Figure 3 - available from: Scientific Reports
This content is subject to copyright. Terms and conditions apply.
QCT tracking analysis quantifies contamination and sample mixups. (A) The experiment from Fig. 2C was analyzed for contamination using QCTs. Either 4x, 2x, 1x or 0 QCT molecules were added to 96 PCRs and sequenced on an Illumina Miseq lane using Truseq-style index pairs. Each EMI cluster for a given i5/i7 index pair was classified as contamination if (i) the read depth was below threshold (see Methods and Fig. S2), and (ii) the same EMI cluster was found to originate from another index pair. The QCT contamination fraction for a given index pair is the ratio of contaminating reads over total reads. (B) Demonstration of QCT tracking analysis to identify the source of contamination. Contaminating EMI clusters in the D707/D504 index pair (yellow box, A) are found to mostly originate from D701/D504 (left), and likewise, contaminants in D707/ D504 are found to originate from D707/D504 (right). (C) QCT contamination tracking shows dual-unique indexes drastically reduce index misassignment. Both dual-unique indexes and Truseq-style index pairs were used on 120 samples prepared and sequenced in batch. Contamination source/destination is shown for all pairs of the 120 PCRs. The reactions that used dual-unique indexes (inset 1) typically had 0.006% contamination compared to 0.5% contamination using Truseq-style index pairs, particularly for D701 and D704 (insets 2a and 2b). Relatively high contamination was also observed in Truseq-style PCRs that had a D7xx index in common (example in inset 3), which is consistent with index misassignment. (D) Pairwise analysis of QCT fingerprints identifies sample mixups. Forty-eight PCRs were processed in parallel, dual unique indexed, and sequenced on a Miseq lane. The similarity of QCT fingerprints is quantified as the number of high read depth EMI clusters in common (i.e. collisions) between two reactions. The number of collisions for all pairs of PCRs is shown.
Source publication
Next-generation DNA sequencing is currently limited by an inability to accurately count the number of input DNA molecules. Molecular counting is particularly needed when accurate quantification is required for diagnostic purposes, such as in single gene non-invasive prenatal testing (sgNIPT) and liquid biopsy. We developed Quantitative Counting Tem...
Contexts in source publication
Context 1
... identify the sample. Given a total pool diversity of 1 million sequences, ~10 443 fingerprints are possible if 100 sequences are added to each PCR. Analysis of PCR fingerprints across the entire sequencing workflow can then be used to rule out the possibility that detected rare variants in any given reaction are from sample cross-contamination ( Fig. 3). We further analyzed the experiment performed in Fig. 2C to quantify contamination using QCT fingerprints. The sequencing depth for each EMI cluster in a PCR library was distinctly bimodal, with most EMI sequence clusters read at depth >30x. A minority of EMI sequencing reads were also present at depth 1-2x (Fig. S2). EMI sequencing ...
Context 2
... during sample handling, or (iv) index misassignment 29 . A low-depth EMI sequence cluster (typically 1-2x) observed in a PCR was classified as a contaminant if it was also observed at high-depth in a different PCR well. We then computed the contamination fraction for each PCR as the number of contaminated QCT reads over total QCT reads (Fig. 3A). The PCRs with 0x QCT molecules should therefore register 100% contamination. QCT contamination analysis measured >90% contamination in 0x QCT wells, suggesting that this method is highly sensitive for detecting contamination. The remaining ~10% of undetected contamination could be due to sequencing error or contamination that had ...
Context 3
... is highly sensitive for detecting contamination. The remaining ~10% of undetected contamination could be due to sequencing error or contamination that had occurred prior to PCR amplification. Unexpectedly, we found that PCR libraries barcoded with D701 and D707 indexes had high levels of total contamination consistently >5% and as high as 13% (Fig. 3A). A more granular analysis of contamination that traced contamination sources on a per-tube level revealed that for the reaction indexed by D707/D504, nearly all of the contamination originated from the D701/ D504 reaction. Conversely, the D701/D504 well was the main destination of contaminating EMIs that originated from the D707/D504 ...
Context 4
... 3A). A more granular analysis of contamination that traced contamination sources on a per-tube level revealed that for the reaction indexed by D707/D504, nearly all of the contamination originated from the D701/ D504 reaction. Conversely, the D701/D504 well was the main destination of contaminating EMIs that originated from the D707/D504 reaction (Fig. 3B). Similar cross-contamination patterns were observed in the other wells indexed by D701 and D707. These data suggested to us that our D701 and D707 indexes themselves had become cross-contaminated, perhaps during oligo synthesis or index preparation. We also observed that most of the remaining contamination occurred in wells that have a ...
