Figure 15 - uploaded by Mehmet Ünsal Barak
Content may be subject to copyright.
Source publication
In this study; we analysed the ITS sequences of 9 lichenized fungi species (Aspicilia cinerea, Circinaria contorta, Lecidea atrobrunnea, Lecanora rupicola, Physcia dubia, Rhizoplaca peltata, Rhizocarpon geographicum, Tephromela atra and Xanthoparmelia pulla) which have a wide distribution in the alpine zone of Erciyes Volcanic Mountain in Central A...
Citations
... The measurements are given as minimummaximum, from n = 30 measurements. Thin-layer chromotography (TLC) was carried out to determine compounds, using solvent system C [5,6]. ...
... PCR was carried out in 50 μL reaction volumes using 4 μl of 10 x reaction buffer, 4 μl MgCl2 (50 mM), 0.5 μl each primer, 2 μl dNTP (10 mM), 0.2 μl Taq DNA polymerase, 1 μl of genomic DNA and 37.8 μl dH2O on a thermal cycler equipped with a heated lid. Primers used for PCR amplification of ITS regions were the fungi-specific primer ITS1-F (5′-CTTGGTCATTTAGAGGAAGTAA-3′) [8] and the universal primer ITS4 (5'-TCCTCCGCTTATTGATATGC-3') [6]. Primers used for PCR amplification of mtSSU and RPB1 regions were mrSSU1:F AGCAGTGAGGAATATTGGTC; mrSSU3R ATGTGGCACGTCTATAGCCC, [9] and RPB1-aFasc ADTGYCCYGGYCATTTYGGT [10] and RPB1-cR (CCCGCATNTCRTTRTCCATRTA [11]. ...
Only two species of the lichen genus Lambiella are known from Antarctica: L. impavida and L. psephota. Here we report a new chemotype of L. psephota collected from James Ross Island in the North-East Antarctic Peninsula region. nrITS, mtSSU and RPB1 gene regions of the norstictic acid deficient L. psephota were obtained, which showed the new chemotype phylogenetically belongs to L. psephota. We also transfer Rimularia maculata to Lambiella, and provide an identification key of the 17 known species of Lambiella world-wide
Acarospora is a crustose lichen genus in the family Acarosporaceae and has a wide distribution. While the lichen genus Acarospora has more than 200 species in the world, the number of species so far determined in Türkiye is 41. Here we report three Acarospora species: A. irregularis H. Magn., A. rosulata (Th. Fr.) H. Magn., A. thamnina (Tuck.) Herre and two lichenicolous fungal species: Lichenostigma svandae Vondrák & Šoun, Stigmidium fuscatae (Arnold) R. Sant. new to Türkiye. Detailed information on these 5 taxa is provided along with photographs. The nrITS, β tubulin and mtSSU gene regions of the new Acarospora records are studied and their phylogenetical positions are discussed.
From the combined phylogenetic analysis of multi-locus sequence data of the Lecanoraceae including two nuclear protein-coding markers (RPB2 and RPB1), the internal transcribed spacer and a fragment of the mitochondrial small subunit, found that the originally monotypic eastern Asian genus Verseghya is positioned within the Verseghya-Lecidella-Pyrrhospora clade of the Lecanoraceae and includes one more taxon Verseghya thysanophora widely distributed in Northern Hemisphere.
The genus Lecidella forming the Lecidella-Glaucomaria subclade within the same Verseghya-Lecidella-Pyrrhospora clade of the Lecanoraceae found to have tendency to be polyphyletic after including the recently described eastern Asian taxon Lecidella mandshurica into phylogenetic analysis of the Lecanoraceae. It is shown that Lecidella mandshurica was previously recorded from China sub Lecidella aff. elaeochroma .
The originally monotypic eastern Asian genus Sedelnikovaea forming a monophyletic branch within the Sedelnikovaea-Lecanoropsis subclade and being in out-position to the Rhizoplaca-Protoparmeliopsis s. str. clade of the Lecanoraceae found to include three more taxa, i.e. Sedelnikovaea marginalis, S. pseudogyrophorica , and S. subdiscrepans .
The Eurasian Protoparmeliopsis bolcana , and the eastern Asian P. kopachevskae , are illustrated for the first time as being positioned within the Protopameliopsis branch of the Lecanoraceae, while the South Korean ‘ Protoparmeliopsis’ chejuensis found to be positioned in separate monophyletic branch from all other branches of the Rhizoplaca-Protoparmeliopsis s. l. clade of the Lecanoraceae.
The genus Polyozosia A. Massal. as earlier name for the former Myriolecis branch of the Lecanoraceae is accepted as far the type species of the latter genus, i.e. P. poliophaea , found to be positioned within this branch. The Polyozosia robust monophyletic branch is positioned in the outermost position in the Rhizoplaca-Protoparmeliopsis s. str. clade of the Lecanoraceae.
Position and species content of the accepted genera Glaucomaria, Lecanoropsis, Omphalodina, Polyozosia , and Straminella are discussed in separate nrITS and mtSSU, and combined phylogeny based on concatenated sequences of nrITS, mtSSU, RPB2 and RPB1 genes.
Fourty new combinations are proposed: Glaucomaria bicincta, G. carpinea, G. leptyrodes, G. lojkaeana, G. subcarpinea, G. sulphurea, G. swartzii, G. swartzii subsp. caulescens, G. swartzii subsp. nylanderi, Lecanoropsis anopta, L. macleanii, Omphalodina chrysoleuca, O. huashanensis, O. opiniconensis, O. phaedrophthalma, O. pseudistera, Palicella anakeestiicola, Polyozosia albescens, P. andrewii, P. contractula, P. crenulata, P. dispersa, P. hagenii, P. perpruinosa, P. populicola, P. pruinosa, P. reuteri, P. sambuci, P. semipallida, P. straminea, P. thuleana, Sedelnikovaea marginalis, S. pseudogyrophorica, S. subdiscrepans, Straminella bullata, S. burgaziae, S. conizaeoides, S. densa, S. maheui, S. varia , and Verseghya thysanophora . Validation of one name as Polyozosia perpruinosa Fröberg ex S. Y. Kondr. L. Lőkös et Farkas is also proposed.
