Figure 3 - uploaded by David A Tulis
Content may be subject to copyright.
Simplified diagram of the rat carotid artery vascular anatomy along with sites for placement of arterial clamp(s), suture, and ligations (9). Proximal and distal anatomical locations are indicated, as well as numerical steps identified in the protocol. The arteriotomy site for insertion of the balloon catheter is on the external carotid artery branch between the bifurcation of the common carotid artery and the site of distal ligation and retraction. Abbreviations: LCC: left common carotid artery; EC: external carotid artery; IC: internal carotid artery.
Source publication
Numerous and diverse experimental animal models have been used over the years to examine reactions to various forms of blood vessel disease and/or injury across species and in multiple vascular beds in a cumulative effort to relate these findings to the human condition. In this context, the rat carotid artery balloon injury model is highly characte...
Contexts in source publication
Context 1
... Before placement of sutures around specific sections of the carotid vasculature can take place (see Fig. 3) (9), the surgeon must make sure that these vessel sections are completely separated from all adjacent tissues. If this is not the case, then during the retraction and/or clamping procedures complete cessation of blood flow will not occur due to the presence of additional tissue in the clamp or retractor. This will result in unexpected ...
Context 2
... If this is not the case, then during the retraction and/or clamping procedures complete cessation of blood flow will not occur due to the presence of additional tissue in the clamp or retractor. This will result in unexpected bleeding, severely hamper progress of the surgery, and cause undue stress on the animal. At each site for suture placement (Fig. 3), carefully blunt dissect away all adjacent tissues from the vessel so that at least 2-3 mm of the vessel is free from extraneous ...
Context 3
... surgeon now must decide whether to access the internal carotid artery branch which, as the surgeon is looking at the animal, lies immediately below the carotid bifurcation and the external carotid artery branch and quickly moves into deep tissue in a dorsal direction (#4 in Fig. 3). The reason to access the internal artery is that it can be a significant source for retrograde blood loss if its flow is not adequately controlled. Access to this branch can be difficult as there is not a lot of space with which to work and the available length of the internal branch is usually minimal. The surgeon must determine if ...
Context 4
... internal carotid branch immediately adjacent to the bifurcation, exposing as much of the internal carotid as possible. Loop a section of 4-0 silk suture around the artery and keep it un-tied. Control of the internal carotid artery blood flow can then be achieved with either arterial micro-clamps or with retraction of the suture (see Note 14; see Fig. 3). If using an arterial clamp, do not place it too close to the common carotid bifurcation, as this will physically impede advancement of the balloon catheter and the clamp will have to be removed and placed at a more distal site on the internal carotid artery. Similarly, if using suture to retract the internal carotid branch, be ...
Context 5
... Now, the internal carotid artery may or may not be retracted and/or clamped (#4 in Fig. 3), and it is time to tie the other sutures already in place (one on the common carotid, two on the external carotid) and to clamp the common carotid artery in advance of the arteriotomy incision and balloon catheterization. First, using a double- knot tie the most distal suture on the external branch, retract it towards the head, and ...
Context 6
... already in place (one on the common carotid, two on the external carotid) and to clamp the common carotid artery in advance of the arteriotomy incision and balloon catheterization. First, using a double- knot tie the most distal suture on the external branch, retract it towards the head, and adhere it to the operating surface with tape (#3 in Fig. 3). Be careful here not to pull too tightly, and constantly watch the carotid artery during retraction to ensure that the vasculature is not being stressed too much. Avoid undue pressure on the vasculature and try to maintain normal vessel geometry (avoid angles). Gently retracting the carotid artery during this step lifts up the ...
Context 7
... retract the proximal suture on the common carotid artery and place an arterial clamp on the vessel in order to stop common carotid artery blood flow (see Notes 30, 31; #1 in Fig. 3). Be careful here and try not to traumatize the vessel. Try to place the clamp exactly perpendicular to the vessel and avoid catching adjacent tissues in the clamp. Lidocaine can be applied to the vasculature and incubated for several minutes. At this point the external carotid artery has been retracted distally, the common carotid ...
