Figure 3 - available via license: Creative Commons Attribution 4.0 International
Content may be subject to copyright.
Protein expression of active MMP-2 and pro MMP-2 in rat left ventricle after MI. A): Immunoblots for pro MMP-2, active MMP-2, and GAPDH in left ventricle (remote area). B): mean densitometric analysis of pro and active MMP-2. Sham levels were set at 1, and all other values were normalized to Sham. All values are mean 6 SD, n = 6. *p , 0.05 vs. vehicle control; # p , 0.05 vs. sham. doi:10.1371/journal.pone.0051151.g003
Source publication
The aim of the present study was to evaluate the cardiovascular effects of the novel bradykinin B1 receptor antagonist BI-113823 following myocardial infarction (MI) and to determine whether B1 receptor blockade alters the cardiovascular effects of an angiotensin II type 1 (AT1) receptor antagonist after MI in rats.
Sprague Dawley rats were subject...
Contexts in source publication
Context 1
... receptor (Bdkrb2) (Applied Biosystems Gene Expression Assay Rn00597384_m1), rat angiotensin II receptor, type 1a (Agtr1a; AT1) (forward: cacccgatcaccgatcac; reverse: cagccattttataccaatctctca; UPL probe set 53, cat. no. 04688503001, Roche, Basel, Switzerland) and rat angiotensin I converting enzyme (peptidyl-dipeptidase A) 1 (ACE1) (forward: ggttttcatgaggctattgga; reverse: ttagaaagttgatgt- catgctcgt; UPL probe set 21, cat. no. 04686942001, Roche). AT1 and ACE1 primers were designed using ProbeFinder v2.45 for rat (Roche). All data were normalized against RNA polymerase 2 (forward: GCAGGCGAGAGCGTTGAG; reverse: CATTGG- TATAATCAAAACGGAACTTC; probe: CTGGCTACACT- TAAGCCTTCTAATAAAGC, FAM/TAMRA-labeled). Amplifications were performed in triplicate using an ABI Prism 7900HT Sequence Detection System (Applied Biosystems). Western blotting was performed as we described previously [14]. Briefly, left ventricle protein extracts were electrophoresed on NuPAGE 4–12% Bis-Tris gels (Invitrogen, Carlsbad, CA) and transferred onto nitrocellulose membranes (Invitrogen). The blots were then incubated in 5% nonfat dry milk in Tris-buffered saline (TBS) for 2 hours at room temperature, and then incubated with primary antibody for 1 hour at room temperature: collagen III (1:1000) (Sigma), matrix metalloproteinases 2 (MMP-2) (1:1000) and GAPDH (1:3000) (both from Santa Cruz Biotechnology, Santa Cruz, CA). The blots were rinsed with TBS and incubated with horse radish peroxidase-conjugated donkey anti-rabbit or goat anti-mouse IgG secondary antibody for 2 hours. Immuno- reactivity was detected using enhanced chemiluminescence autoradiography (ECL kit; Amersham, Piscataway, NJ). The signals were scanned with a color image scanner and densome- trically quantified with ImageJ software (National Institutes of Health, Bethesda, MD, USA). All results are presented as mean 6 standard deviation (SD). Data were analyzed using two-sided analysis of variance (ANOVA) followed by post hoc intergroup comparisons using Student’s t- tests with Bonferroni corrections. P values , 0.05 were considered statistically significant. Eight sham-operated rats and 32 rats that initially survived acute MI induced by left coronary artery occlusion were weaned off the ventilator, randomly assigned to study groups, and survived the entire experimental protocol. At 7 days after MI, there was no significant difference in infarct size among study groups (table 1). The heart weight to body weight ratio (HW/BW) and lung weight to body weight ratio (LW/BW) are shown in table 1. The HW/ BW ratio was not significantly increased 7 days after MI compared to sham animals. However, the LW/BW ratio was significantly increased 7 days after MI in vehicle-treated control rats compared to sham animals. This increase was significantly attenuated in animals treated with irbesartan or BI-113823 alone or a combination of irbesartan and BI-113823 (P . 