Figure 6 - uploaded by Stefania Bellini
Content may be subject to copyright.
TNTs allow mitochondrial transfer between podocytes. (A) Podocytes stained with CellTracker Blue were exposed to rotenone (50 nM) for 24 hours, then cocultured with donor podocytes labeled with Cell-Light Mito-GFP. GFP mitochondria moving along the TNT in the direction of a podocyte pre-exposed to rotenone (magnification 3630, bar 550 mm) are shown. (B and C) Podocytes stained with CellTracker Blue were exposed to AD (0.8 mg/ml) for 24 hours, then cocultured with WT donor podocytes labeled with either Cell-Light Mito-GFP or Mitotracker. The images show GFP/RFP mitochondria within the TNT and in the cytosol of a recipient podocyte pre-exposed to AD (magnification 3630, bar 5 50 mm, DIC images in the insert showing the TNT). (D) AD-treated podocytes and WT donor podocytes, containing GFP-labeled mitochondria, were separately seeded in a two Well Ibidi Culture Insert. After insert removal, the two populations, separated by a cell-free gap, were cocultured for 24 hours under gentle shaking. As shown in the representative image, GFP-labeled mitochondria were not observed in recipient cells. (E and F) The rate of mitochondrial transfer toward WT podocytes pre-exposed to AD (GFP and Blue dually labeled cells) was quantified by flow cytometry as shown in both the plot and the graph (n53; *P,0.001 WT AD versus vehicle and KO AD; # P,0.001 KO AD versus vehicle).
Source publication
Background
Podocyte dysfunction and loss are major determinants in the development of proteinuria. FSGS is one of the most common causes of proteinuria, but the mechanisms leading to podocyte injury or conferring protection against FSGS remain poorly understood. The cytosolic protein M-Sec has been involved in the formation of tunneling nanotubes (...
Citations
... Further study and precise definition of cell sources and state would be necessary to advance cell-based therapy for Alport syndrome. Horizontal transfer of genetic material in vivo was previously reported in distinct pathologies using extracellular vesicles or nanotubes (Burghoff et al, 2008;Tome et al, 2009;Uygur et al, 2019;Barutta et al, 2021). Beyond horizontal transfer of a limited amount of genetic material, cell fusion with the formation of a sable heterokaryon capable of genetic rescue remains challenging to ascertain. ...
Glomerular filtration relies on the type IV collagen (ColIV) network of the glomerular basement membrane, namely, in the triple helical molecules containing the α3, α4, and α5 chains of ColIV. Loss of function mutations in the genes encoding these chains ( Col4a3 , Col4a4 , and Col4a5 ) is associated with the loss of renal function observed in Alport syndrome (AS). Precise understanding of the cellular basis for the patho-mechanism remains unknown and a specific therapy for this disease does not currently exist. Here, we generated a novel allele for the conditional deletion of Col4a3 in different glomerular cell types in mice. We found that podocytes specifically generate α3 chains in the developing glomerular basement membrane, and that its absence is sufficient to impair glomerular filtration as seen in AS. Next, we show that horizontal gene transfer, enhanced by TGFβ1 and using allogenic bone marrow–derived mesenchymal stem cells and induced pluripotent stem cells, rescues Col4a3 expression and revive kidney function in Col4a3-deficient AS mice. Our proof-of-concept study supports that horizontal gene transfer such as cell fusion enables cell-based therapy in Alport syndrome.
... After 24h, the time sufficient for the virus to undergo one replication cycle [6,20], we detected the formation of long, thin intercellular connections positive for infection without having a detrimental effect on cell viability ( Figure 1A). To characterize these structures in more detail, we stained infected cells with fluorescent phalloidin to visualize F-actin, a major component of TNTs, and with antibodies to detect viral NP and the host TNF--induced protein 2 (TNFAIP2), which localizes to TNTs and is key for their biogenesis [11,12,21]. As seen in Figure 1B, the connections floated free in the medium and contained TNFAIP2 and viral NP. ...
... Upregulation of several proinflammatory cytokines correlates with increased mortality in infected individuals [1]. Inflammation exacerbates TNT formation, partly by a TNF--induced mechanism, where strongly induced TNFAIP2 triggers F-actin polymerization from the initiating cell surface [21,45,46]. We detected a strong association of TNFAIP2 with TNTs in EBOV-infected Ms, suggesting that a virus-induced proinflammatory environment may direct TNT development. ...