Context 5
... twice in the same sequencing run. When the pairwise collisions are plotted, barcodes 25-32 immediately stand out because they share ~150 EMI clusters in common with corresponding barcodes 33-40. This approach can therefore be used to identify common operator errors that would result in a reduced number of fingerprints in the sequencing data (Fig. ...
Similar publications
Iraq is located in the prevailing region of â-thalassemias. Thalassemia is one of the most wide genetic diseases and the majorityof beta thalassemia is the severe form. The aim of this study is to evaluation hematological characteristics and some biochemical conditions in the blood of thalassemia patients prior to transfusion compared to healthy gr...
Background: The present study aimed to determine the prevalence of thalassemia minor and sickle hemoglobin in marriage applicants referring to the Genetic Diseases Counseling Center of Kazeroun Health Center over 2014-2018.
Methods: This cross-sectional study was conducted in Kazeroun, Iran. The statistical population included all couples referring...
Background: To evaluate the prevalence of alpha- and beta-thalassemia in Ji'an City, Jiangxi Province, 28,941 people in the region were genetically screened to identify various thalassemia genotypes. Methods: High-throughput amplicon sequencing and gap-PCR was used to screen 301 thalassemia alleles in 28,941 people in the region. Pregnant women wer...
Background:
Gliomas consist of a heterogeneous group of tumors. This study aimed to report the incidences of O6-methylguanine-DNA-methyltransferase (MGMT) promoter methylation, 1p19q co-deletion, isocitrate dehydrogenase (IDH) gene mutations, and inactivating mutations of alpha-thalassemia/mental retardation syndrome X-linked (ATRX) in high-grade...
Citations
... The technology is capable of both accurately quantifying genes of interest as well as sequence variants using next generation sequencing (NGS). QCT technology has previously been validated for NIPT of autosomal recessive conditions in cfDNA [22][23][24] . ...
... These antigens are all associated with HDFN and can be detected as early as 10 weeks gestation. This performance is achieved by the combination of QCT technology with genome-wide assessment of polymorphic locations that determine the expected cfDNA fetal molecule count 22 . These quantitative measurements are critical to ensure there is sufficient fetal cfDNA present in the sample and significantly reduce the false negative rate. ...
... To detect the genotype of fetal antigens RhD, C, c, E, K, and Fy a in pregnant individuals, a highly-multiplexed PCR-based NIPT assay with a NGS readout that employs QCT technology was developed 22 . The assay is comprised of five amplicons across the RHD gene that amplifies regions that are unique between the wild-type RHD gene, the RHCE homolog gene (exons 7 and 10) and the RHDΨ pseudogene (exons 4 and 5) (Fig. 1a, Table S1) 16,25 . ...
We developed and validated a next generation sequencing-(NGS) based NIPT assay using quantitative counting template (QCT) technology to detect RhD, C, c, E, K (Kell), and Fya (Duffy) fetal antigen genotypes from maternal blood samples in the ethnically diverse U.S. population. Quantitative counting template (QCT) technology is utilized to enable quantification and detection of paternally derived fetal antigen alleles in cell-free DNA with high sensitivity and specificity. In an analytical validation, fetal antigen status was determined for 1061 preclinical samples with a sensitivity of 100% (95% CI 99–100%) and specificity of 100% (95% CI 99–100%). Independent analysis of two duplicate plasma samples was conducted for 1683 clinical samples, demonstrating precision of 99.9%. Importantly, in clinical practice the no-results rate was 0% for 711 RhD-negative non-alloimmunized pregnant people and 0.1% for 769 alloimmunized pregnancies. In a clinical validation, NIPT results were 100% concordant with corresponding neonatal antigen genotype/serology for 23 RhD-negative pregnant individuals and 93 antigen evaluations in 30 alloimmunized pregnancies. Overall, this NGS-based fetal antigen NIPT assay had high performance that was comparable to invasive diagnostic assays in a validation study of a diverse U.S. population as early as 10 weeks of gestation, without the need for a sample from the biological partner. These results suggest that NGS-based fetal antigen NIPT may identify more fetuses at risk for hemolytic disease than current clinical practice, which relies on paternal genotyping and invasive diagnostics and therefore is limited by adherence rates and incorrect results due to non-paternity. Clinical adoption of NIPT for the detection of fetal antigens for both alloimmunized and RhD-negative non-alloimmunized pregnant individuals may streamline care and reduce unnecessary treatment, monitoring, and patient anxiety.