0.05). Hemodynamic parameters are shown in table 2. There were no significant changes in mean blood pressure or heart rate in any of the study groups. In vehicle-treated control animals, MI resulted in decreased left ventricle systolic pressure (LVP) and 6 dp/dt max and elevated left ventricle end-diastolic pressure (LVEDP). LVP was not significantly different among treatment groups compared to the vehicle control group. The 6 dp/dt max was improved in animals that received BI-113823 or a combination of irbesartan and BI-113823, but not in animals that received irbesartan alone. Post-MI LVEDP elevation was significantly attenuated in all treatment groups compared to vehicle control (table 2). Echocardiography analysis shows that MI resulted in impaired left ventricular function evidence by reduced ejection fraction and fractional shorting and impaired wall motion in vehicle-treated control animals. All three treatment groups exhibited improve- ments in all three parameters (Fig. 1). MI markedly increased cardiac mRNA expression of B1, B2, and AT1 receptors and ACE1 in the left ventricle, and this upregulation was greater in infarcted regions [B1 receptor (11.1x), B2 receptor (2.3x), AT1 receptor (4.7x), and ACE1 (2.1x)], compared to remote regions [B1 receptor (2.7x), B2 receptor (1.4x), AT1 receptor (1.7x), and ACE1 (1.5x)] (Fig. 2). B1 and AT1 receptor mRNA upregulation were markedly reduced in animals treated with BI 113823, but B2 receptor and ACE1 mRNA expression were not significantly affected by B1 receptor blockade compared to vehicles controls. Treatment with the AT1 receptor antagonist irbesartan increased mRNA expression of B1, B2, and AT1 receptors but did not affect ACE1 expression compared to vehicle- treated controls. These up-regulations were markedly reduced in animals that received both BI-113823 and irbesartan, but the combination treatment did not affect ACE1 expression. MMP-2 cardiac expression was significantly increased following MI, and this increase was more pronounced with active MMP-2 compared to pro MMP-2 (Fig. 3). Cardiac collagen III was also increased following MI (Fig. 4). The up-regulation of MMP-2 and collagen following MI was attenuated by treatment with BI- 113823 or irbesartan alone or given together (Fig. ...
Context 2
... 53, cat. no. 04688503001, Roche, Basel, Switzerland) and rat angiotensin I converting enzyme (peptidyl-dipeptidase A) 1 (ACE1) (forward: ggttttcatgaggctattgga; reverse: ttagaaagttgatgt- catgctcgt; UPL probe set 21, cat. no. 04686942001, Roche). AT1 and ACE1 primers were designed using ProbeFinder v2.45 for rat (Roche). All data were normalized against RNA polymerase 2 (forward: GCAGGCGAGAGCGTTGAG; reverse: CATTGG- TATAATCAAAACGGAACTTC; probe: CTGGCTACACT- TAAGCCTTCTAATAAAGC, FAM/TAMRA-labeled). Amplifications were performed in triplicate using an ABI Prism 7900HT Sequence Detection System (Applied Biosystems). Western blotting was performed as we described previously [14]. Briefly, left ventricle protein extracts were electrophoresed on NuPAGE 4–12% Bis-Tris gels (Invitrogen, Carlsbad, CA) and transferred onto nitrocellulose membranes (Invitrogen). The blots were then incubated in 5% nonfat dry milk in Tris-buffered saline (TBS) for 2 hours at room temperature, and then incubated with primary antibody for 1 hour at room temperature: collagen III (1:1000) (Sigma), matrix metalloproteinases 2 (MMP-2) (1:1000) and GAPDH (1:3000) (both from Santa Cruz Biotechnology, Santa Cruz, CA). The blots were rinsed with TBS and incubated with horse radish peroxidase-conjugated donkey anti-rabbit or goat anti-mouse IgG secondary antibody for 2 hours. Immuno- reactivity was detected using enhanced chemiluminescence autoradiography (ECL kit; Amersham, Piscataway, NJ). The signals were scanned with a color image scanner and densome- trically quantified with ImageJ software (National Institutes of Health, Bethesda, MD, USA). All results are presented as mean 6 standard deviation (SD). Data were analyzed using two-sided analysis of variance (ANOVA) followed by post hoc intergroup comparisons using Student’s t- tests with Bonferroni corrections. P values , 0.05 were considered statistically significant. Eight sham-operated rats and 32 rats that initially survived acute MI induced by left coronary artery occlusion were weaned off the ventilator, randomly assigned to study groups, and survived the entire experimental protocol. At 7 days after MI, there was no significant difference in infarct size among study groups (table 1). The heart weight to body weight ratio (HW/BW) and lung weight to body weight ratio (LW/BW) are shown in table 1. The HW/ BW ratio was not significantly increased 7 days after MI compared to sham animals. However, the LW/BW ratio was significantly increased 7 days after MI in vehicle-treated control rats compared to sham animals. This increase was significantly attenuated in animals treated with irbesartan or BI-113823 alone or a combination of irbesartan and BI-113823 (P . 