summary, this cell culture model is expected to facil-
itate further investigation of the potential role of the
HPFB in the penitoneal cytokine network of patients
treated with chronic peritoneal dialysis.
Key Words: Human peritoneal fibroblasts. cell culture, cyto-
kines, interleukin-6, peritoneal dialysis
The increasing use of peritoneab dialysis as a form
of chronic renal replacement therapy has focused
attention on the functional integrity of the penitoneal
membrane, which serves as the permeability barrier
across which ultrafiltration and dialysis occur. Dam-
age to it may result in interstitial thickening and
sclerosis, potentially leading to boss of ultrafiltration
and solute transport capacity and, ultimately, treat-
ment failure.
Continuous ambulatory penitoneab dialysis (CAPD)
therapy in itself appears to lead to a certain degree of
penitoneal membrane damage because CAPD pa-
tients, unlike uremic patients on hemodialysis or
without renal replacement therapy, show significant
abnormalities in peritoneal membrane morphology,
the predominant finding being peritoneab fibrosis (1-
3). Moreover, biopsies of parietab penitoneum of CAPD
patients show ubtrastructural alterations of the me-
sothebium, e.g. , a substantial decrease of surface mi-
cnovibli (4-6). The mechanisms leading to these struc-
tural changes are presently unknown; however, it has
been suggested that these alterations might be related
to the number of peritonitis episodes (7). In clinical
CAPD, however, “sclerosing peritonitis” or gross fibro-
sis constitute relatively rare events. The fact that in
some patients loss of penitoneal clearance and/or
ultrafiltration capacity occurs without a relevant his-
topathobogic correlate suggests that even mild struc-
tune dysregulation ofthe penitoneab membrane and/or
subtle changes of penitoneal membrane cell function
are clinically relevant.
Although little direct information regarding the rel-
ative importance of the two major resident cell types in
the peritoneum, the fibrobbasts and the mesothelial
cells, is available, it is reasonable to assume that both
cell types are among the main targets of inflammatory
mediators produced by peritoneal macrophages and
infiltrating neutrophils during peritonitis episodes,
reacting to stimulation with proliferation and produc-
tion of extraceblubar matrix components. In addition,
earlier work in pleural or penitoneal mesothelial cells
and pulmonary, synovial, or dermal fibroblasts from
men or experimental animals demonstrated that these
Jzres et al
Journal of the American Society of Nephrology 2193
cells are capable of producing various types of im-
mune mediators in response to stimulation, which
suggests that both cell types may also play an active
role in the regulation of inflammatory events (8-16).
Whereas the importance of the mesothebiab cell for
the regulation of peritoneab host defense seems to be
established ( 1 7-20), very little information about the
role of the peritoneal fibroblast in this context is
available to date. We therefore established a cell-
culture model by using human peritoneal fibrobbasts
(HPFB). Upon stimulation with macrophage-derived
cytokines [intenbeukin (IL)- 1 /3, tumor necrosis factor-a
(TNFa)J these cells produce IL-6 in a dose- and time-
dependent manner as a result of transcriptional and
post-transcriptional activation, suggesting that HPFB
may indeed play a significant robe in the cytokine
network regulating penitoneab inflammation.
METHODS AND MATERIAL
All chemicals were obtained from Sigma Chemical Com-
pany (Deisenhofen, Germany) unless otherwise stated.
Crude trypsin was obtained from Difco (Detroit, MI).
The fibroblasts were cultured in a humidified atmosphere,
5% CO2/95% air at 37#{176}C,with Ham’s F12 medium (ICN/
Flow, Meckenheim, Germany), supplemented with penicillin
( 100 U/mL), streptomycin (100 g/mL), L-gbutamine (2 mM),
insulin (0.5 jtg/mL), transferrin (0.5 .tg/mL), hydrocortisone
(0.4 .tg/mL); 0. 15 M N-2-hydroxyethylpiperazine-N’-2-eth-
anesulfonic acid (HEPES) buffer (Gibco BRL. Berlin, Ger-
many) and 10% vol/vol fetal calf serum (FCS) (Gibco BRL).
The pH was adjusted to 7.3 to 7.4 by adding 1 M NaOH.
The culture vessels (25-cm2 and 75-cm2 culture flasks,
six-, 24-, and 96-mubtiwell plates; Falcon Labware, Lincoln
Park, NJ) were coated with rat tail collagen type I as de-
scribed previously (21,22).
Preparation and Maintenance of Primary HPFB
Cultures
Human omental tissue was obtained from consenting pa-
tients undergoing abdominal surgery. The enzymatic disag-
gregation of tissue was modified from Stybianou et at. (22).