... The technology is capable of both accurately quantifying genes of interest as well as sequencing variants using Next Generation Sequencing (NGS). QCT technology has previously been validated for NIPT of autosomal recessive conditions in cfDNA [21,22]. ...
... Here we describe the application of QCT technology NIPT for the detection of the fetal genotypes that encode for the RhD, C, c, E, Kell, and Duffy (Fy a ); RBC antigens associated with HDFN [1], and show that this assay demonstrates excellent performance even at fetal fractions as low as 1.1% and as early as 10 weeks of gestation, with a sensitivity and speci city of 99.6%-100% across multiple sets of validation. This performance is achieved by the combination of QCT technology with a genome-wide assessment of polymorphic locations that determine cfDNA fetal molecule count [22]. Moreover, the quantitative sequencing-based design of the fetal antigen NIPT described herein enables the detection of fetal antigen status due to the common genotypes as well as non-deletion RHD gene variants, thus improving clinical utility for the diverse U.S. population and avoiding the necessity of a partner sample. ...
... The combination of the QCT technology-based quantitative approach with NGS described in this work enables the assay to detect both the common RHD gene deletion and other RHD variants, including RHDΨ and Rh-CE-D hybrid genes, that result in an RhD-negative phenotype [22]. In the current study, a fetal RhD phenotype was predicted for all samples with a RHDΨ variant (3.6%) detected, illustrating the clinical utility of this assay in a diverse population. ...
We developed and validated a next generation sequencing (NGS) based NIPT assay using quantitative counting template (QCT) technology to detect RhD, C, c, E, Kell, and Fy a fetal antigen genotypes in the diverse U.S. population. The assay quantifies paternally derived fetal antigen cell-free DNA molecules after calibration to fetal fraction and a reference gene. The assay correctly determined fetal antigen status for 1061 preclinical samples with an analytical sensitivity of 100% (95% CI: 99–100%) and analytical specificity of 100% (95% CI: 99–100%) with only a 3.8% no-call rate, including challenging samples at 1.5% fetal fraction. The assay showed a clear separation between antigen detected and not detected for 15,939 clinical plasma samples in a general population setting, with an estimated clinical sensitivity of 99.6%-100%. The precision of the assay in which two replicate plasma samples were independently analyzed was 99.9% for 1683 clinical samples. Moreover, a fetal antigen determination could be made for samples with RHDΨ , a variant more common among RhD-negative Black individuals. The NIPT results were 100% concordant with neonatal antigen genotype/serology for 23 RhD negative pregnant individuals and 12 other antigen evaluations in 4 alloimmunized pregnant individuals. This NGS-based fetal antigen NIPT assay had excellent performance in a validation study of samples from a diverse U.S. population for fetal fractions as low as 1.1% and as early as 10 weeks of gestation, without the need for a sample from the biological partner. Implementation of NIPT for the detection of fetal antigen in RhD-negative and alloimmunized pregnant individuals will streamline care and reduce unnecessary treatment, monitoring and patient anxiety.
... Research into NIPD for monogenic conditions has been ongoing since 2000, with the first publications describing potential clinical utility for achondroplasia [28] and myotonic dystrophy [29] . NIPD has now been implemented in clinical service in England for several monogenic conditions, including FGFR2-and FGFR3 -related skeletal conditions [30][31][32][33] , DMD-related Duchenne and Becker muscular dystrophies [34,35] , cystic fibrosis [36] , and spinal muscular atrophy [35,37] . It is also available for families with rare monogenic conditions, but this has largely relied on bespoke test development for at-risk pregnancies owing to the rarity of individual cases and extensive mutational heterogeneity, which is both labour-intensive and costly to healthcare systems. ...
... Typically, RHDO is carried out using capture-based target enrichment, followed by NGS and statistical analysis for haplotype phasing and genotyping [4] . The statistical method most widely applied to RHDO analysis is SPRT [4,34,36,37,44,61,77,101,102] , although other Bayesian approaches have also been reported in the literature (e.g., the hidden Markov model) [103,104] . This review will focus primarily on the SPRT approach. ...