Context 8
... have been calibrated well ahead of time (see Section 3.2.) and should be located within easy reach of the surgeon. With a cotton swab in one hand and small micro-scissors in the dominant hand, very delicately snip a portion of the external carotid branch perpendicular to its axis and as distally as possible (towards suture nearest the head; see Figs. 3, 4). This will allow sufficient length of external carotid artery branch if there presents a problem with this initial arteriotomy incision (see Note 28). The cut should be straight with a length ~1/4 to 1/3 the circumference of the vessel. Do not make the cut too deep or cut completely through the vessel, as this will make things more ...
Context 9
... Now for the removal of the catheter and closure of the arteriotomy site. Hold a 7S forcep in each hand and grab the ends of the loosely tied proximal suture on the external carotid artery (#2 in Figs. 3, 4). These will be pulled tight to tie the suture and to close off the arteriotomy following removal of the catheter. With the inflated balloon near the arteriotomy hole on the external carotid and the ends of the suture held in the forcep tips, quickly deflate the balloon, remove the catheter from the vessel, and tie the suture to close ...
Context 10
... arteriotomy incision (which is made as distally as possible), then that site will be closed and the surgeon will move proximally if there exists a sufficient length of external carotid artery branch remaining with which to work. However, caution must be practiced if the arteriotomy hole is made too close to the most distal suture knot (#3 in Figs. 3, 4). In that case, the suture knot itself could impede insertion of the balloon tip, and the surgeon may have to make a second arteriotomy at a more proximal ...
Context 11
... This will serve to dilate the artery and will enhance blood flow thus augmenting existing leaks in the vessels. Generally speaking, if leaks are present they are usually located around the arteriotomy incision and are due to inadequate closure of that suture. If this is the case, tie another suture around the arteriotomy at that site (#2 in Figs. 3, 4) to stop the ...
Context 12
... suture at (#2) will be tied immediately upon removal of the balloon catheter following surgery, while the suture at (#3) will be tied and used to retract the carotid vasculature prior to performing the arteriotomy. These numbers correspond to those included in Figure 3. The internal carotid artery branch was not accessed in this animal and therefore is not indicated. ...
Similar publications
Mural cells of the vessel wall, namely pericytes and vascular smooth muscle cells, are essential for vascular integrity. The developmental sources of these cells and molecular mechanisms controlling their progenitors in the heart are only partially understood. Here we show that endocardial endothelial cells are progenitors of pericytes and vascular...
Citations
... Following our protocols (Tulis, 2007a;Tulis, 2007b;Holt and Tulis, 2013), adult rats (425-475 g body weight) were anesthetized (ketamine (90 mg/mL), xylazine (10 mg/mL); 1 mL/kg, intraperitoneal injection) and provided analgesia (Buprenex; 0.5 mL/kg, subcutaneous injection) supplied by the Department of Comparative Medicine, ECU. The left carotid artery and external carotid branch were surgically exposed, and a Fogarty 2FR embolectomy catheter (Baxter Healthcare Corp., Irvine, CA) was introduced into an external carotid arteriotomy and advanced to the aortic arch. ...
... We found that Smad3 stimulated cell cycle progression and increased cell numbers compared to vehicle or Ad-GFP controls due in part to increased cyclin D/E and CDK2/4 and reduced cytostatic p21 and p27. In the current study, our first experiments verified Smad3 induction in an ASM growth-provoking rat carotid artery injury model (Tulis, 2007a;Tulis, 2007b;Joshi et al., 2011;Holt and Tulis, 2013), confirming our previous in vivo observations and in vivo findings from other investigators (Tsai et al., 2009) and lending credence for more focused and controlled study of the mechanisms of Smad3 in primary ASM cells. It is important to mention that our in vivo data revealed that phosphorylated and total Smad3 were both significantly upregulated following intact arterial injury ( Figures 1B, D), yet considering that the increase in total Smad3 surpassed the increase in phosphorylated Smad3, a significantly reduced ratio was observed ( Figure 1E). ...