Omental specimens were handled under sterile conditions,
washed three times in phosphate-buffered saline (PBS; Bio-
chrom, Berlin, Germany) and pieces approximately 10 cm2 in
size were incubated in 15 mL trypsin/EDTA/glucose
(0.125%/0.01%/0.1 wt/vol in PBS) for 20 mm at 37#{176}C.The
suspension was centrifuged at 180 X gand 4#{176}Cfor 5 mm.
The remaining tissue and trypsmn/EDTA/glucose solution
were removed and the pelleted cells were washed twice
(180 X 9 at 4#{176}Cfor 5 mm) in cell-culture medium containing
10% FCS to inhibit the trypsin activity. The trypsin/EDTA
digestion was repeated once for 20 mm after by two more
digestion steps of 40 mm each. The cells obtained during
each disaggregation step were resuspended in 5 mL cell-
culture medium and transferred to 25-cm2 culture flasks.
The primary cultures were incubated at 37#{176}C,and the me-
dium was exchanged after 24 h for the first time and every
third day thereafter.
Passage of Cell Cultures
Confluent cell cultures were subcubtured as follows: the
cell cultures were washed with PBS and incubated with
trypsmn/EDTA/glucose solution (0. 125% /0.01 % /0. 1 %, wt/
vol). The detachment of cells was observed by light micros-
copy and the trypsin activity inhibited by adding FCS-sup-
plemented culture medium thereafter. The cells were washed
twice in FCS-supplemented culture medium and seeded into
new collagen-coated culture flasks at one third of the density
of the previous culture.
Establishment of Growth-Arrested HPFB
For the establishment of resting, nonproliferating cell cul-
tures, HPFB were grown to confluence in 24-well plates and
incubated in Ham’s F12 medium without FCS for 48 h.
Subsequently, the cells were washed and incubated in Ham’s
F12 medium with increasing FCS concentrations (0 to 10%
vol/vol). [3Hlthymidine (100 tL 25 nM, specific activity 6.3
Ci/mM: NEN Products, Dreieich, Germany) was added to the
wells at the indicated time interval (0 to 48 h) for a 24-h pulse
period. The cells were then washed in medium containing
thymidmne and solubilized with 0. 1 NNaOH. Aliquots were
taken for scintillation counting and quantification of total
cell protein. The total cell protein was estimated by the
modified Bradford method (23).
For the assessment of cell viability under FCS-depleted
conditions, HPFB were seeded in 96-well plates, grown to
confluence, washed four times in Ham’s F12 medium con-
taming 0% to 10% FCS, and incubated at 37#{176}Cfor the
indicated periods (0 to 48 h).
As an indirect measure of cell viability, the cellular ATP
content was evaluated by using the ATP bioluminescence
CLS test (Boehringer, Mannheim, Germany). After the re-
moval of the cell culture supernatant. ATP was released from
the cells after the indicated time interval by benzalconium-
chloride (1 mg/mL)/EDTA ( 10 mM) and stabilized in HEPES/
EDTA buffer (25 mM HEPES, 10 mM EDTA, pH 7.4). The
bioluminescence was measured with a luminometer model
1 250 (LKB-Pharmacia, Freiburg, Germany) after adding the
luminescence reagent to the samples (1:1 v/v). The mea-
sured value of relative light intensity (RLI) was proportional
to the ATP concentration.
Identification and Characterization of HPFB
The morphologic identification of HPFB was performed by
phase-contrast microscopy.
Indirect immunofluorescence was performed as previously
described for human peritoneal mesothelial cells (22). The
primary antibodies tested were anticytokeratmn 18 monoclo-
nab antibody (diluted 1:800 vol/vol), antivimentin monoclo-
nal antibody (diluted 1 :200 yol/vol), antifactor VIII antibody
(diluted 1 :50 vol/vol), and antidesmin antibody (diluted 1:50
vol/vol): these antibodies were obtained from Dako Ltd.,
Bucks, UK. The second antibody was a rabbit antimouse
fluorescemn isothiocyanate conjugate diluted 1 :500 vol/vol
(Sigma).
HPFB were grown to confluence in eight-well chamber
slides (Nunc. Wiesbaden, Germany), fixed in ice-cold meth-
anob/acetone(1:1 vol/vol)for 10 mm, and washed IPBS/BSA
(0. 1 %)I. The cells were incubated with 50 .tL of the primary
antibody diluted in PBS/BSA for 60 mm at room temperature
in a humidified chamber. After being washed, they were
incubated with 50 tL of the secondary antibody diluted in
PBS/BSA for 60 mm at room temperature in a humidified
atmosphere, extensively washed again, coverslipped (tris-
buffered 10% glycerol), and examined under ultraviolet light.