Ebola virus disease is marked by the rapid virus replication and spread. Ebola virus (EBOV) enters the cell by macropinocytosis, replicates in the cytoplasm, and nascent virions egress from the cell surface to infect neighboring cells. Here, we show that EBOV uses an alternate route to disseminate: tunneling nanotubes (TNTs). TNTs, an actin-based long-range intercellular communication system, allows for direct exchange of cytosolic constituents between cells. Using live, scanning electron and high-resolution quantitative 3D-microscopy, we show that EBOV infection of primary human cells results in the enhanced formation of TNTs, containing viral nucleocapsids. TNTs promoted the intercellular transfer of nucleocapsids in the absence of live virus, and virus could replicate in cells devoid of entry factors after initial stall. Our studies suggest an alternate model of EBOV dissemination within its host, laying the groundwork for further investigations into the pathogenesis of filoviruses and, importantly, stimulating new areas of antiviral design.
... These events ultimately lead to detachment, hypertrophy, and death of podocytes (reviewed in Sun et al., 2021). (Barutta et al., 2021). ...
Podocytes are terminally differentiated kidney cells acting as the main gatekeepers of the glomerular filtration barrier; hence, inhibiting proteinuria. Podocytopathies are classified as kidney diseases caused by podocyte damage. Different genetic and environmental risk factors can cause podocyte damage and death. Recent evidence shows that mitochondrial dysfunction also contributes to podocyte damage. Understanding alterations in mitochondrial metabolism and function in podocytopathies and whether altered mitochondrial homeostasis/dynamics is a cause or effect of podocyte damage are issues that need in-depth studies. This review highlights the roles of mitochondria and their bioenergetics in podocytes. Then, factors/signalings that regulate mitochondria in podocytes are discussed. After that, the role of mitochondrial dysfunction is reviewed in podocyte injury and the development of different podocytopathies. Finally, the mitochondrial therapeutic targets are considered.
... TN-FAIP2 genotyping was carried out using primers F: AGCTGTGCATTTAGGTCCAT and RW: TGTGGGCAGTGGACCATCTA. Loss of M-Sec protein was confirmed by western blotting using an M-Sec specific antibody. Homozygous M-Sec-KO mice were viable, born at normal Mendelian ratios, grew normally, and showed a normal phenotype similar to that reported using a M-Sec deficient mouse generated by the Riken Centre [40]. For the intravital imaging MacBlue C57Bl6 mice, Tg(Csf1r*-GAL4/VP16,UAS-ECFP)1Hume/J (Stock No: 026051, Jackson Laboratory) expressing ECFP under the control of a truncated CSF-1r promoter were crossed with B6.Cg-Gt(ROSA)26Sortm14(CAG-tdTomato) to label the vasculature with tdTomato utilizing Cre driven by Cadh5 endothelial promoter, as described in [22]. ...
... Our previous work has shown that similar structures that we identified as TNTs, a subset of TMCs, were important in promoting tumor cell invasion and dissemination [33]. We confirmed that the TMCs that we detected during extravasation were regulated in the same manner as TNTs by using macrophages with reduced levels of M-Sec, a known regulator of the TNTs [33,36,40,47]. The reduction in M-Sec decreased TMC formation between macrophages and tumor cells and reduced tumor cells extravasation in vitro. ...
... The importance of M-Sec and TNTs/TMCs in vivo was recently demonstrated by another group that showed that M-Sec-TNTs played a protective role in the glomeruli by rescuing podocytes via mitochondrial horizontal transfer [40]. We tested the capability of injected wild type tumor cells to disseminate into the lung parenchyma of M-Sec KO mice. ...
Simple Summary
Breast cancer is one of the most common cancers in women and despite improvements in treatments, patients suffering from metastatic disease still have a very low survival rate. A rate-limiting step is the seeding of tumor cells from the blood into the metastatic site. Macrophages are a key cell type in the metastatic niche, which are important for tumor cell seeding despite being separated from the tumor cells in the vasculature by an endothelial barrier. We found that macrophages and tumor cells make thin membranous connections through the endothelial barrier to assist in tumor cell crossing. These structures are similar to tunneling nanotubes that we previously showed were important for tumor cell invasion. We found that these macrophage-mediated connections were important for tumor crossing the endothelial barrier and for metastatic seeding. This new finding suggests that targeting tunneling nanotubes may limit tumor spread.
