FIGURE 3 - uploaded by Richard Padgett
Content may be subject to copyright.
Sequences of the 3 0 splice site mutants used to determine the branch site to 3 0 splice site spacing constraints for a /GU-AG/ U12-dependent intron. The top line is the original P120 intron F sequence with the consensus 5 0 splice site and branch site sequences boxed. The second line is the /GU-AG/ version of this intron, which includes a mutation of the À1G to an A adjacent to the 5 0 splice site. This reduces the use of this 5 0 splice site by the U2- dependent spliceosome (Dietrich et al. 1997). The 3 0 splice sites of the constructs are shown at the right of the figure. The common branch site is shown in bold and the mutated positions are underlined. The sites of in vivo splicing for each construct are indicated by the arrows. Major sites are indicated by dark arrowheads and minor sites are indicated by light arrowheads. The numbers at the top refer to the distance in nucleotides between the branch site adenosine and the dashed lines.
Source publication
Introns spliced by the U12-dependent minor spliceosome are divided into two classes based on their splice site dinucleotides. The /AU-AC/ class accounts for about one-third of U12-dependent introns in humans, while the /GU-AG/ class accounts for the other two-thirds. We have investigated the in vivo and in vitro splicing phenotypes of mutations in...
Contexts in source publication
Context 1
... also combined each of these mutants to generate five single mutants and six double mutants. Figure 2 shows the RT- PCR analysis of the in vivo splicing patterns of these ,3), three single mutants of the 3 0 splice site À2 position (lanes 4-6), and six double mutants (lanes 7-12). The indicated minigene con- structs were transfected into CHO cells and total RNA prepared after 48 h. ...
Context 2
... investigate the mechanistic basis of this difference between the two subclasses of U12-dependent introns, we have examined the effects on in vivo and in vitro splicing of altering the branch site to 3 0 splice site distance in a /GU- AG/ intron. For this analysis, we used the G-1A/A1G 5 0 splice site mutant of P120 intron F and combined it with 3 0 splice sites based on the C99G mutant to give the mutant labeled GU-AG + 10 in Figure 3. The in vivo and in vitro splicing phenotype of this mutant was reported previously ( Dietrich et al. 1997). ...
Context 3
... in vivo and in vitro splicing phenotype of this mutant was reported previously ( Dietrich et al. 1997). Additional mutants were constructed as shown in Figure 3 to both increase and decrease the distance between the branch site and the 3 0 splice site. These mutants were analyzed for their in vivo splicing phenotypes by transfection into CHO cells followed by RT-PCR amplification of the intron F region of the mini- gene construct. ...
Context 4
... numbers at the left indicate the distance in nucleotides between the branch site and the 3 0 splice site in each product. The results are summarized in Figure 3. In all cases, the U12-dependent 5 0 splice site at position 1 was used. ...
Context 5
... spite of the clear preference for the canonical residues at the 5 0 +2 and 3 0 À2 positions, it is noteworthy that nonconsensus 3 0 dinucleotides can become active when the 3 0 splice site is moved to more distal positions as shown in Figure 3. These mutants show splicing of a 5 0 /GU to 3 0 UG/ and CG/ dinucleotides. ...
Context 6
... templates for in vitro transcription were prepared by PCR amplification using the P120 minigene constructs with 3 0 splice site sequences shown in Figure 3 as described (Dietrich et al. 1997(Dietrich et al. , 2001). For the XRP wild-type and mutant templates, a common 5 0 PCR primer located in the upstream exon (GCGAAGCTTAATACGACT CACTATAG) was used with specific 3 0 primers that included the branch site, 3 0 splice site(s), and downstream exon (XRP wild type: GGAGTACTTACCCCAACAGAGCGGATAACAATTTCACACAGG CTTCTGTGTTGTATTGAC; XRP oligo CAG: CTGTGTTGTATT GACTCTACGATGCCAGCGTCTCCAGGTCTTAGTTGGGGCAAA CATACGCCCACCACGCTGCTGCTGCTGCTGATATTAAGGAAA ATA; XRP AG + 11 + 15: CTGTGTTGTATTGACTCTACGATGC CAGCGTCTCCAGGTCTTAGTTGGGGCAAACATACGCCCACCA CGACACATCTGTCTGCAAATATTAAGGAAAATA). ...