... Over the past decade, RHDO has been introduced into routine clinical use for NIPD of maternally inherited pathogenic variants for cystic fibrosis (CFTR) [36] , spinal muscular atrophy (SMN1/SMN2) [37] , and congenital adrenal hyperplasia (CYP21A2) [105] , as well as for X-linked Duchenne and Becker muscular dystrophies (DMD) [34] . RHDO is also under development for several other autosomal recessive conditions [101,106] , and for maternal inheritance of autosomal dominant retinoblastoma (RB1) [102] . ...
Prenatal testing is important for the early detection and diagnosis of rare genetic conditions with life-changing implications for the patient and their family. Gaining access to the fetal genotype can be achieved using gold-standard invasive sampling methods, such as amniocentesis and chorionic villus sampling, but these carry a small risk of miscarriage. Non-invasive prenatal diagnosis (NIPD) for select rare monogenic conditions has been in clinical service in England since 2012 and has revolutionised the field of prenatal diagnostics by reducing the number of women undergoing invasive sampling procedures. Fetal-derived genomic material is present in a highly fragmented form amongst the maternal cell-free DNA (cfDNA) in circulation, with sequence coverage across the entire fetal genome. Cell-free fetal DNA (cffDNA) is the foundation for NIPD, and several technologies have been clinically implemented for the detection of paternally inherited and de novo pathogenic variants. Conversely, a low abundance of cffDNA within a high background of maternal cfDNA makes assigning maternally inherited variants to the fetal fraction a significantly more challenging task. Research is ongoing to expand available tests for maternal inheritance to include a broader range of monogenic conditions, as well as to uncover novel diagnostic avenues. This review covers the scope of technologies currently clinically available for NIPD of monogenic conditions and those still in the research pipeline towards implementation in the future.
... cSMART was developed as a proof-of-concept study for Wilson disease (ATP7B) using Sanger sequencing [88] and, more recently, has employed NGS technologies, showing clinical utility for autosomal recessive non-syndromic hearing loss (GJB2 and SLC26A4) [89,90], β-thalassaemia (HBB) [91,92], methylmalonic acidaemia cblC type (MMACHC) [93], and phenylketonuria (PAH) [94]. Other studies have also described the use of barcode-enabled NGS to facilitate molecular counting with single base pair resolution [95][96][97], nested PCR and NGS [98], as well as size-based enrichment of cffDNA prior to diagnostic analysis [54,97]. ...
... Another commercially available screening test is the UNITY Screen™ (BillionToOne Inc., Menlo Park, CA, U.S.A.) (Figure 2). This test offers a maternal carrier screen for four recessive conditions, including CF, SMA, and haemoglobinopathies, as recommended by ACOG [60], with reflex cfDNA testing for all those identified as carriers [95]. This RMD-based screening test, which uses a Quantitative Counting Template (QCT) molecular counting approach rather than UMIs, can therefore provide a personalised fetal risk assessment without the need for a paternal sample. ...
... This RMD-based screening test, which uses a Quantitative Counting Template (QCT) molecular counting approach rather than UMIs, can therefore provide a personalised fetal risk assessment without the need for a paternal sample. While the minimum FF required for the UNITY Screen™ is not explicitly stated on the company website, reliable results were reported to be obtained at a FF ≥ 5%, according to their recent publication [95]. With respect to CF and the group of inherited haemoglobinopathies, the UNITY Screen™ is not fully exhaustive for all disease-causing recessive variants within the CFTR and HBA/HBB genes, respectively (Figure 2). ...
Cell-free fetal DNA (cffDNA) is released into the maternal circulation from trophoblastic cells during pregnancy, is detectable from 4 weeks and is representative of the entire fetal genome. The presence of this cffDNA in the maternal bloodstream has enabled clinical implementation of non-invasive prenatal diagnosis (NIPD) for monogenic disorders. Detection of paternally inherited and de novo mutations is relatively straightforward, and several methods have been developed for clinical use, including quantitative polymerase chain reaction (qPCR), and PCR followed by restriction enzyme digest (PCR-RED) or next-generation sequencing (NGS). A greater challenge has been in the detection of maternally inherited variants owing to the high background of maternal cell-free DNA (cfDNA). Molecular counting techniques have been developed to measure subtle changes in allele frequency. For instance, relative haplotype dosage analysis (RHDO), which uses single nucleotide polymorphisms (SNPs) for phasing of high- and low-risk alleles, is clinically available for several monogenic disorders. A major drawback is that RHDO requires samples from both parents and an affected or unaffected proband, therefore alternative methods, such as proband-free RHDO and relative mutation dosage (RMD), are being investigated. cffDNA was thought to exist only as short fragments (<500 bp); however, long-read sequencing technologies have recently revealed a range of sizes up to ∼23 kb. cffDNA also carries a specific placental epigenetic mark, and so fragmentomics and epigenetics are of interest for targeted enrichment of cffDNA. Cell-based NIPD approaches are also currently under investigation as a means to obtain a pure source of intact fetal genomic DNA.