Human Peritoneal Fibroblast Cell Culture
2i 94 Volume 7 .Number 10 .1996
Stimulation of HPFB with Recombinant
Cytokines
HPFB monolayers were grown to confluency in collagen-
coated 24-well plates and growth-arrested for 24 h in culture
medium containing 0. 1 % FCS, washed four times with rest
medium, and incubated at 37#{176}Cin the presence of increasing
doses (1 to 10,000 pg/mL) of recombinant human TNFa
and/or IL-lfi for up to 48 h. At the indicated time intervals,
HPFB supernatants were removed, centrifuged at 3000 X g,
and stored at -20#{176}Cuntil further analysis. The remaining
cell monolayers were washed with PBS and solubilized with
0. 1 NNaOH for estimation of total protein. Incubation of
HPFB with recombinant cytokmnes ( 1 to 10,000 pg/mL) for up
to 48 h did not affect cell viability or the levels of total cellular
protein as compared with cells treated with medium alone
(data not shown).
Additional experiments were performed premncubating the
HPFB with either cycloheximide ( 1 to 10 g/mL) or actino-
mycin D (0. 1 to 10 ig/mL) for 30 mm at 37#{176}C(both obtained
from Calbiochem, Frankfurt, Germany) before cytokine stim-
ulation.
RNA Isolation and Reverse Transcription
Total RNA was isolated from HPFB by using the RNAzol
method according to the instructions of the manufacturer
(Cinna-Biotecx Laboratories, Houston, TX). One microgram
of total RNA was heat-denaturated at 95#{176}Cfor 3 mm in the
presence of 100 pM random hexamer (Pharmacia, Freiburg.
Germany) and cooled on ice for 2 mm. The RNA was reverse-
transcribed in a final volume of 20 L of 1 x polymerase chain
reaction (PCR) buffer 110 nM Tris (pH 8.3), 50 mM KCI, 1.5
mM MgCl2. 0.001 % gelatmnl and 625 .tg ofdNTP (Boehringer),
20 U of RNAsin (Promega, Heidelberg, Germany), 10 mM
dithiothreitol, and 200 U of MMuLV reverse transcriptase
(Gibco-BRL). The reaction mixture was incubated for 10 mm
at room temperature, 45 mm at 42#{176}C,and 5 mm at 95#{176}C.
Amplification of cDNA by PCR
PCR amplification of cDNA was carried out in a total
volume of 50 j.L [2 j.L of reverse-transcription product and
48 j.tL master mix (36.25 iL H2O, 1 .25 jiL 3-primer (20 .tM),
1 .25 iL 5’ -primer (20 jtM). 4 L nucleotide triphosphate. 5
L lOx PCR buffer, and 0.25 .tl Taq polymerase (2.5 U.
Amplitaq: ILS Ltd., London, Engband)1 with a model 480
thermocycler (Perkmn-Elmer. Uberlingen. Germany). The PCR
protocol was: first cycle, 94#{176}Cfor 3 mm, 55#{176}Cfor 1 mm, 72#{176}C
for 1 mm; second through 24th cycle (a-actin) or 34th cycle
(IL-6). 94#{176}Cfor 1 mm. 55#{176}Cfor 1 mm, 72#{176}Cfor 1 mm. The
final cycle was 94#{176}Cfor 1 mm and 60#{176}Cfor 10 mm.
One tenth of the PCR reaction product was separated by
electrophoresis on 1 .5% agarose gels, stained with ethidium
bromide, and photographed. The negatives were scanned
and evaluated by densitometry (Scanpack; Biometra, GOttin-
gen, Germany). and the relative density of the IL-6 transcript
was compared with the respective actin controls.
Oligonucleotide Primers for PCR
Oligonucleotide primers were generously provided by Dr.
Peter Scholz, Schering AG. Berlin, Germany. The sequences
of the amplification primers are shown in Table 1.
Enzyme Immunoassay for IL-6
IL-6 was determined as described previously (26). In brief,
the enzyme immunoassay for IL-6 used microtiter strips
TABLE 1 .Amplification Primer Sequences
Gene Primers Product
Size References
IL-6 TACATCCTCGACGGCATCTC
GCTACA11TGCCGAAGAGCC 465 bp 24
a-Actin GGAGCAATGATC1TGATC1T
TCCTGAGGTACGGGTCC1TCC 204 bp 25
(Nunc, Wiesbaden, Germany) coated with an affinity-purified
polycbonal rabbit antimouse IgG antibody (Dakopatts, Ham-
burg, Germany) followed by a mouse monocbonal antihuman
bL-6 antibody (Serva, Heidelberg, Germany). IL-6 in samples
and standards was detected by a sequence of incubations
with: (1 ) a polyclonal antihuman IL-6 antibody coupled to
biotin (R&D Systems, Minneapolis, MN); (2) horseradish
peroxidase-streptavidmn (Calbiochem, Frankfurt, Germany),
and (3) tetramethyb benzidmne substrate buffer for color de-
vebopment (Fluka, Buchs, Switzerland). The IL-6 content of
the samples was calculated from a standard curve with
recombinant human IL-6 standards (Janssen. Beerse, Bel-
gium) ranging from 20 to 2000 pg/mL.