Abstract
Macrophages are important players involved in the progression of breast cancer, including in seeding the metastatic niche. However, the mechanism by which macrophages in the lung parenchyma interact with tumor cells in the vasculature to promote tumor cell extravasation at metastatic sites is not clear. To mimic macrophage-driven tumor cell extravasation, we used an in vitro assay (eTEM) in which an endothelial monolayer and a matrigel-coated filter separated tumor cells and macrophages from each other. The presence of macrophages promoted tumor cell extravasation, while macrophage conditioned media was insufficient to stimulate tumor cell extravasation in vitro. This finding is consistent with a requirement for direct contact between macrophages and tumor cells. We observed the presence of Thin Membranous Connections (TMCs) resembling similar structures formed between macrophages and tumor cells called tunneling nanotubes, which we previously demonstrated to be important in tumor cell invasion in vitro and in vivo. To determine if TMCs are important for tumor cell extravasation, we used macrophages with reduced levels of endogenous M-Sec (TNFAIP2), which causes a defect in tunneling nanotube formation. As predicted, these macrophages showed reduced macrophage-tumor cell TMCs. In both, human and murine breast cancer cell lines, there was also a concomitant reduction in tumor cell extravasation in vitro when co-cultured with M-Sec deficient macrophages compared to control macrophages. We also detected TMCs formed between macrophages and tumor cells through the endothelial layer in the eTEM assay. Furthermore, tumor cells were more frequently found in pores under the endothelium that contain macrophage protrusions. To determine the role of macrophage-tumor cell TMCs in vivo, we generated an M-Sec deficient mouse. Using an in vivo model of experimental metastasis, we detected a significant reduction in the number of metastatic lesions in M-Sec deficient mice compared to wild type mice. There was no difference in the size of the metastases, consistent with a defect specific to tumor cell extravasation and not metastatic outgrowth. Additionally, with an examination of time-lapse intravital-imaging (IVI) data sets of breast cancer cell extravasation in the lungs, we could detect the presence of TMCs between extravascular macrophages and vascular tumor cells. Overall, our data indicate that macrophage TMCs play an important role in promoting the extravasation of circulating tumor cells in the lungs.
... There is little information on the TNFAIP2-TNT system in the kidney. However, podocytes can express TNFAIP2 and their exposure to either serum deprivation or adriamycin induces a TNFAIP2-TNT-dependent transfer of mitochondria from healthy to injured podocytes [54]. In addition, in vivo deletion of Tnfaip2 causes the spontaneous development of focal segmental glomerulosclerosis (FSGS) in the susceptible BALB/c mouse strain [54]. ...
... However, podocytes can express TNFAIP2 and their exposure to either serum deprivation or adriamycin induces a TNFAIP2-TNT-dependent transfer of mitochondria from healthy to injured podocytes [54]. In addition, in vivo deletion of Tnfaip2 causes the spontaneous development of focal segmental glomerulosclerosis (FSGS) in the susceptible BALB/c mouse strain [54]. ...
... Podocyte overexpression of TNFAIP2 also occurs in FSGS [54], raising the hypothesis that TNFAIP2 induction may be a common response to podocyte injury. TNFAIP2 upregulation is likely a compensatory mechanism aimed to limit glomerular injury. ...
Podocyte injury leading to albuminuria is a characteristic feature of diabetic nephropathy (DN). Hyperglycemia and advanced glycation end products (AGEs) are major determinants of DN. However, the underlying mechanisms of podocyte injury remain poorly understood. The cytosolic protein TNFAIP2/M-Sec is required for tunneling nanotubes (TNTs) formation, which are membrane channels that transiently connect cells, allowing organelle transfer. Podocytes express TNFAIP2 and form TNTs, but the potential relevance of the TNFAIP2-TNT system in DN is unknown. We studied TNFAIP2 expression in both human and experimental DN and the renal effect of tnfaip2 deletion in streptozotocin-induced DN. Moreover, we explored the role of the TNFAIP2-TNT system in podocytes exposed to diabetes-related insults. TNFAIP2 was overexpressed by podocytes in both human and experimental DN and exposure of podocytes to high glucose and AGEs induced the TNFAIP2-TNT system. In diabetic mice, tnfaip2 deletion exacerbated albuminuria, renal function loss, podocyte injury, and mesangial expansion. Moreover, blockade of the autophagic flux due to lysosomal dysfunction was observed in diabetes-injured podocytes both in vitro and in vivo and exacerbated by tnfaip2 deletion. TNTs allowed autophagosome and lysosome exchange between podocytes, thereby ameliorating AGE-induced lysosomal dysfunction and apoptosis. This protective effect was abolished by tnfaip2 deletion, TNT inhibition, and donor cell lysosome damage. By contrast, Tnfaip2 overexpression enhanced TNT-mediated transfer and prevented AGE-induced autophagy and lysosome dysfunction and apoptosis. In conclusion, TNFAIP2 plays an important protective role in podocytes in the context of DN by allowing TNT-mediated autophagosome and lysosome exchange and may represent a novel druggable target.Abbreviations: AGEs: advanced glycation end products; AKT1: AKT serine/threonine kinase 1; AO: acridine orange; ALs: autolysosomes; APs: autophagosomes; BM: bone marrow; BSA: bovine serum albumin; CTSD: cathepsin D; DIC: differential interference contrast; DN: diabetic nephropathy; FSGS: focal segmental glomerulosclerosis; HG: high glucose; KO: knockout; LAMP1: lysosomal-associated membrane protein 1; LMP: lysosomal membrane permeabilization; MAP1LC3/LC3: microtubule-associated protein 1 light chain 3; PI3K: phosphoinositide 3-kinase; STZ: streptozotocin; TNF: tumor necrosis factor; TNFAIP2: tumor necrosis factor, alpha-induced protein 2; TNTs: tunneling nanotubes; WT: wild type.