Similar publications
The U12-type dependent (minor) spliceosome excises a rare group of introns that are characterized by a highly conserved 5' splice site and branch point sequence. Several new congenital or somatic diseases have recently been associated with mutations in components of the minor spliceosome. A common theme in these diseases is the detection of elevate...
The 3' end of Schizosaccharomyces pombe telomerase RNA (SpTER1) is generated by spliceosomal cleavage, a reaction that corresponds to the first step of splicing. The observation that the spliceosome functions in 3' end processing raised questions about the evolutionary origin and conservation of this mechanism. We now present data in support of spl...
Luc7 is an essential 261-amino acid protein subunit of the Saccharomyces cerevisiae U1 snRNP. To establish structure-function relations for yeast Luc7, we conducted an in vivo mutational analysis entailing N- and C-terminal truncations and alanine scanning of phylogenetically conserved amino acids, including two putative zinc finger motifs, ZnF1 an...
In eukaryotes, genes are transcribed by RNA polymerase-II (Pol-II) and introns are removed by the spliceosome largely cotranscriptionally1–3; analysis using long-read sequencing revealed that splicing occurs immediately after Pol-II passes introns in yeast4,5. Here, we developed a Nanopore-based method to profile chromatin-bound RNA that enables th...
The spliceosome accurately promotes precursor messenger-RNA splicing by recognizing specific noncoding intronic tracts including the branch point sequence (BPS) and the 3’-splice-site (3’SS). Mutations of Hsh155 (yeast)/SF3B1 (human), which is a protein of the SF3b factor involved in BPS recognition and induces altered BPS binding and 3’SS selectio...
Citations
... 5' splice sites of the U12-type introns have a highly conserved consensus sequence, but their base-pairing potential to U11 snRNP is limited. Our structure shows that only four nucleotides of the previously identified 5'SS binding region of the U11 snRNA (26,45,46) remain single-stranded and available for base-pairing. This contrasts with a much longer 5'-SS binding region of the U1 snRNP (47). ...
The minor spliceosome catalyses the excision of U12-dependent introns from pre-mRNAs. These introns are rare, but their removal is critical for cell viability. We obtained a cryo-EM reconstruction of the 13-subunit U11 snRNP complex, revealing structures of U11 snRNA and five minor spliceosome-specific factors. U11 snRNP appears strikingly different from the equivalent major spliceosome U1 snRNP. SNRNP25 and SNRNP35 form a dimer, which specifically recognises U11 snRNA. PDCD7 forms extended helices, which bridge SNRNP25 and SNRNP48, located at the distal ends of the particle. SNRNP48 forms multiple interfaces with U11 snRNP and, together with ZMAT5, are positioned near the 5′-end of the U11 snRNA and likely stabilise the binding of the incoming 5′-SS. Our structure provides mechanistic insights into U12-dependent intron recognition and the evolution of the splicing machinery.
... Dinucleotides at 5SS and 3SS are highly conserved and required for proper splicing. [23][24][25] A study revealed that 98.92% of all splice sites in the human genome are composed of GT-AG dinucleotides, with the 1.07% remaining sites exhibiting GC-AG, AT-AC, and other less prevalent dinucleotides. ...