Transition of arterial smooth muscle (ASM) from a quiescent, contractile state to a growth-promoting state is a hallmark of cardiovascular disease (CVD), a leading cause of death and disability in the United States and worldwide. While many individual signals have been identified as important mechanisms in this phenotypic conversion, the combined impact of the transcription factors Smad3 and FoxO3 in ASM growth is not known. The purpose of this study was to determine that a coordinated, phosphorylation-specific relationship exists between Smad3 and FoxO3 in the control of ASM cell growth. Using a rat in vivo arterial injury model and rat primary ASM cell lysates and fractions, validated low and high serum in vitro models of respective quiescent and growth states, and adenoviral (Ad-) gene delivery for overexpression (OE) of individual and combined Smad3 and/or FoxO3, we hypothesized that FoxO3 can moderate Smad3-induced ASM cell growth. Key findings revealed unique cellular distribution of Smad3 and FoxO3 under growth conditions, with induction of both nuclear and cytosolic Smad3 yet primarily cytosolic FoxO3; Ad-Smad3 OE leading to cytosolic and nuclear expression of phosphorylated and total Smad3, with almost complete reversal of each with Ad-FoxO3 co-infection in quiescent and growth conditions; Ad-FoxO3 OE leading to enhanced cytosolic expression of phosphorylated and total FoxO3, both reduced with Ad-Smad3 co-infection in quiescent and growth conditions; Ad-FoxO3 inducing expression and activity of the ubiquitin ligase MuRF-1, which was reversed with concomitant Ad-Smad3 OE; and combined Smad3/FoxO3 OE reversing both the pro-growth impact of singular Smad3 and the cytostatic impact of singular FoxO3. A primary takeaway from these observations is the capacity of FoxO3 to reverse growth-promoting effects of Smad3 in ASM cells. Additional findings lend support for reciprocal antagonism of Smad3 on FoxO3-induced cytostasis, and these effects are dependent upon discrete phosphorylation states and cellular localization and involve MuRF-1 in the control of ASM cell growth. Lastly, results showing capacity of FoxO3 to normalize Smad3-induced ASM cell growth largely support our hypothesis, and overall findings provide evidence for utility of Smad3 and/or FoxO3 as potential therapeutic targets against abnormal ASM growth in the context of CVD.
... In this model, a balloon catheter is inserted through a rat carotid artery and is repeatedly overexpanded and pulled along the vessel to similarly denude the endothelium and distend the vessel wall in a single procedure. SMC proliferation ensues and NH development typically peaks after 2 weeks [17,18]. Due to its improved surgical feasibility, balloon injury has been extensively used in the development of a wide range of anti-restenosis therapies including antibodies [19], recombinant proteins [20], gene therapy [21], and even the compounds used in current drug-eluting devices. ...
... To further support the animals during recovery, Ringers fluid (warmed to 37˚C) will be subcutaneously injected at 10 mL/kg. 17. The animal will be allowed to recover on a heat mat (37˚C) and monitored continuously until it has regained its righting reflexes. ...