The lower detection limit of the assay was 20 pg/mL. No
crossreactivity with recombinant TNFa, TNFf3, IL- 1 a, IL- 1 f3,
IL-2, IL-3, or IL-4 was observed when these cytokines were
added to blank samples in concentrations up to 50 ng/mL
(recombinant cytokines were obtained from British Biotech-
nobogy, Oxford, UK).
Statistical Analysis
All statistical analyses were performed by using the Wil-
coxon signed-ranks matched-pairs test for nonparametric
data. A two-sided Pvalue of less than 0.05 was considered to
be significant. All data are presented as mean ±SD.
RESULTS
Cell Culture
The enzymatic disaggregation of human omentum
yielded homogeneous mesothelial cells during the first
incubation period and caused an increasing release of
fibrobbasts during further trypsin/EDTA/gbucose
treatment. From the third cycle HPFB were harvested
without contamination of mesothelial and other cells,
as assessed by phase-contrast microscopy. Increasing
the time of enzyme exposure to 40 mm resulted in a
higher yield of viable cells per cycle. The repeated
enzymatic digestion of omentab tissue was performed
four times, thereafter the number of released cells
decreased and the plated cell cultures did not grow to
confluency because of the small number of HPFB.
After more than three cell passages, a marked de-
crease in cell proliferative capacity was noted, and,
beyond Passage 4, cells began to display morphologic
alterations. For this reason, only Passage 2 and 3 cells
were used for the various incubation experiments.
Phase-Contrast Microscopy and Indirect
Immunofluorescence
Human penitoneab fibroblasts in cell culture ob-
served by phase-contrast microscopy assumed a bi-
Jrres et al
Journal of the American Society of Nephrology 2195
polar or mubtipolar shape with distinct cell borders
and were well spread on the culture surface. At con-
fluency, HPFB were identified as bipolar or spindle-
shaped, less spread, and growing in parallel arrays
and whorls with overlapping between individual cells
(Figure 1).
Immunofluorescence staining of routine HPFB cul-
tunes characterized these cells by their positive stain-
ing for vimentin and the absence of staining for cyto-
keratin 18, factor VIII, and desmin.
Growth Cycle and Viability of HPFB
Incubation of resting HPFB with 1 % or 10% FCS
resulted in a significant increase of l3Hlthymidine
incorporation with a proliferation maximum at 24 h,
thereafter decreasing again. No significant increase in
E3Hlthymidine incorporation was observed in HPFB
incubated in medium without FCS or 0. 1 % FCS (Fig-
ure 2).
At the same time, no significant decrease in cellular
ATP content could be observed in cells incubated in
either FCS concentration over a 48-h period. With the
highest FCS concentrations (1% to 10%) ATP concen-
trations tended to increase after 24 h, probably re-
flecting increasing ATP turnover as a consequence of
cell proliferation (Figure 3).
Induction of lnterleukin-6 mRNA in
Cytokine-Stimulated HPFB
Unstimulated resting HPFB constitutiveby ex-
pressed a single 465-bp transcript specific for IL-6.
The stimulation of resting HPFB with recombinant
IL-1j3 and/on TNFa resulted in the time-dependent
increase in steady-state IL-6 mRNA expression (Figure
4). Maximum IL-6 mRNA induction was observed after
12 h of stimulation with 100 pg/mL IL- 1f3 (Figure 5).
Release of IL-6 by Cytokine-Stimulated HPFB
Unstimulated nonproliferating HPFB released IL-6
in small but detectable quantities into the culture
medium. Stimulation with IL- 13 (100 pg/mL), TNFa
(1000 pg/mL), or the combination thereof resulted in
Figure i.Confluent cell cultures of human peritoneal fibroblasts (left) and human peritoneal mesothelial cells (right). HPMC
appear polygonal, whereas HPFB are spindle-shaped cells, growing in parallel, whorl-forming arrays (phase-contrast micros-
copy; original magnification, x iOO).
4000-
3000-
5 2000-
1000-
0-
*
0-p r-i UI‘I
6 12 24 36 48
Human Peritoneal Fibroblast Cell Culture
2i96 Volume 7 .Number 10 .1996
13
.FCSIO%
--FCSI%
.FCSO.1%
EFCS 0%
Incubation time (hours)
Figure 2. Growth cycle of HPFB. Twenty-four hour (3H)thymidine incorporation of nonproliferatlng HPFB after Incubation with 0%
to iO% FCS-supplemented medium. Data are mean ±SD, N=6, <0.05 versus 0.5 h incubation period at the corresponding
FCS concentration and versus 0% FCS at the corresponding time point.
a time-dependent increase of IL-6 release, which was
statistically significant after 6 to 12 h of incubation
(Figure 6). Stimulation of HPFB for 24 h with increas-
ing doses of IL- 1 f3 or TNFa resulted in a dose-depen-
dent increase of IL-6 secretion, which was significant
with doses as low as 1 pg/mL of either cytokine
(Figure 7). The stimulation of HPFB with combined
doses of IL- 1 f3 and TNFa showed an additive effect on
IL-6 release (Figure 8).