Alternative splicing (AS) of RNA molecules is a key contributor to transcriptome diversity. In humans, 90%-95% of multi-exon genes produce alternatively spliced RNA transcripts. Therefore, every single gene has the opportunity of producing multiple splice variants, including long non-coding RNA (lncRNA) genes that undergo RNA maturation steps such as conventional and alternative splicing. Emerging evidence suggests significant roles for these lncRNA splice variants in many aspects of cell biology. Differential changes in expression of specific lncRNA splice variants have also been associated with many diseases including cancer. This review covers the current knowledge on this emerging topic of investigation. We provide exclusive insights on the AS landscape of lncRNAs and also describe at the molecular level the functional relevance of lncRNA splice variants, i.e., RNA-based differential functions, production of micropeptides, and generation of circular RNAs. Finally, we discuss exciting perspectives for this emerging field and outline the work required to further develop research endeavors in this field.
... When an ancestral minor intron ceases to be a minor intron, it is thought to happen primarily in one of two ways: the entire intron sequence could be lost via, for example, reverse transcriptase-mediated reinsertion of spliced mRNA [44,17,88,33], or the intron could undergo sequence changes sufficient to allow it to be recognized instead by the major spliceosome [11,21,20,26]. From first-principles arguments based on the greater information content of the minor intron motifs [11,10,21] along with empirical analyses [44], it is assumed that intron conversion proceeds almost universally unidirectionally from minor to major. ...
Spliceosomal introns are segments of eukaryotic pre-mRNA that are removed ("spliced") during creation of mature mRNA, and are one of the defining and domain-specific features of gene structure in eukaryotes. Introns are spliced by a large, multi-subunit ribonucleoprotein machinery called the spliceosome, and most eukaryotic genomes contain two distinct sets of this machinery - the major (or U2-type) spliceosome is responsible for removal of the vast majority (usually > 99%) of introns in a given genome, with the minor (or U12-type) spliceosome processing the remaining minuscule fraction. Despite in some cases only being responsible for the removal of single-digit numbers of introns in entire genomes, the minor splicing system has been maintained over the roughly 1.5 billion years of eukaryotic evolution since the last eukaryotic common ancestor, and a number of recent studies have suggested that minor introns may be involved in certain aspects of cell cycle regulation and cancer development. It is in this context that we present a broad bioinformatic survey of minor introns across more than 3000 eukaryotic genomes, providing a dramatic increase in information about their distribution in extant species, descriptions of their evolutionary dynamics and features across the eukaryotic tree, and estimates of the minor intron complements of various ancestral nodes.
... Most minor introns have AT-AC or GT-AG terminal dinucleotides (24 and 69%, respectively) (Sheth et al, 2006;Moyer et al, 2020). In addition, the 3 0 terminal nucleotide can vary, thus giving rise to AT-AN and GT-AN classes of minor introns (Levine & Durbin, 2001;Dietrich et al, 2005). For simplicity, we refer to these as A-and G-type introns, respectively. ...
... Only later, it was shown that there are also major AT-AC introns and that most of the minor introns in fact have GT-AG termini (Dietrich et al, 1997;Sharp & Burge, 1997;Wu & Krainer, 1997). Additionally, minor introns have infrequent variations in the 3 0 terminal nucleotide (Levine & Durbin, 2001;Dietrich et al, 2005), thus giving rise to the AT-AN and GT-AN classes of minor introns, here referred to as A-and G-type introns, respectively. Significantly, in all known minor spliceosome diseases for which comprehensive transcriptome data are available, splicing defects are roughly uniformly distributed between the A-and G-type introns (Argente et al, 2014;Madan et al, 2015;Merico et al, 2015;Cologne et al, 2019) (Fig 5A-C, ZRSR2 mutation). ...
Aneuploidy is the leading cause of miscarriage and congenital birth defects, and a hallmark of cancer. Despite this strong association with human disease, the genetic causes of aneuploidy remain largely unknown. Through exome sequencing of patients with constitutional mosaic aneuploidy, we identified biallelic truncating mutations in CENATAC (CCDC84). We show that CENATAC is a novel component of the minor (U12-dependent) spliceosome that promotes splicing of a specific, rare minor intron subtype. This subtype is characterized by AT-AN splice sites and relatively high basal levels of intron retention. CENATAC depletion or expression of disease mutants resulted in excessive retention of AT-AN minor introns in ~ 100 genes enriched for nucleocytoplasmic transport and cell cycle regulators, and caused chromosome segregation errors. Our findings reveal selectivity in minor intron splicing and suggest a link between minor spliceosome defects and constitutional aneuploidy in humans.