... At the time of their publication, no screening tools, other than ultrasound, were available to assess risk for APA-related genetic conditions. Advances in cell-free non-invasive prenatal screening have demonstrated the feasibility of screening for single-gene genetic conditions, some of which are associated with APA (Tsao et al. 2019;Zhang et al. 2019). This type of non-invasive prenatal screening may provide an inroad to screen at-risk pregnancies due to APA, despite not currently being recommended as a standard of care (ACOG Practice Advisory 2020). ...
The objective of this pilot study was to characterize healthcare professionals’ knowledge of advanced paternal age (APA), the associated risks, as well as current clinical practices regarding APA. Our study utilized an online survey that questioned providers who see children with genetic conditions and patients who are or may become pregnant regarding demographic information, APA knowledge, APA guideline familiarity, and their clinical practices. A total of 67 providers responded to the survey. We had responses from 54 physician participants in the specialties of medical genetics (GEN), maternal fetal medicine (MFM), and obstetrics and gynecology (OBGYN). OBGYN, but not MFM, reported significantly lower agreement that current data supports an association between APA and certain genetic diseases compared to GEN. Furthermore, OBGYN were less likely to identify established risks associated with APA and more likely to incorrectly identify unestablished risks compared to GEN and MFM. Regardless of specialty, the majority of physicians were unfamiliar with the most recently published APA guidelines. This study revealed a desire for more information regarding APA risks and management among our participants. Our data suggest that GEN, MFM, and OBGYN would benefit from updated and more visible guidelines regarding APA. Additionally, OBGYN consistently showed knowledge gaps and misconceptions regarding the risks of APA. Targeted educational or guidance materials regarding APA may also be beneficial for OBGYNs.
... For this purpose, several groups have attempted different methods and approaches, including the relative mutation dosage (RMD) and the relative haplotype dosage (RHDO) (14)(15)(16). Next-generation sequencing (NGS) is the method of choice: a powerful, highly sensitive technique that enables the detection of small genetic variations in the genome (17)(18)(19)(20). However, NGS is costly and requires complex bioinformatics analyses, making it less suitable for routine application. ...
... Prenatal diagnosis of monogenic diseases, such as beta-thalassemia, is currently dependent on invasive procedures. Over the last few years, many studies have reported successful development of NIPD methods (15)(16)(17)(18)(19)(20)22,(27)(28)(29); however, most of these studies were based on the determination of only the paternally inherited fetal allele (30)(31)(32)(33)(34)(35), leading to the need for a method that can determine both parental alleles and, thus, be applied to all pregnancies. In the case of beta-thalassemia, several groups accomplished this goal by taking advantage of the improved analytical sensitivity of NGS and ddPCR (15,(17)(18)(19)(20)22). ...
... Over the last few years, many studies have reported successful development of NIPD methods (15)(16)(17)(18)(19)(20)22,(27)(28)(29); however, most of these studies were based on the determination of only the paternally inherited fetal allele (30)(31)(32)(33)(34)(35), leading to the need for a method that can determine both parental alleles and, thus, be applied to all pregnancies. In the case of beta-thalassemia, several groups accomplished this goal by taking advantage of the improved analytical sensitivity of NGS and ddPCR (15,(17)(18)(19)(20)22). Despite these advances, NIPD of monogenic diseases has not yet reached the clinical diagnostics setting, with the exception of some that are available only for screening purposes with the need for invasive follow-up (25). ...