Models of arterial injury in rodents have been invaluable to our current understanding of vessel restenosis and play a continuing role in the development of endovascular interventions for cardiovascular disease. Mechanical distention of the vessel wall and denudation of the vessel endothelium are the two major modes of vessel injury observed in most clinical pathologies and are critical to the reproducible modelling of progressive neointimal hyperplasia. The current models which have dominated this research area are the mouse wire carotid or femoral injury and the rat carotid balloon injury. While these elicit simultaneous distension of the vessel wall and denudation of the luminal endothelium, each model carries limitations that need to be addressed using a complementary injury model. Wire injuries in mice are highly technical and procedurally challenging due to small vessel diameters, while rat balloon injuries require permanent blood vessel ligation and disruption of native blood flow. Complementary models of vascular injury with reproducibility, convenience, and increased physiological relevance to the pathophysiology of endovascular injury would allow for improved studies of neointimal hyperplasia in both basic and translational research. In this study, we developed a new surgical model that elicits vessel distention and endothelial denudation injury using sequential steps using microforceps and a standard needle catheter inserted via arteriotomy into a rat common carotid artery, without requiring permanent ligation of branching arteries. After 2 weeks post-injury this model elicits highly reproducible neointimal hyperplasia and rates of re-endothelialisation similar to current wire and balloon injury models. Furthermore, evaluation of the smooth muscle cell phenotype profile, inflammatory response and extracellular matrix within the developing neointima, showed that our model replicated the vessel remodelling outcomes critical to restenosis and those becoming increasingly focused upon in the development of new anti-restenosis therapies.
... Numerous methods to introduce endothelial injury with varying degrees of modelling difficulties had been studied [14]. A common disease model for IH following endothelial dysfunction is the murine carotid artery balloon injury model where mechanical injury of EC lining was established and subsequent endothelialisation were analyzed [15]. In this model, injuries to the medial layer are expected, activating SMC over-proliferation due to phenotypic switching as a response to endothelial dysfunction resulting in accelerated progression of vessel stenosis [14,16,17]. ...
... Endothelial dysfunction is recognised as a key feature in various cardiovascular diseases [6]. Currently, the most common method to induce endothelial injury is through mechanical means, such as using wires, balloon catheters or needles [15]. Although this approach effectively causes endothelial injury, it comes with several drawbacks. ...
Endothelial dysfunction initiates the pathogenesis of a myriad of cardiovascular diseases, yet the precise underlying mechanisms remain unclear. Current model utilises mechanical denudation of arteries resulting in an arterial-injury model with onset of intimal hyperplasia (IH). Our study shows that 5 min enzymatic denudation of human umbilical artery (hUA) lumen at 37 °C efficiently denudes hUA while maintaining vessel integrity without significantly increase intima-media thickness after 7 days in culture. This ex-vivo model will be a valuable tool in understanding the mechanism of re-endothelialization prior to smooth muscle cells (SMC) activation thus placating IH at an early stage.
... The balloon injuries were performed in rat carotid arteries using male 8-week-old Sprague-Dawley rats weighing 220-260 g (Hunan SJA Laboratory Animal Co., Ltd.) as previously described (22). The left common carotid arteries were fully exposed after the rats were anesthetized. ...
N6-methylatidine (m6A) is involved in post-transcriptional metabolism and a variety of pathological processes. However, little is known about the role of m6A in vascular proliferative diseases, particularly in vascular smooth muscle cells (VSMCs) phenotype switching-induced neointimal hyperplasia. In the current study, we discovered that methyltransferase like 3 (METTL3) is a critical candidate for catalyzing a global increase in m6A in response to carotid artery injury and various VSMCs phenotype switching. The inhibited neointimal hyperplasia was obtained after in vivo gene transfer to knock-down Mettl3. In vitro overexpression of Mettl3 resulted in increased VSMC proliferation, migration, and reduced contractile gene expression with a global elevation of m6A modification. In contrast, Mettl3 knockdown reversed this facilitated phenotypic switch in VSMCs, as demonstrated by downregulated m6A, decreased proliferation, migration, and increased expression of contractile genes. Mechanistically, Mettl3 knock-down was found to promote higher phosphatidylinositol 3-kinase (Pi3k) mRNA decay thus inactivating the PI3K/AKT signal to inhibit VSMCs phenotype switching. Overall, our findings highlight the importance of METTL3-mediated m6A in VSMCs phenotype switching and offer a novel perspective on targeting METTL3 as a therapeutic option for VSMCs phenotype switching modulated pathogenesis, including atherosclerosis and restenosis.