... Inspection of these introns reveals that the vast majority of these splice sites are only a few nucleotides away from a conventional U2type splice site with canonical terminal dinucleotides; these splice sites with non-canonical dinucleotides were likely annotated on the basis of conserved exon boundaries, without regard for the precise placement of the splice sites. The proportion of U12-type introns with non-canonical terminal dinucleotides (Table 2) largely agrees with previous investigations (35,36,63). ...
During nuclear maturation of most eukaryotic pre-messenger RNAs and long non-coding RNAs, introns are removed through the process of RNA splicing. Different classes of introns are excised by the U2-type or the U12-type spliceosomes, large complexes of small nuclear ribonucleoprotein particles and associated proteins. We created intronIC, a program for assigning intron class to all introns in a given genome, and used it on 24 eukaryotic genomes to create the Intron Annotation and Orthology Database (IAOD). We then used the data in the IAOD to revisit several hypotheses concerning the evolution of the two classes of spliceosomal introns, finding support for the class conversion model explaining the low abundance of U12-type introns in modern genomes.
... U12-type introns were first discovered due to their unusual AT-AC dinucleotide donor and acceptor splice sites and believed to harbor exclusively these sequences (Jackson 1991). They are now computationally identified based on their specific donor splice site and branch point sequence (BPS) consensus sequences, the latter being located within a specific window of 10-13 nt before the acceptor splice site (Dietrich et al. 2001a(Dietrich et al. , 2005. In 2007, these criteria enabled to identify 695 introns of the U12-type in the human genome, thus representing <1% of all human introns (Alioto 2007). ...
Minor intron splicing plays a central role in human embryonic development and survival. Indeed, biallelic mutations in RNU4ATAC, transcribed into the minor spliceosomal U4atac snRNA, are responsible for three rare autosomal recessive multimalformation disorders named Taybi-Linder (TALS/MOPD1), Roifman (RFMN), and Lowry-Wood (LWS) syndromes, which associate numerous overlapping signs of varying severity. Although RNA-seq experiments have been conducted on a few RFMN patient cells, none have been performed in TALS, and more generally no in-depth transcriptomic analysis of the ∼700 human genes containing a minor (U12-type) intron had been published as yet. We thus sequenced RNA from cells derived from five skin, three amniotic fluid, and one blood biosamples obtained from seven unrelated TALS cases and from age- and sex-matched controls. This allowed us to describe for the first time the mRNA expression and splicing profile of genes containing U12-type introns, in the context of a functional minor spliceosome. Concerning RNU4ATAC-mutated patients, we show that as expected, they display distinct U12-type intron splicing profiles compared to controls, but that rather unexpectedly mRNA expression levels are mostly unchanged. Furthermore, although U12-type intron missplicing concerns most of the expressed U12 genes, the level of U12-type intron retention is surprisingly low in fibroblasts and amniocytes, and much more pronounced in blood cells. Interestingly, we found several occurrences of introns that can be spliced using either U2, U12, or a combination of both types of splice site consensus sequences, with a shift towards splicing using preferentially U2 sites in TALS patients' cells compared to controls.
... Proper intron recognition and removal rely on consensus sequences located at the intron/exon boundaries. Dinucleotide sequences at these boundaries have been found to be strongly conserved and relevant for proper splicing (3)(4)(5). Nearly all introns belong to the so-called U2-type, which are spliced by the major spliceosome and are flanked by GT-AG splice site dinucleotides. The most frequent exception to this rule are the U2-type GC-AG splice sites, comprising ∼0.9% of human splice sites (6). ...