The induction of IL-6 secretion by IL- 1 3 was signif-
icantly reduced after preincubation with cycbohexi-
mide or actmnomycin D (Figure 9). The incubation of
HPFB with cycboheximide or actmnomycmn D (0. 1 to 10
g/mL) for up to 48 h did not affect cell viability or the
bevels of cellular protein per well as compared with
cells treated with medium alone (data not shown).
DISCUSSION
Peritoneal host defense in peritoneab dialysis is be-
bieved to be regulated by a complex network of inter-
actions between peritoneal macrophages, infiltrating
neutrophils, and resident peritoneal cells such as
mesothebial cells. In addition, several lines of evidence
indicate that fibrobbasts not only act as the target for
promnflammatory stimuli, but also have the potential
to actively contribute to the control of penitoneal in-
flammation. With fibroblasts from extraperitoneal
sources, it was indeed shown earlier that these cells
are capable of producing a variety of immune media-
tons upon stimulation. In this respect, human dermal
fibroblasts have been reported to release different
chemotactic peptides related to IL-8 upon stimulation
with IL- 1 or TNF ( 13). They also secrete multimenic
forms of IL-6 that are biologically active (27). In addi-
tion, IL- 1 and TNF synergistically induce IL- 1 j3 gene
transcription in fibroblasts; the accumulation of IL- 1 j3
mRNA, however, is not associated with release of
soluble IL- 1 f3 protein ( 1 2). In the setting of peritoneab
dialysis it is important to note that cellular responses
of fibnoblasts can not only be elicited by cytokines, but
also by matrix-mediated signals (28). In addition, it
has already been shown that spent overnight penito-
neal dialysate exhibits marked mitogenicity toward
cultured mouse and human fibroblast cell lines (29).
In contrast, unused commercial CAPD fluids were
shown to exert a marked cytotoxicity toward cultured
L-929 fibroblasts (30). These findings underline the
potential importance of the fibrobbast in peritoneal
dialysis; however, direct evidence by use of fibroblasts
from human peritoneum is still essentially lacking.
To create a useful tool for the further elucidation of
the potential robe of the fibroblast in penitoneal host
defense this study set out to establish and character-
ize a cell-culture model with penitoneab fibroblasts
isolated from human omentum obtained during rou-
tine abdominal surgery. Although it must be remem-
bered that omental cells are not necessarily represen-
tative of the peritoneum as a whole, omentum has also
U)
C
C)
Cu
>
04)
0
20000-
15000-
10000.
5000.
0
.FCSIO%
-c---FCS 1%
UFCSO.1%
-c-- FCS 0%
03I, ‘I‘I‘I‘I
6 12 24 36 48
Incubation time (hours)
Jares et at
Journal of the American Society of Nephrology 2i97
Figure 3. VIability of HPFB cultured in growth medium supplemented with the indicated FCS concentration. The data presented
are the cellular AlP content expressed as relative light intensity (RLI) from six separate experiments with HPFB obtained from
different omental specimens.
IL-6
a-Actin
Control TNFct (1000 pg/mI) IL-13 (100 pg/mI)
cDNA 0.5 3 6 12 24 48 cDNA 0.5 3 6 12 24 48 cDNA 0.5 3 6 12 24 48 hours
Figure 4. Time course of IL-6 mRNA induction after cytokine stimulation of HPFB. Negatives of PCR gels show the expression of a
465-bp transcript specific for IL-o and of a 204-bp transcript specific for a-actin serving as internal control. (One representative
gel of experiments performed with three different cell lines is shown.)
been widely accepted as a routine source for human
peritoneal mesothebial cell culture (17-19,22).
The fibroblasts were identified by light microscopy
and further characterized by indirect immunofluores-
cence. Because specific positive markers for perito-
neal fibnoblasts were presently not available, markers
that allowed the distinction of the HPFB cultures from
mesothelial cells (cytokeratin 18), smooth muscle cells
(desmin), and microvascular endothelial cells (factor
VIII) were chosen. The evaluation of their growth cycle
under different culture conditions was specially em-
phasized to establish reproducible conditions under
which HPFB were growth-arrested, but still remained
viable for prolonged incubation periods. Because the
proliferation maximum of HPFB was shown to be at
24 h after stimulation with FCS (1 to 10%), a period of
2.