Background:
Thalassemias are inherited blood disorders and by far one of the most common monogenic diseases globally. Beta-thalassemia has a particularly high prevalence in Cyprus, with the IVSI-110 G>A (HBB:c.93-21G>A) pathogenic variation representing almost 79% of the total carriers. The discovery that 3% to 20% of cell-free fetal DNA (cffDNA) is present in the maternal plasma allowed the development of non-invasive prenatal diagnosis (NIPD) of monogenic diseases, like beta-thalassemia, avoiding the risks of invasive procedures. However, the development of NIPD holds major technical challenges and has not yet reached the clinical setting.
Methods:
In this study, we apply droplet digital PCR (ddPCR) coupled with the relative variant dosage approach to develop a NIPD assay for IVSI-110 G>A beta-thalassemia. We have implemented an optimization process for ddPCR to address the challenges of ddPCR assays such as inconclusive rain droplets and thus increase the sensitivity and specificity of the assay. The established protocol was evaluated on 40 maternal plasma samples with a median gestational age of 10 weeks where both parents carried the same pathogenic variation.
Results:
Thirty-three samples were correctly classified, 6 remained inconclusive, and 1 was misclassified. Our assay exhibited 97.06% accuracy (95% CI, 82.46–99.68), 100% sensitivity (95% CI, 76.84–100), and 95% specificity (95% CI, 75.13–99.87), demonstrating its efficiency for the non-invasive detection of both maternal and paternal alleles.
Conclusions:
We have developed an efficient, simple, and cost-effective ddPCR assay for the non-invasive determination of fetal genotype in couples at risk of IVSI-110 G>A beta-thalassemia, bringing NIPD of monogenic diseases closer to the diagnostic setting.
... We previously reported the proof-ofprinciple development of a sequencing-based sgNIPT test for five conditions, including SCD, in 2019. 6 Single-gene NIPT analyzes cellfree DNA (cfDNA) from maternal plasma to provide a personalized fetal residual disease risk ranging from >9 in 10 to <1 in 20,000. The aim of this study was to build upon our previous work to validate the sgNIPT in clinical samples and identify high-risk SCD fetuses in a cohort of at-risk pregnancies. ...
... The cfDNA fraction was then sequenced to determine (1) fetal fraction, (2) molecular counts of cfDNA, (3) maternal variant fraction, and (4) variants that are not present in the maternal genotype (paternally inherited variants). 6 All patients start with an a priori risk calculated from the pregnant patient's carrier status, the highest subpopulation HBB carrier frequency in the United States (one in eight), 7 and the likelihood a fetus inherits two SCD alleles. A likelihood ratio is calculated through relative dosage analysis of the most abundant allele found in cfDNA, comparing the likelihood of inheriting one copy or two copies of the most abundant allele. ...
... A likelihood ratio is calculated through relative dosage analysis of the most abundant allele found in cfDNA, comparing the likelihood of inheriting one copy or two copies of the most abundant allele. 6 The likelihood ratio was used (1) to calculate the genotype score and predict fetal HBB genotype ( Figure 1A) and (2) to adjust the a priori risk and calculate a residual risk that the fetus is affected with SCD ( Figure 1B). In a clinical report, the residual and associated risk categories (low risk, decreased risk, or high risk) would be provided. ...
... Single-gene non-invasive prenatal testing (sgNIPT) has the potential to overcome the challenges with traditional carrier screening workflow. A commercially available carrier screen with reflex sgNIPT was introduced into clinical use in 2019 in the U.S. 8 . This screen provides both maternal carrier status and fetal risk assessment from one maternal blood sample without the need for partner testing. ...
Objective
To evaluate the clinical benefits and achievable cost savings associated with the adoption of a carrier screen with reflex single-gene non-invasive prenatal test (sgNIPT) in prenatal care.
Method
A decision-analytic model was developed to compare carrier screen with reflex sgNIPT (maternal carrier status and fetal risk reported together) as first-line carrier screening to the traditional carrier screening workflow (positive maternal carrier screen followed by paternal screening to evaluate fetal risk). The model compared the clinical outcomes and healthcare costs associated with the two screening methods. These results were used to simulate appropriate pricing for reflex sgNIPT.