... Despite the disruptive splicing effects that have mutations of splice site dinucleotides (3)(4)(5), introns with non-canonical splice sites (that is, with sequences other than GT-AG, GC-AG or AT-AC at the intron/exon boundaries) have been reported to be efficiently removed (6,(8)(9)(10)(11)(12). These reported non-canonical splice sites have U2/U12-like splice site consensus sequences (U2/U12-like non-canonical splice sites). ...
We uncovered the diversity of non-canonical splice sites at the human transcriptome using deep transcriptome profiling. We
mapped a total of 3.7 billion human RNA-seq reads and developed a set of stringent filters to avoid false non-canonical splice
site detections. We identified 184 splice sites with non-canonical dinucleotides and U2/U12-like consensus sequences. We selected
10 of the herein identified U2/U12-like non-canonical splice site events and successfully validated 9 of them via reverse
transcriptase-polymerase chain reaction and Sanger sequencing. Analyses of the 184 U2/U12-like non-canonical splice sites
indicate that 51% of them are not annotated in GENCODE. In addition, 28% of them are conserved in mouse and 76% are involved
in alternative splicing events, some of them with tissue-specific alternative splicing patterns. Interestingly, our analysis
identified some U2/U12-like non-canonical splice sites that are converted into canonical splice sites by RNA A-to-I editing.
Moreover, the U2/U12-like non-canonical splice sites have a differential distribution of splicing regulatory sequences, which
may contribute to their recognition and regulation. Our analysis provides a high-confidence group of U2/U12-like non-canonical
splice sites, which exhibit distinctive features among the total human splice sites.
... As discussed above, splicing of U11 and U12-type introns requires U11 and U12 snRNAs.Figure 2D shows that, following oligonucleotide-directed RNase H degradation of either U11 or U12 snRNA, the Urp–P120 39 splice site interaction did not occur. Previous studies have shown that mutating the C of the 39 splice site AC dinucleotide does not impair splicing of a U12-type intron, whereas mutation of the A is detrimental (Dietrich et al. 2001Dietrich et al. , 2005). To determine whether these splicing results correlated with binding of Urp to the 39 splice site, we analyzed a series of P120 derivatives that have been characterized previously for splicing activity (Dietrich et al. 2001Dietrich et al. , 2005). ...
... Previous studies have shown that mutating the C of the 39 splice site AC dinucleotide does not impair splicing of a U12-type intron, whereas mutation of the A is detrimental (Dietrich et al. 2001Dietrich et al. , 2005). To determine whether these splicing results correlated with binding of Urp to the 39 splice site, we analyzed a series of P120 derivatives that have been characterized previously for splicing activity (Dietrich et al. 2001Dietrich et al. , 2005). The UV-cross-linking experiment ofFigure 2E shows that mutation of the 39 splice site AC dinucleotide to either AU, AA, or AG had no effect on binding of Urp. ...
... Inactivation of U11 or U12 snRNA by RNase H-directed cleavage was performed as described previously (Shen et al. 2004 ) using a DNA oligonucleotide complementary to the 59 end of U11 snRNA (59-UCACGAC AGAAGCCCUUUUU-39) or the branchpoint base-pairing region of U12 snRNA (59-AUUUUCCUUACUCAUAAG-39). Previously described P120 mutants (Dietrich et al. 2005) were obtained from Richard Padgett (Lerner Research Institute). Mild heat treatment of NE or DUrpNE was performed by heating the extract for 20 min at 43°C (Krainer and Maniatis 1985; Wu and Green 1997). ...
The U2AF35-related protein Urp has been implicated previously in splicing of the major class of U2-type introns. Here we show that Urp is also required for splicing of the minor class of U12-type introns. Urp is recruited in an ATP-dependent fashion to the U12-type intron 3' splice site, where it promotes formation of spliceosomal complexes. Remarkably, Urp also contacts the 3' splice site of a U2-type intron, but in this case is specifically required for the second step of splicing. Thus, through recognition of a common splicing element, Urp facilitates distinct steps of U2- and U12-type intron splicing.