1
I
0.5
0. 0.5 3 6
Control
FWA lL-13 (100 pg/mI)
IITNFa (1000 pg/mI)
Incubation time (hours)
Figure 5. Time course of lL-o mRNA induction after cytokine stimulation of HPFB (densitometry of negatives shown in Figure 4).
Unstimulated HPFB constitutively express IL-6 mRNA. Steady-state IL-6 mRNA expression is upregulated after stimulation with IL-ip
and/or TNFa.
. IL-.1+ThFa
-- IL- I (1 00 pg/mI)
UThFo (1000 pg/mI)
12 24 48
50
00 3 6 12 24 36 48
Human Peritoneal Fibroblast Cell Culture
2i 98 Volume 7 .Number 10 .1996
C
C.)
P
(9
-I
0
I-
ci
a
C
G)
0
I..
0.1
C.)
D)
C,
0.
(0
Incubation time (hours)
Figure 6. Time course of IL-6 protein secretion after cytokine stimulation of HPFB. Data presented are the mean ±SD from six
experiments with HPFB from different omental specimens. Asterisks represent significant differences (* P<0.05) compared with
unstimulated HPFB.
48 h in a rest medium containing 0. 1 % FCS was
chosen to synchronize all HPFB in a quiescent state
before the cytokine stimulation experiments. Under
these conditions, the HPFB remained viable for more
than 48 h; that is, the maximum period chosen for
stimulation experiments.
Resting HPFB were then subjected to stimulation
experiments with human recombinant IL-1f3 and/or
TNFa. Both cytokines are believed to be secreted by
activated peritoneal macnophages during peritoneal
inflammation and to represent important early signals
for the activation of resident peritoneal cells
(20,31,32). As shown earlier for mesothelial cells (18),
HPFB in culture constitutively express IL-6 mRNA and
**
**
**
lL-13
ThEa
**
*
Cytokine dose (pg/mI)
I 50
125
I 10 100 1000 10000 1 10 100 1000 10000
pg/mi IL-i 1 +I 00 pg/mI TNFc pg/mI TNFa +100 pg/mi IL-I
Jares et al
Journal of the American Society of Nephrology 2i99
C
C,
0
0.
C,
C.,
C)
C)
0.
(0
-I
Figure 7. Dose-dependent release of lL-6, expressed in
pg/1Lg cell protein from HPFB, stimulated with the indicated
concentration of IL-ip or TNFa for 24 h. Data presented are
the mean ±SD from nine experiments with HPFB from
different omental specimens. Asterisks represent significant
differences (* P<0.05; ** P<0.01) compared with unstimu-
lated HPFB.
secrete small amounts of immunoreactive IL-6 pro-
tein. Upon stimulation with IL-1f3 and/orTNFa, secre-
tion ofimmunoreactive IL-6 could be greatly enhanced
in a dose- and time-dependent manner. The cytokine
doses required for significant induction of IL-6 secre-
tion were as low as 1 pg/mL. In this respect it is
important to note that the bevels of IL- 1 3 and TNFa
which have been detected in the penitoneal effluent of
infected CAPD patients are in the lower picogram
range, whereas IL-6 and IL-8 increases reported under
these conditions are in the upper nanogram range
(33-35).
On the cellular level we observed an induction of
steady-state IL-6 mRNA after cytokine stimulation.
Experiments with the transcription inhibitor actino-
mycmn D and the translation inhibitor cycboheximide.
however, suggest that the induction of IL-6 synthesis
by cytokmnes is operative both on a transcriptional and
a post-transcriptional level.
In summary, our data suggest that the penitoneal
fibroblast may not only act as a target for promnflam-
matory stimuli during penitoneal infection, but may be
actively involved in the penitoneab cytokine network by
secretion of immunologically active molecules. This
0
0.
C.)
0)
C,
0.
(9
-j
Figure 8. Effect of combined cytokine stimulation (IL-ip, i to 10,000 pg/mL plus TNFa, iOO pg/mL; and TNFa, i to iO,000 pg/mL
plus IL-if3, iOO pg/mL) on IL-6 release from HPFB (mean ±SD, N=6). The predicted values are mean levels calculated from the
results of the stimulation experiments with IL-i p and TNFa alone. The differences between predicted and measured values did
not reach statistical significance.
*
EJActinoniycin D
Cycloheximide
*
0 1 510
Human Peritoneal Fibroblast Cell Culture
2200 Volume 7 .Number 10 .1996
0)
0
0.
a)
C.)
C)
C)
0.