0.05). Hemodynamic parameters are shown in table 2. There were no significant changes in mean blood pressure or heart rate in any of the study groups. In vehicle-treated control animals, MI resulted in decreased left ventricle systolic pressure (LVP) and 6 dp/dt max and elevated left ventricle end-diastolic pressure (LVEDP). LVP was not significantly different among treatment groups compared to the vehicle control group. The 6 dp/dt max was improved in animals that received BI-113823 or a combination of irbesartan and BI-113823, but not in animals that received irbesartan alone. Post-MI LVEDP elevation was significantly attenuated in all treatment groups compared to vehicle control (table 2). Echocardiography analysis shows that MI resulted in impaired left ventricular function evidence by reduced ejection fraction and fractional shorting and impaired wall motion in vehicle-treated control animals. All three treatment groups exhibited improve- ments in all three parameters (Fig. 1). MI markedly increased cardiac mRNA expression of B1, B2, and AT1 receptors and ACE1 in the left ventricle, and this upregulation was greater in infarcted regions [B1 receptor (11.1x), B2 receptor (2.3x), AT1 receptor (4.7x), and ACE1 (2.1x)], compared to remote regions [B1 receptor (2.7x), B2 receptor (1.4x), AT1 receptor (1.7x), and ACE1 (1.5x)] (Fig. 2). B1 and AT1 receptor mRNA upregulation were markedly reduced in animals treated with BI 113823, but B2 receptor and ACE1 mRNA expression were not significantly affected by B1 receptor blockade compared to vehicles controls. Treatment with the AT1 receptor antagonist irbesartan increased mRNA expression of B1, B2, and AT1 receptors but did not affect ACE1 expression compared to vehicle- treated controls. These up-regulations were markedly reduced in animals that received both BI-113823 and irbesartan, but the combination treatment did not affect ACE1 expression. MMP-2 cardiac expression was significantly increased following MI, and this increase was more pronounced with active MMP-2 compared to pro MMP-2 (Fig. 3). Cardiac collagen III was also increased following MI (Fig. 4). The up-regulation of MMP-2 and collagen following MI was attenuated by treatment with BI- 113823 or irbesartan alone or given together (Fig. ...
Citations
... Western blot experiments were performed to determine protein expression of extracellular signal regulated protein kinase (ERK1/2), phospho-ERK1/2, AKT and phospho-AKT in lung tissues as previously described [21]. Briefly, the lung protein extracts were separated by using SDS-PAGE and transferred to nitrocellulose membranes. ...
Background
This study examined whether BI113823, a novel selective kinin B1 receptor antagonist can reverse established pulmonary arterial hypertension (PAH), prevent right heart failure and death, which is critical for clinical translation.
Methods
Left pneumonectomized male Wistar rats were injected with monocrotaline to induce PAH. Three weeks later, when PAH was well established, the rats received daily treatment of BI113823 or vehicle for 3 weeks.
Results
Treatment with BI113823 from day 21 to day 42 after monocrotaline injection reversed established PAH as shown by normalized values of mean pulmonary arterial pressure (mPAP). BI113823 therapy reversed pulmonary vascular remodeling, pulmonary arterial neointimal formation, and heart and lung fibrosis, reduced right ventricular pressure, right heart hypertrophy, improved cardiac output, and prevented right heart failure and death. Treatment with BI113823 reduced TNF-α and IL-1β, and macrophages recruitment in bronchoalveolar lavage, reduced CD-68 positive macrophages and expression of proliferating cell nuclear antigen (PCNA) in the perivascular areas, and reduced expression of iNOS, B1 receptors, matrix metalloproteinase (MMP)-2 and MMP-9 proteins, and the phosphorylation of ERK1/2 and AKT in lung. Treatment with BI113823 reduced mRNA expression of ANP, BNP, βMHC, CGTF, collange-I and IV in right heart, compared to vehicle treated controls. In human monocytes cultures, BI113823 reduced LPS-induced TNF-α production, MMP-2 and MMP-9 expression, and reduced TNF-α-induced monocyte migration.