... Naturally occurring U12-type introns with these three sets of termini (CT-AC, GG-AG, GA-AG) have never been reported before. In a mutational study of terminal dinucleotide in U12-type introns, all sixteen possible combinations of first and last nucleotides were tested in the context of NU-AN [41] . Indeed the combination CU- AC yields correct splicing products, albeit with a lower efficiency than the wide type. ...
... The discovery of these non-canonical U12-type introns has two important implications. Firstly, this finding shows that the variation in the 5' termini is greater than previously thought and confirms the results of that mutational study [41] . Secondly, it underscores the difficulty faced if noncanonical introns are to be recognized in genome-scale analyses. ...
Many multicellular eukaryotes have two types of spliceosomes for the removal of introns from messenger RNA precursors. The major (U2) spliceosome processes the vast majority of introns, referred to as U2-type introns, while the minor (U12) spliceosome removes a small fraction (less than 0.5%) of introns, referred to as U12-type introns. U12-type introns have distinct sequence elements and usually occur together in genes with U2-type introns. A phylogenetic distribution of U12-type introns shows that the minor splicing pathway appeared very early in eukaryotic evolution and has been lost repeatedly.
We have investigated the evolution of U12-type introns among eighteen metazoan genomes by analyzing orthologous U12-type intron clusters. Examination of gain, loss, and type switching shows that intron type is remarkably conserved among vertebrates. Among 180 intron clusters, only eight show intron loss in any vertebrate species and only five show conversion between the U12 and the U2-type. Although there are only nineteen U12-type introns in Drosophila melanogaster, we found one case of U2 to U12-type conversion, apparently mediated by the activation of cryptic U12 splice sites early in the dipteran lineage. Overall, loss of U12-type introns is more common than conversion to U2-type and the U12 to U2 conversion occurs more frequently among introns of the GT-AG subtype than among introns of the AT-AC subtype. We also found support for natural U12-type introns with non-canonical terminal dinucleotides (CT-AC, GG-AG, and GA-AG) that have not been previously reported.
Although complete loss of the U12-type spliceosome has occurred repeatedly, U12 introns are extremely stable in some taxa, including eutheria. Loss of U12 introns or the genes containing them is more common than conversion to the U2-type. The degeneracy of U12-type terminal dinucleotides among natural U12-type introns is higher than previously thought.
... These introns mainly consist of two subtypes, as defined by their terminal dinucleotides: AT–AC and GT–AG introns. In addition, a small fraction of the U12-type introns exhibit other terminal dinucleotides [Wu and Krainer 1997; Levine and Durbin, 2001; Dietrich et al., 2005]. Whereas U2-type introns have been found in virtually all eukaryotes [Collins and Penny, 2005] and comprise the vast majority of the splice sites found in any organism, U12-type introns have only been identified in vertebrates, insects, jellyfish and plants [Burge et.al, 1998]. ...
We define new profiles based on hydropathy properties and point out specific profiles for regions surrounding splice sites. We built a set T of flanking regions of genes with 1-3 introns from 21st and 22nd chromosomes. These genes contained 313 introns and 385 exons and were extracted from GenBank. They were used in order to define hydropathy profiles. Most human introns, around 99.66%, are likely to be U2- type introns. They have highly degenerate sequence motifs and many different sequences can function as U2-type splice sites. Our new profiles allow to identify regions which have conservative biochemical features that are essential for recognition by spliceosome. We have also found differences between hydropathy profiles for U2 or U12-types of introns on sets of spice sites extracted from SpliceRack database in order to distinguish GT?AG introns belonging to U2 and U12-types. Indeed, intron type cannot be simply determined by the dinucleotide termini. We show that there is a similarity of hydropathy profiles inside intron types. On the one hand, GT?AG and GC?AG introns belonging to U2-type have resembling hydropathy profiles as well as AT?AC and GT?AG introns belonging to U12-type. On the other hand, hydropathy profiles of U2 and U12-types GT?AG introns are completely different. Finally, we define and compute a pvalue; we compare our profiles with the profiles provided by a classical method, Pictogram.