(0
j
Inhibitor dose (pg/mI)
Figure 9. Inhibition of IL-6 release from lL-13 (i000 pg/mL,
24 h)-stimulated HPFB by cycloheximide and actinomycin D
(i to 10 g/mL). Data presented are the mean ±SD of IL-6
release expressed as pg/g cell protein from six experi-
ments with HPFB from different donors. Asterisks represent
significant differences (* P<0.05; ** P<0.01) compared
with stimulated HPFB without inhibitor.
cell-culture model is expected to contribute further to
our understanding of the processes involved in peri-
toneal inflammation and fibrosis.
ACKNOWLEDGMENTS
The authors acknowledge the expert technical assistance of Mrs.
Sibylle FrOhllch and Mrs. Barbara Mauder. This work was supported
by a grant from the Baxter Extramural Grant Program.
REFERENCES
1.Pollock CA, Ibels LS, Eckstein RP, et at.: Peritoneal
morphology on maintenance dialysis. Am J Nephrol
1989;9: 198-204.
2. Verger C, Bnunschvicg 0, Le Charpentier Y, Lavergne A,
Vantebon J: Structural and ultrastructural peritoneal
membrane changes and permeability alterations during
continuous ambulatory peritoneal dialysis. Proc Eur Diai
Transplant Assoc 198 1 ;18:199-205.
3. Dobbie JW: Pathogenesis of peritoneal fibrosing syn-
dromes (sclerosing peritonitis) in peritoneal dialysis.
Pent Dial mt 1992:12:14-27.
4. Di Paobo N, Sacchi G, De Mia M, et at.: Morphology of the
peritoneal membrane during continuous ambulatory
peritoneal dialysis. Nephron 1986:44:204-211.
5, Dobbie JW, Lloyd JK, Gal! CA: Categorization of ultra-
structural changes in penitoneal mesothelium, stroma
and blood vessels in uremia and CAPD patients. Adv
Pent Dial 1990;6:3-l2.
6. Dobbie JW: Morphology of the peritoneum in CAPD.
Blood Purif 1989:7:74-85.
7. Rubin J, Herrera GA, Collins D: An autopsy study of the
peritoneal cavity from patients on continuous ambula-
tory peritoneal dialysis. Am J Kidney Dis 1991:18:97-
102.
8. Lanfrancone L, Boraschi D, Ghiara P. et aL :Human
peritoneal mesothelial cells produce many cytokmnes
(granulocyte colony-stimulating factor (CSF), granubo-
cyte-monocyte-CSF, macrophage-CSF, interleukmn- 1 (IL-
1), and IL-6) and are activated and stimulated to grow by
IL-i. Blood 1992:80:2835-2842.
9. Jonjic N, Pen G, Bernasconi S. et at.: Expression of
adhesion molecules and chemotactic cytokines in cul-
tured human mesothelial cells. J Exp Med 1992:176:
1165-1174.
10. Larsen CG, Anderson AO, Oppenheim JJ, Matsushima
K: Production of interleukin-8 by human dermal fibro-
blasts and keratinocytes in response to mnterbeukin- 1 or
tumour necrosis factor. Immunology 1989;68:31-36.
1 1 .Nakagawa H, Ikesue A, Hatakeyama S, et aL: Production
of an interleukmn-8-bike chemokine by cytokine-
stimulated rat NRK-49F fibroblasts and its suppression
*by anti-inflammatory steroids. Biochem Pharmacol
-.- 1993:45:1425-1430.
1 2. Elias JA, Reynolds MM, Kotboff RM, Kern JA: Fibroblast
interleukmn 1 beta: Synergistic stimulation by recombi-
nant mnterleukmn 1 and tumor necrosis factor and post-
transcriptional regulation. Proc Natl Acad Sci USA 1989;
86:617 1-6 175.
13. Schr#{246}der JM, Sticherling M, Henneicke RH, Preissner
WC, Christophers E: IL- 1 alpha or tumor necrosis fac-
tor-alpha stimulate release of three NAP- 1 /IL-8-related
neutrophib chemotactic proteins in human dermal fibro-
blasts. J Immunol 1990; 144:2223-2232.
14. Mielke V, Bauman JG, Sticherling M, Ct at.: Detection of
neutrophil-activating peptide NAP/IL-8 and NAP/IL-8
mRNA in human recombinant IL- 1 alpha- and human
recombinant tumor necrosis factor-alpha-stimulated
human dermab fibroblasts. An immunocytochemicab and
fluorescent in situ hybridization study. J Immunol 1990:
144: 153-16 1.
15. Rathanaswami P, Hachicha M, Sadick M, Schall TJ,
McColl SR: Expression of the cytokine RANTES in hu-
man rheumatoid synovial fibroblasts. Differential regu-
lation of RANTES and mnterleukmn-8 genes by mnflamma-
tory cytokines. J Biol Chem 1993:268:5834-5839.
16. Rolfe MW, Kunkeb SL, Standiford TJ, et at.: Expression
and regulation of human pulmonary fibroblast-derived
monocyte chemotactic peptide- 1 .Am J Physiol 1992;
263:L536-L545.