Conclusions
We conclude that BI113823 reverses preexisting severe experimental pulmonary hypertension via inhibition of macrophage infiltration, cytokine production, as well as down regulation of matrix metalloproteinase proteins.
... B1R and B2R have different functions (Wu, Lin, Bernloehr, Hildebrandt, & Doods, 2012). B1R stimulation induced by cytosolic calcium ion contributes to the inflammatory responses (Gurusamy et al., 2016). ...
The severe acute respiratory syndrome coronavirus‐2 (SARS‐COV‐2), a novel coronavirus responsible for the recent infectious pandemic, is known to downregulate angiotensin‐converting enzyme‐2 (ACE2). Most current investigations focused on SARS‐COV‐2‐related effects on the renin–angiotensin system and especially the resultant increase in angiotensin II, neglecting its effects on the kinin–kallikrein system. SARS‐COV‐2‐induced ACE2 inhibition leads to the augmentation of bradykinin 1‐receptor effects, as ACE2 inactivates des‐Arg9‐bradykinin, a bradykinin metabolite. SARS‐COV‐2 also decreases bradykinin 2‐receptor effects as it affects bradykinin synthesis by inhibiting cathepsin L, a kininogenase present at the site of infection and involved in bradykinin production. The physiologies of both the renin–angiotensin and kinin–kallikrein system are functionally related suggesting that any intervention aiming to treat SARS‐COV‐2‐infected patients by triggering one system but ignoring the other may not be adequately effective. Interestingly, the snake‐derived bradykinin‐potentiating peptide (BPP‐10c) acts on both systems. BPP‐10c strongly decreases angiotensin II by inhibiting ACE, increasing bradykinin‐related effects on the bradykinin 2‐receptor and increasing nitric oxide‐mediated effects. Based on a narrative review of the literature, we suggest that BPP‐10c could be an optimally effective option to consider when aiming at developing an anti‐SARS‐COV‐2 drug.
... The involvement of bradykininergic system in the modulation of MEDL-exerted antinociceptive activity was analysed using the bradykinin-induced paw licking test. Bradykinins, a small proinflammatory peptide released during tissue damage and inflammation, is involved in the initiation of pain in the periphery and in the development of hypersensitivity in inflamed or injured tissues [35]. In normal tissue bradykinin causes an acute sensation of pain by an action at B 2 receptors but in inflamed tissue the pharmacology of the response changes to that of B 1 receptors [35,36]. ...
... Bradykinins, a small proinflammatory peptide released during tissue damage and inflammation, is involved in the initiation of pain in the periphery and in the development of hypersensitivity in inflamed or injured tissues [35]. In normal tissue bradykinin causes an acute sensation of pain by an action at B 2 receptors but in inflamed tissue the pharmacology of the response changes to that of B 1 receptors [35,36]. Other than sensitizing nociceptors, bradykinin was also cited to enhance glutamatergic synaptic transmission between spinal cord neurons and to sensitize TRPV1 in dissociated DRG neuronal cultures partly via the activation of PKC produced downstream to B 2 receptor activation [37]. ...
Dicranopteris linearis leaf has been reported to exert antinociceptive activity. The present study elucidates the possible mechanisms of antinociception modulated by the methanol extract of D. linearis leaves (MEDL) using various mouse models. The extract (25, 150, and 300 mg/kg) was administered orally to mice for 30 min priot to subjection to the acetic acid-induced writhing-, hot plate- or formalin-test to establish the antinociceptive profile of MEDL. The most effective dose was then used in the elucidation of possible mechanisms of action stage. The extract was also subjected to the phytochemical analyses. The results confirmed that MEDL exerted significant (p < 0.05) antinociceptive activity in those pain models as well as the capsaicin-, glutamate-, bradykinin- and phorbol 12-myristate 13-acetate (PMA)-induced paw licking model. Pretreatment with naloxone (a non-selective opioid antagonist) significantly (p < 0.05) reversed MEDL effect on thermal nociception. Only l-arginine (a nitric oxide (NO) donor) but not N(ω)-nitro-l-arginine methyl ester (l-NAME; a NO inhibitor) or 1H-[1,2,4]oxadiazolo[4,3-a]quinoxalin-1-one (ODQ; a specific soluble guanylyl cyclase inhibitor) significantly (p < 0.05) modified MEDL effect on the writhing test. Several polyphenolics and volatile antinociceptive compounds were detected in MEDL. In conclusion, MEDL exerted the opioid/NO-mediated antinociceptive activity, thus, justify D. linearis as a potential source for new analgesic agents development.