... The carotid balloon injury model was performed as described previously study. 25 Following a midline neck incision, the left common, internal, and external carotid arteries (CCA, ICA, and ECA, respectively) were exposed. A 2-French Fogarty balloon (Edwards Lifesciences, Irvine, CA, USA) was inserted into the CCA. ...
Neointimal hyperplasia (NIH) after revascularization is a key unsolved clinical problem. Various studies have shown that attenuation of the acute inflammatory response on the vascular wall can prevent NIH. MicroRNA146a‐5p (miR146a‐5p) has been reported to show anti‐inflammatory effects by inhibiting the NF‐κB pathway, a well‐known key player of inflammation of the vascular wall. Here, a nanomedicine, which can reach the vascular injury site, based on polymeric micelles was applied to deliver miR146a‐5p in a rat carotid artery balloon injury model. In vitro studies using inflammation‐induced vascular smooth muscle cell (VSMC) was performed. Results showed anti‐inflammatory response as an inhibitor of the NF‐κB pathway and VSMC migration, suppression of reactive oxygen species production, and proinflammatory cytokine gene expression in VSMCs. A single systemic administration of miR146a‐5p attenuated NIH and vessel remodeling in a carotid artery balloon injury model in both male and female rats in vivo. MiR146a‐5p reduced proinflammatory cytokine gene expression in injured arteries and monocyte/macrophage infiltration into the vascular wall. Therefore, miR146a‐5p delivery to the injury site demonstrated therapeutic potential against NIH after revascularization.
... To investigate the role of ICS-II in vascular remodeling, a rat carotid artery balloon injury model was implemented, which is capable of mimicking vascular remodeling as well as VSMC phenotypic transition validly in vivo (Tulis, 2007;Zhang and Trebak, 2014). Results from the morphometric analysis showed that ICS-II significantly suppressed intima thickness and intima/ media ratio ( Figure 1A-C) at day 14 compared to the control group (p < 0.05). ...
Vascular smooth muscle cell (VSMC) phenotypic transition represents the fundamental pathophysiological alteration in the vascular remodeling process during the initiation and progression of cardiovascular diseases. Recent studies have revealed that Icariside II (ICS-II), a flavonol glycoside derived from the traditional Chinese medicine Herba Epimedii, exhibited therapeutic effects in various cardiovascular diseases. However, the therapeutic efficacy and underlying mechanisms of ICS-II regarding VSMC phenotypic transition were unknown. In this study, we investigated the therapeutic effects of ICS-Ⅱ on vascular remodeling with a rat’s balloon injury model in vivo . The label-free proteomic analysis was further implemented to identify the differentially expressed proteins (DEPs) after ICS-II intervention. Gene ontology and the pathway enrichment analysis were performed based on DEPs. Moreover, platelet-derived growth factor (PDGF-BB)-induced primary rat VSMC was implemented to verify the restoration effects of ICS-II on the VSMC contractile phenotype. Results showed that ICS-II could effectively attenuate the vascular remodeling process, promote SMA-α protein expression, and inhibit OPN expression in vivo . The proteomic analysis identified 145 differentially expressed proteins after ICS-II intervention. Further, the bioinformatics analysis indicated that the focal adhesion signaling pathway was enriched in the ICS-II group. In vitro studies showed that ICS-II suppressed VSMC proliferation and migration, and promoted VSMC contractile phenotype by modulating the focal adhesion signaling pathway. Taken together, our results suggest that ICS-II attenuates the vascular remodeling process and restores the VSMC contractile phenotype by promoting the focal adhesion pathway.
... The contradictory observations could be due to the different models (AVF in mice with kidney failure versus balloon injury/ partial left carotid artery ligation injury in rat/mice with normal kidney function) used in the two studies. The artery injury model is induced by completely removing the endothelial layer and causing a distending mural injury in rat/mice with normal kidney function (48). In patients with kidney failure, uremic milieu contributes to a multitude of vascular diseases including venous intimal hyperplasia even prior to hemodialysis access surgery (7,49,50). ...