1 7. Topley N, Brown Z, J#{246}rres A, et at.: Human peritoneal
mesothebiab cells synthesize mnterleukin-8. Synergistic
induction by interleukmn- 1 beta and tumor necrosis fac-
tor-alpha. Am J Pathol 1993; 142:1876-1886.
18. Topley N, J#{246}rres A, Luttmann W, et at.: Human perito-
neal mesothelial cells synthesize interleukmn-6: mnduc-
tion by IL-i beta and TNF alpha. Kidney Int 1993;43:
226-233.
19. Topley N, Petersen MM, Mackenzie RK, et at: Human
peritoneal mesothelial cell prostaglandin synthesis: in-
duction of cycbooxygenase mRNA by peritoneal macro-
phage-derived cytokmnes. Kidney mt 1 994;46:900-909.
20. Topley N, Mackenzie RK, J#{246}rresA, Coles GA, Davies M,
Williams JD: Cytokmne networks in continuous ambula-
tory peritoneal dialysis: interactions of resident cells
during inflammation in the peritoneal cavity. Perit Dial
Int 1993; l3LSuppl 21:5282-5285.
2 1 .Bornstein MD: Reconstituted rat tail collagen used as a
substrate for tissue cultures and coversbips in Maximow
slides and roller tubes. Lab Invest 1958;7: 134-139.
22. Stylianou E, Jenner LA, Davies M, Coles GA, Williams
JD: Isolation, culture and characterization of human
peritoneal mesothelial cells. Kidney Int 1990:37:1563-
1570.
23. Redinbaugh MG, Campbell WH: Adaptation of the dye-
binding protein assay to microtiter plates. Anal Biochem
1985:147:144-147.
24. Zilberstein A, Ruggieri R, Korn JH, Revel M: Structure
and expression of cDNA and genes for human interferon-
beta-2, a distinct species inducible by growth-stimula-
tory cytokmnes. EMBO J 1986:5:2529-2537.
25. O’Biyan JP, Frye RA, Cogswell PC, et aL: axl, a trans-
forming gene isolated from primary human myeboid leu-
kemia cells, encodes a novel receptor tyrosmne kmnase.
Mob Cell Biol 1991;11:5016-5031.
26. J#{246}rres A, Topley N, Steenweg L, Muller C, Kottgen E,
Gahi GM: Inhibition of cytokmne synthesis by penitoneal
dialysate persists throughout the CAPD cycle. Am J
Nephrol 1992;12:80-85.
27. May LT, Santhanam U, Sehgal PB: On the multimenic
nature of natural human mnterbeukmn-6. J Biol Chem
1991266:9950-9955.
Jares et al
Journal of the American Society of Nephrology 220i
28. Krieg T, Heckmann M: Regulatory mechanisms of fibro-
blast activity. Recent Prog Med 1989:80:594-598.
29. Selgas R, Lopez Rivas A, Miranda B, et at.: Characteri-
sation of the mitogenic-induced capacity of peritoneal
effluent on human and mice fibroblasts in culture.
Nephrol Dial Transplant 199 1;6:44-50.
30. Wiesbander AP, Nordin MK, Kjellstrand PT, Boberg UC:
Toxicity of peritoneab dialysis fluids on cultured fibro-
blasts, L-929. Kidney Int 199 1;40:77-79.
3 1 .Fieren MW, van den Bemd GJ, Bonta IL.: Peritoneab
macrophages from patients on continuous ambulatory
peritoneal dialysis show a differential secretion of pros-
tanoids and interleukin- 1 beta. Prostaglandmns Leuko-
trienes Essent Fatty Acids 1992:47:23-28.
32. Fieren MW, van den Bemd GJ, Bonta IL, Ben Efraim S.:
Peritoneal macrophages from patients on continuous
ambulatory peritoneal dialysis have an increased capa-
bility to release tumour necrosis factor during peritoni-
tis. J Clin Lab Immunol l991;34:1-9.
33. Goldman M, Vandenabeebe P. MoulartJ, et at.: Intraper-
itoneal secretion of interleukin-6 during continuous am-
bulatory peritoneal dialysis. Nephron l990;56:277-280.
34. Brauner A, Hylander B, Wretbind B: Interleukin-6 and
interleukin-8 in dialysate and serum from patients on
continuous ambulatory peritoneal dialysis. Am J Kidney
Dis 1993:22:430-435.
35. Zemel D, Krediet RT, Koomen GCM, Kortekaas WMR,
Geertzen HGM, ten Berge bUM: Interleukmn-8 during
peritonitis in patients treated with CAPD: An in-vivo
model of acute inflammation. Nephrol Dial Transplant
1994;9: 169-174.