... The kallikrein-kininogen system modulates various physiological processes and exerts protective and/or inductive actions in pathological conditions. These actions occur through endogenous kinins, such as bradykinin (BK), kallidin and Met-Lys-bradykinin, which are generated by the action of plasma and tissue-type kallikreins on hepatic kininogens ( Wu et al. 2002, Calixto et al. 2004, Marceau and Regoli 2004). The synthesis, degradation and action of the kinins evoke well-documented effects, chambers and two chambers), the following variables were obtained in M mode: LV diastolic (LVDd) and end-systolic (LVESd) diameters. ...
Evaluate whether endothelial overexpressing of the bradykinin B1 receptor could be associated with altered left ventricular and myocardial performance. Echocardiography and hemodynamic were employed to assess left ventricular morphology and function in Sprague-Dawley transgenic rats overexpressing the endothelial bradykinin B1 receptor (Tie2B1 rats). The myocardial inotropism was evaluated on papillary muscles contradicting in vitro. In Tie2B1 animals, an enlarged left ventricular cavity and lower fractional shortening coupled with a lower rate of pressure change values indicated depressed left ventricular performance. Papillary muscle mechanics revealed that both Tie2B1 and wild-type rat groups had the same contractile capacities under basal conditions; however, in transgenic animals, there was accentuated inotropism due to post-pause potentiation. Following treatment with the Arg(9)-BK agonist, Tie2B1 papillary muscles displayed a reduction in myocardial inotropism. Endothelial B1 receptor overexpression has expanded the LV cavity and worsened its function. There was an exacerbated response of papillary muscle in vitro to a prolonged resting pause, and the use of a B1 receptor agonist impairs myocardial inotropism.
... B1 receptor deletion in mice attenuates cardiac inflammation and fibrosis during the development of experimental diabetic cardiomyopathy (Westermann et al., 2009) and following doxorubicin-induced cardiomyopathy (Westermann et al., 2008). We recently reported that BI113823, an orally active small molecule kinin B1 receptor antagonist, exhibits a favorable cardiovascular profile (Wu et al., 2012;Murugesan et al., 2015). In a model of acute myocardial infarction (7 days) in rats, we showed that B1 receptor Toxicology and Applied Pharmacology 305 (2016) ...
... e l s e v i e r . c o m / l o c a t e / y t a a p inhibition with BI113823 improved cardiac function and did not influence the cardiovascular effects of AT1 receptor antagonist following MI (Wu et al., 2012). The present study was designed to further test the hypothesis that treatment with the B1 receptor antagonist BI113823 may attenuate cardiac remodeling and dysfunction following prolonged myocardial infarction. ...
... Myocardial coronary artery ligation was performed in male Sprague Dawley rats (275-325 g) as previously described (Wu et al., 2012). Beginning 24 h after induction of myocardial ischemia (MI), animals received daily treatments of vehicle (0.1% natrosol), B1 receptor antagonist (BI113823, 30 mg/kg, b.i.d., p.o.), an ACE inhibitor (lisinopril, 10 mg/kg, b.i.d., p.o.), or both BI113823 and lisinopril. ...
Introduction:
The aim of the present study was to evaluate the effects of the novel kinin B1 receptor antagonist BI113823 on postinfarction cardiac remodeling and heart failure, and to determine whether B1 receptor blockade alters the cardiovascular effects of an angiotensin 1 converting enzyme (ACE) inhibitor in rats.
Methods and results:
Sprague Dawley rats were subjected to permanent occlusion of the left coronary artery. Cardiovascular function was determined at 6weeks postinfarction. Treatment with either B1 receptor antagonist (BI113823) or an ACE inhibitor (lisinopril) alone or in combination significantly reduced the heart weight-to-body weight and lung weight-to-body weight ratios, and improved postinfarction cardiac function as evidenced by greater cardiac output, the maximum rate of left ventricular pressure rise (±dP/dtmax), left ventricle ejection fraction, fractional shorting, better wall motion, and attenuation of elevated left ventricular end diastolic pressure (LVEDP). Furthermore, all three treatment groups exhibited significant reduction in cardiac interstitial fibrosis, collagen deposition, CD68 positive macrophages, neutrophils, and proinflammatory cytokine production (TNF-α and IL-1β), compared to vehicle controls.