... In adriamycin-treated podocytes the M-Sec-TNT system allows mitochondria transfer, ameliorates mitochondrial bioenergetics, and partially reverts podocyte injury. Moreover, in vivo M-Sec is overexpressed by podocytes in both human and experimental FSGS and M-Sec deletion causes podocyte injury, mitochondrial abnormalities, and the spontaneous development of progressive FSGS [322]. ...
Albuminuria is the hallmark of both primary and secondary proteinuric glomerulopathies, including focal segmental glomerulosclerosis (FSGS), obesity-related nephropathy, and diabetic nephropathy (DN). Moreover, albuminuria is an important feature of all chronic kidney diseases (CKDs). Podocytes play a key role in maintaining the permselectivity of the glomerular filtration barrier (GFB) and injury of the podocyte, leading to foot process (FP) effacement and podocyte loss, the unifying underlying mechanism of proteinuric glomerulopathies. The metabolic insult of hyperglycemia is of paramount importance in the pathogenesis of DN, while insults leading to podocyte damage are poorly defined in other proteinuric glomerulopathies. However, shared mechanisms of podocyte damage have been identified. Herein, we will review the role of haemodynamic and oxidative stress, inflammation, lipotoxicity, endocannabinoid (EC) hypertone, and both mitochondrial and autophagic dysfunction in the pathogenesis of the podocyte damage, focussing particularly on their role in the pathogenesis of DN. Gaining a better insight into the mechanisms of podocyte injury may provide novel targets for treatment. Moreover, novel strategies for boosting podocyte repair may open the way to podocyte regenerative medicine.
... Another widely used technique to induce the formation of TNTs in vitro is also to transfect cells with proteins involved in cytoskeletal mobility and cell adhesion. The administration of mSEC [66,67], which triggers the formation of TNTs due to the higher dynamicity of the cytoskeleton, is a primary example. Most drugs used and tested in cell cultures have been also linked to an increase in the connections between cells due to their stressful effect, especially considering anticancer drugs and antibiotics [68][69][70]. ...
Tunneling nanotubes (TNTs), discovered in 2004, are thin, long protrusions between cells utilized for intercellular transfer and communication. These newly discovered structures have been demonstrated to play a crucial role in homeostasis, but also in the spreading of diseases, infections, and metastases. Gaining much interest in the medical research field, TNTs have been shown to transport nanomedicines (NMeds) between cells. NMeds have been studied thanks to their advantageous features in terms of reduced toxicity of drugs, enhanced solubility, protection of the payload, prolonged release, and more interestingly, cell-targeted delivery. Nevertheless, their transfer between cells via TNTs makes their true fate unknown. If better understood, TNTs could help control NMed delivery. In fact, TNTs can represent the possibility both to improve the biodistribution of NMeds throughout a diseased tissue by increasing their formation, or to minimize their formation to block the transfer of dangerous material. To date, few studies have investigated the interaction between NMeds and TNTs. In this work, we will explain what TNTs are and how they form and then review what has been published regarding their potential use in nanomedicine research. We will highlight possible future approaches to better exploit TNT intercellular communication in the field of nanomedicine.
... In adriamycin-treated podocytes the M-Sec-TNT system allows mitochondria transfer, ameliorates mitochondrial bioenergetics, and partially reverts podocyte injury. Moreover, in vivo M-Sec is overexpressed by podocytes in both human and experimental FSGS and M-Sec deletion causes podocyte injury, mitochondrial abnormalities, and the spontaneous development of progressive FSGS [322]. ...