Jumonji domain-containing protein-3 (JMJD3), a histone H3 lysine 27 (H3K27) demethylase, promotes endothelial regeneration, but its function in neointimal hyperplasia (NIH) of arteriovenous fistulas (AVF) has not been explored. In this study, we examined the contribution of endothelial JMJD3 to NIH of AVF and the mechanisms underlying JMJD3 expression during kidney failure. We found that the expression of endothelial JMJD3 was negatively associated with NIH of AVF in kidney failure patients. JMJD3 expression in endothelial cells (ECs) was also downregulated in the vasculature of chronic kidney disease (CKD) mice. Additionally, specific knockout of endothelial JMJD3 delayed EC regeneration, enhanced endothelial mesenchymal transition, impaired endothelial barrier function as determined by increased Evans blue staining and inflammatory cell infiltration, and accelerated neointima formation in the AVF created by venous end to arterial side anastomosis in CKD mice. Mechanistically, JMJD3 expression was downregulated via binding of TGFβ1-mediated Hes family transcription factor Hes1 to its gene promoter. Knockdown of JMJD3 enhanced histone H3K27 methylation, thereby inhibiting transcriptional activity at promoters of EC markers and reducing migration and proliferation of ECs. Furthermore, knockdown of endothelial JMJD3 decreased endothelial nitric oxide synthase expression and nitric oxide production, leading to the proliferation of vascular smooth muscle cells. In conclusion, we demonstrate that decreased expression of endothelial JMJD3 impairs EC regeneration and function, and accelerates neointima formation in AVFs. We propose increasing the expression of endothelial JMJD3 could represent a new strategy for preventing endothelial dysfunction, attenuating NIH, and improving AVF patency in patients with kidney failure.
... Once the GNRs accumulate in a tissue, the DR profile immediately changes due to the absorption properties of the Au nanoparticles [40,41]. The unstable plaque in the rats' arteries was modeled by balloon injured carotid arteries [42]. In this work, we used the DR method to ensure the GNRs and GNR-HDL accumulations in the injured arteries 24 h post the GNRs injection. ...
Cardiovascular disease (CVD) is a major cause of death and disability worldwide. A real need exists in the development of new, improved therapeutic methods for treating CVD, while major advances in nanotechnology have opened new avenues in this field. In this paper, we report the use of gold nanoparticles (GNPs) coated with high-density lipoprotein (HDL) (GNP-HDL) for the simultaneous detection and therapy of unstable plaques. Based on the well-known HDL cardiovascular protection, by promoting the reverse cholesterol transport (RCT), injured rat carotids, as a model for unstable plaques, were injected with the GNP-HDL. Noninvasive detection of the plaques 24 h post the GNP injection was enabled using the diffusion reflection (DR) method, indicating that the GNP-HDL particles had accumulated in the injured site. Pathology and noninvasive CT measurements proved the recovery of the injured artery treated with the GNP-HDL. The DR of the GNP-HDL presented a simple and highly sensitive method at a low cost, resulting in simultaneous specific unstable plaque diagnosis and recovery.
... The rat carotid artery balloon injury model is the most common in vivo model widely used to study ISR. This approach consists of isolating a segment from the right common carotid artery in SD rats under general anesthesia (pentobarbital sodium, 60 mg/kg, i.p.), creating an arteriotomy incision in the external carotid branch followed by inserting a balloon catheter (Fogarty, 12A0602F, 0.67 mm, Edwards Lifesciences) into the common carotid artery, repeated balloon inflation and pulling back five times to imitate percutaneous transluminal coronary angioplasty (PTCA), and finally removal of the catheter with external carotid ligation (10). The rats were sacrificed with an overdose of pentobarbital sodium (200 mg/kg, iv) at 28 days after the procedure, and their left (control group) and right (case group) carotid arteries (Supplementary Figure 1A) were subsequently collected for further study. ...