Conclusion:
The present study shows that treatment with the novel kinin B1 receptor antagonist, BI113823, reduces postinfarction cardiac remodeling and heart failure, and does not influence the cardiovascular effects of the ACE inhibitor.
... BI113823 is a small molecule orally active non-peptide B1 receptor antagonist. It exhibits high affinity (Ki) for both the human and rat B1 receptor (5.3 and 13.3 nM, respectively), whereas it has no affinity for the B2 receptor (IC50 > 10,000 nM) [19,20]. As such, BI113823 reduces inflammatory injury in rat and mouse models of sepsis, while exhibiting a favorable cardiovascular profile [19,21]. ...
... It exhibits high affinity (Ki) for both the human and rat B1 receptor (5.3 and 13.3 nM, respectively), whereas it has no affinity for the B2 receptor (IC50 > 10,000 nM) [19,20]. As such, BI113823 reduces inflammatory injury in rat and mouse models of sepsis, while exhibiting a favorable cardiovascular profile [19,21]. ...
... Differential cell counts were determined on the basis of morphologic criteria by staining BAL cell smear with Hemacolor for Microscopy Staining Kit (IVD, Merck, Germany). The dose of the BI11382 used in this study was selected on the basis of preclinical pharmacokinetic and pharmacodynamics studies [19,20]. The dose of the dexamethasone was selected based on its previous use in clinic and laboratory studies showing it to have effective anti-allergic actions [27,28]. ...
Kinin B1 receptors are implicated in asthmatic airway inflammation. Here we tested this hypothesis by examining the anti-inflammatory effects of BI113823, a novel non-peptide orally active kinin B1 receptor antagonist in mice sensitized to ovalbumin (OVA). Male Balb-c mice were randomly assigned to four study groups: 1) Control, 2) OVA+vehicle, 3) OVA+BI113823, 4) OVA+dexamethasone. Mice were sensitized intraperitoneally with 75μg ovalbumin on days 1 and 8. On days 15 to 17, mice were challenged intranasally with 50μg of ovalbumin. Mice received vehicle, BI113823, or dexamethasone (positive control) on days 16 to 18. On day 19, bronchoalveolar lavage (BAL) and lung tissue were collected for biochemical and immuno-histological analysis. Compared to controls treatment with BI113823 significantly reduced the numbers of BAL eosinophils, macrophages, neutrophils and lymphocytes by 58.3%, 61.1%, 66.4% and 56.0%, respectively. Mice treated with dexamethasone showed similar reductions in BAL cells. Treatment with BI113823 and dexamethasone also significantly reduced total protein content, IgE, TNF-α and IL-1β in lavage fluid, reduced myeloperoxidase activity, mucus secretion in lung tissues, and reduced the expression of B1 receptors, matrix metalloproteinase (MMP)-2 and cyclooxygenase (COX)-2 compared to vehicle-treated mice. Only BI113823 reduced MMP-9 and inducible nitric oxide synthase (iNOS). BI113823 effectively reduced OVA-induced inflammatory cell, mediator and signaling pathways equal to or greater than that seen with steroids in a mouse asthma model. BI113823 might be useful in modulating inflammation in asthma.
... Small-molecule, nonpeptide, orally active antagonists of B1 receptors are desired for clinical drug development for a variety of inflammatory diseases. BI113823, a small-molecule, orally active, nonpeptide B1 receptor antagonist, is a potent antiinflammatory agent with a favorable cardiovascular profile [16,17]. The present study examined the therapeutic potential of BI113823 in a rat model of polymicrobial sepsis induced by cecal ligation and puncture (CLP). ...
Background:
This study examined the therapeutic effects of an orally active non-peptide kinin B1 receptor antagonist, BI113823, in a clinically relevant experimental model of polymicrobial sepsis in rats.
Methods:
Sepsis was induced by cecal ligation and puncture (CLP). Animals received treatment with either vehicle or BI113823. The experiment was terminated 15 hours after CLP in SET 1 animals. Seven-day survival following CLP was determined in SET 2 animals.