Results
Reflex sgNIPT carrier screening-detected 108 of 110 affected pregnancies per 100,000 births (98.5% sensitivity), whereas traditional carrier screening-detected 46 of 110 affected pregnancies (41.5% sensitivity). The cost to identify one affected pregnancy was reduced by 62% in the reflex sgNIPT scenario compared to the traditional scenario. Adding together the testing cost savings and the savings from earlier clinical intervention made possible by reflex sgNIPT, the total cost savings was $37.6 million per 100,000 pregnancies. Based on these cost savings, we simulated appropriate reflex sgNIPT pricing range: if the cost to identify one affected pregnancy is the unit cost, carrier screening with reflex sgNIPT can be priced up to $1,859 per test (or $7,233 if sgNIPT is billed separately); if the cost per 100,000 pregnancies is the unit cost, carrier screening with sgNIPT can be priced up to $1,070 per test (or $2,336 if sgNIPT is billed separately).
Conclusion
Using the carrier screen with reflex sgNIPT as first-line screening improves the detection of affected fetuses by 2.4-fold and can save costs for the healthcare system. A real-life experience will be needed to assess the clinical utility and exact cost savings of carrier screen with reflex sgNIPT.
... We first compared MAESTRO with conventional for tracking 438 SNPs in 18× replicate 1:100,000 dilutions and 17× replicate negative control samples. We used sheared genomic DNA from the same two cell lines described in the previous section 8,23,[29][30][31][32][33] to reflect donor versus recipient DNA and isolated 20 ng for each replicate. MAESTRO uncovered 81% (n = 47/58) and 80% (n = 4/5) of the donor-exclusive SNP duplexes detected with conventional across all 1:100,000 dilution and negative control samples, respectively, using much less sequencing ( Supplementary Fig. 6a). ...
Assaying for large numbers of low-frequency mutations requires sequencing at extremely high depth and accuracy. Increasing sequencing depth aids the detection of low-frequency mutations yet limits the number of loci that can be simultaneously probed. Here we report a method for the accurate tracking of thousands of distinct mutations that requires substantially fewer reads per locus than conventional hybrid-capture duplex sequencing. The method, which we named MAESTRO (for minor-allele-enriched sequencing through recognition oligonucleotides), combines massively parallel mutation enrichment with duplex sequencing to track up to 10,000 low-frequency mutations, with up to 100-fold fewer reads per locus. We show that MAESTRO can be used to test for chimaerism by tracking donor-exclusive single-nucleotide polymorphisms in sheared genomic DNA from human cell lines, to validate whole-exome sequencing and whole-genome sequencing for the detection of mutations in breast-tumour samples from 16 patients, and to monitor the patients for minimal residual disease via the analysis of cell-free DNA from liquid biopsies. MAESTRO improves the breadth, depth, accuracy and efficiency of mutation testing by sequencing. The combination of massively parallel mutation enrichment and duplex sequencing allows for the tracking of up to 10,000 low-frequency mutations with up to 100-fold fewer reads per locus than conventional duplex sequencing.
... counter). With the development of diagnostic methods, an increasing number of novel mutations in the globin genes have been identified (Petropoulou et al., 2015;Tsao et al., 2019). Novel globin mutations are continually identified by advanced methods such as NGS, which exhibits high-quality genotype coverage and costeffectiveness. ...
Background
Thalassemia is one of the most common inherited diseases worldwide. This report presents three novel cases of α-thalassemia and two novel cases of β-thalassemia caused by five different mutations in the globin gene.
Methods
Next-generation sequencing (NGS) was used to identify novel α- and β-thalassemia in five individuals, which was confirmed by Sanger sequencing of the globin gene. Hematological parameters were determined by an automated cell counter, and hemoglobin electrophoresis was carried out by a capillary electrophoresis system, respectively. The isoelectric point (pI), molecular weight, and conservation for the mutations were described by the Internet software programs. The pathogenicity for globin mutations was analyzed by bioinformatics analysis and relative quantitative analysis.
Results
NGS revealed five novel cases of α- and β-thalassemia: HBA2:c.245C>T, HBA2:c.95+11_95+34delCTCCCCTGCTCCGACCCGGGCTCC, HBA2:c.54delC, HBB:c.373C>A, and HBB:c.40G>A. The clinical implications of these mutations were described. Computational predictions were made for pI, amino acid conservation, and pathogenicity of the missense mutation. Relative quantitative data of the α-globin mRNA were analyzed.
Conclusion
Five novel globin mutations were identified in the populations of China, and those mutations were analyzed to provide a mechanistic view for their pathogenicity. These analyzed results improve genetic diagnostics for thalassemia, which can improve screening programs for thalassemia and prenatal diagnosis for Chinese population.