Aims: In-stent restenosis (ISR) remains an Achilles heel of drug-eluting stents despite technical advances in devices and procedural techniques. Neointimal hyperplasia (NIH) is the most important pathophysiological process of ISR. The present study mapped normal arteries and stenotic arteries to uncover potential cellular targets of neointimal hyperplasia.
Methods and Results: By comparing the left (control) and right (balloon injury) carotid arteries of rats, we mapped 11 clusters in normal arteries and 11 mutual clusters in both the control and experimental groups. Different clusters were categorized into 6 cell types, including vascular smooth muscle cells (VSMCs), fibroblasts, endothelial cells (ECs), macrophages, unknown cells and others. An abnormal cell type expressing both VSMC and fibroblast markers at the same time was termed a transitional cell via pseudotime analysis. Due to the high proportion of VSMCs, we divided them into 6 clusters and analyzed their relationship with VSMC phenotype switching. Moreover, N-myristoyltransferase 1 (NMT1) was verified as a credible VSMC synthetic phenotype marker. Finally, we proposed several novel target genes by disease susceptibility gene analysis, such as Cyp7a1 and Cdk4, which should be validated in future studies.
Conclusion: Maps of the heterogeneous cellular landscape in the carotid artery were defined by single-cell RNA sequencing and revealed several cell types with their internal relations in the ISR model. This study highlights the crucial role of VSMC phenotype switching in the progression of neointimal hyperplasia and provides clues regarding the underlying mechanism of NIH.
... RhoGDI1-shRNA: GCAAGATTGACAAGACTGACTATTCAAGAGATAGTCAGTCTTGT-CAATCTTGTTTTTT. Cdc42-shRNA: CACCGCTTGTTGGGACTCAAATTGACGAATCAA TTTGAGTCCCAACAAGCTTTTTT. Rat carotid artery balloon injury (BI) was performed as previously described [26]. After the BI operation, the carotid artery was injected with approximately 0.2 mL of adenovirus solution for specifically knocking down RhoGDI1 or Cdc42 (titer: 1.0 × 10 10 pfu) using a small needle. ...
RhoGTPase is involved in PDGF-BB-mediated VSMC phenotypic modulation. RhoGDIs are key factors in regulating RhoGTPase activation. In the present study, we investigated the regulatory effect of RhoGDI1 on the activation of RhoGTPase in VSMC transformation and neointima formation. Western blot and co-immunoprecipitation assays showed that the PDGF receptor inhibition by crenolanib promoted RhoGDI1 polyubiquitination and degradation. Inhibition of RhoGDI1 degradation via MG132 reversed the decrease in VSMC phenotypic transformation. In addition, RhoGDI1 knockdown significantly inhibited VSMC phenotypic transformation and neointima formation in vitro and in vivo. These results suggest that PDGF-BB promotes RhoGDI1 stability via the PDGF receptor and induces the VSMC synthetic phenotype. The co-immunoprecipitation assay showed that PDGF-BB enhanced the interaction of RhoGDI1 with Cdc42 and promoted the activation of Cdc42; these enhancements were blocked by crenolanib and RhoGDI1 knockdown. Moreover, RhoGDI1 knockdown and crenolanib pretreatment prevented the localization of Cdc42 to the plasma membrane (PM) to activate and improve the accumulation of Cdc42 on endoplasmic reticulum (ER). Furthermore, Cdc42 inhibition or suppression significantly reduced VSMC phenotypic transformation and neointima formation in vitro and in vivo. This study revealed the novel mechanism by which RhoGDI1 stability promotes the RhoGDI1-Cdc42 interaction and Cdc42 activation, thereby affecting VSMC phenotypic transformation and neointima formation.