Results:
Compared to vehicle treatment, administration of BI113823 reduced neutrophil and macrophage infiltration, reduced cytokine production, attenuated intestinal mucosal hyperpermeability, prevented hemodynamic derangement, and improved cardiac output. Furthermore, administration of BI113823 reduced lung iNOS expression and lung injury score and attenuated NF-ĸB activation and apoptosis in the liver. Treatment with BI113823 also reduced plasma levels of cardiac troponin, aspartate aminotransferase, alanine aminotransferase, urea, and lactate, as well as proteinuria. Finally, administration of BI113823 improved the 7-day survival rate following CLP in rats.
Conclusions:
Administration of BI113823 reduced systemic and tissue inflammatory responses, prevented hemodynamic derangement, attenuated multi-organ injury, and improved overall survival.
... However, studies indicate a distinct role of these receptors in cardiac remodeling. Treatment with kinin B 1 receptor antagonist improved cardiac function after myocardial infarction, as evidenced by attenuation of elevated LV end diastolic pressure [28]. On the other hand, it was shown that tissue kallikrein, through the kinin B 2 receptor and NO formation, improves cardiac function, apoptosis, and inflammation , and limits LV remodeling after ischemic injury [29,30]. ...
... Previous work shows that bradykinin induces contractions mediated by B2 receptors in endotoxin-treated pig coronary arteries, suggesting differential roles of bradykinin in health and disease [15]. In a rat model of myocardial infarction and heart failure, the B1 receptor antagonist BI-113823 improved post-infarction cardiac function, suggesting a favorable cardiovascular profile [16]. These findings imply a role for the induction of kinin B1 receptors in acute coronary inflammation. ...
... In some arteries, the endothelium was removed by gently rubbing the intimal surface with a glass rod moistened with control solution. The preparations were placed, under sterile tissue culture conditions, into 24-well plates [with each well containing one arterial ring in 1 mL Dulbecco's modified Eagle medium supplemented with penicillin (100 unit/mL), streptomycin (100 g/mL) and 10% fetal bovine serum] and incubated with or without lipopolysaccharide (LPS, 20 g/mL) for 6 h at 37 • C in a humidified atmosphere [5% CO 2 in air] [16]. ...
... Therefore, it is logical to presume that the local kinin production during inflammation can have pathological significance in the vasculature, particular in coronary arteries without endothelial cells. Small molecule orally active non-peptide B1 receptor antagonists are currently under development as novel anti-inflammatory agents [16]. Such B1 receptor antagonists may have a favorable cardiovascular profile under inflammatory conditions. ...
... Treatment with kinin B 1 receptor antagonist improved cardiac function after myocardial infarction, as evidenced by attenuation of elevated LV end diastolic pressure [28]. On the other hand, it was shown that tissue kallikrein, through the kinin B 2 receptor and NO formation, improves cardiac function, apoptosis, and inflammation, and limits LV remodeling after ischemic injury [29,30]. ...
Sympathetic hyperactivity induces adverse effects in myocardial. Recent studies have shown that exercise training induces cardioprotection against sympathetic overload; however, relevant mechanisms of this issue remain unclear. We analyzed whether exercise can prevent pathological hypertrophy induced by sympathetic hyperactivity with modulation of the kallikrein-kinin and angiogenesis pathways. Male Wistar rats were assigned to non-trained group that received vehicle; non-trained isoproterenol treated group (Iso, 0.3 mg kg-1 day-1); and trained group (Iso+Exe) which was subjected to sympathetic hyperactivity with isoproterenol. The Iso rats showed hypertrophy and myocardial dysfunction with reduced force development and relaxation of muscle. The isoproterenol induced severe fibrosis, apoptosis and reduced myocardial capillary. Interestingly, exercise blunted hypertrophy, myocardial dysfunction, fibrosis, apoptosis and capillary decreases. The sympathetic hyperactivity was associated with high abundance of ANF mRNA and β-MHC mRNA, which was significantly attenuated by exercise. The tissue kallikrein was augmented in the Iso+Exe group, and kinin B1 receptor mRNA was increased in the Iso group. Moreover, exercise induced an increase of kinin B2 receptor mRNA in myocardial. The myocardial content of eNOS, VEGF, VEGF receptor 2, pAkt and Bcl-2 were increased in the Iso+Exe group. Likewise, increased expression of pro-apoptotic Bad in the Iso rats was prevented by prior exercise. Our results represent the first demonstration that exercise can modulate kallikrein-kinin and angiogenesis pathways in the myocardial on sympathetic hyperactivity. These findings suggest that kallikrein-kinin and angiogenesis may have a key role in protecting the heart.
