Figure 3 - available from: Scientific Reports
This content is subject to copyright. Terms and conditions apply.
Production of multigenic immunodeficient rabbits by multiplex gene targeting. (A) Summary of embryo transfer results. (B) Summary of multigenic immunodeficient founder rabbits. S: single allele indel(s). B: bialleic indels. (C) NuSRG rabbit (left) and its age-matched WT peers. WT: wild type. (D) Flow cytometry analysis revealed defective T-and B-cell populations in the NuSRG rabbit.
Source publication
Immunodeficient mice have been used predominantly in biomedical research. Realizing that large animal species may have an enhanced ability to predict clinical outcome relative to mice, we worked to develop immunodeficient rabbits by CRISPR/Cas9. We first demonstrated that multiplex embryo transfer efficiently produced multiple lines of single-gene...
Contexts in source publication
Context 1
... of double-gene mutant rabbits of genes on the same chromosome. Next, we worked to exploit the multiplex capacity of Cas9 gene targeting. RAG1 (location: 175,821,314 to 175,834,519) and RAG2 (complement, location: 175,840,664 to 175,842,247) genes are adjacent to each other on rabbit Chromosome One, only 6.1 kb apart. We microinjected sgRNAs targeting both RAG1 and RAG2 along with Cas9 mRNA to pronuclear stage embryos. Fifteen embryos were transferred to one recipient animal, resulting in 3 kits ( Fig. 2A). Genotyping of ear skin biopsies revealed that all 3 kits (100%) carried indels in both RAG1 and RAG2 genes ( Fig. 2A). In one animal (#196), homozygous bialleic mutations were found for both genes (Fig. 2B); this animal was later confirmed to be deficient of CD4+/CD8+ T and IgM+ B lymphocytes in peripheral blood analyzed by Flow cytometry (Fig. 2C), consistent with reports of RAG1/2 deficient human patients and RAG1/2 deficient mice 16 . This work convincingly demonstrates that two genes as close as 6.1 kb apart on the same chromosome can be effectively targeted via CRISPR/Cas9. Production of multigenic immunodeficient rabbits. We next sought to test if more than two genes can be targeted simultaneously. We pooled sgRNAs targeting all five genes (i.e. FOXN1, PRKDC, IL2RG, RAG1 and RAG2) for microinjection. We transferred 45 such embryos to 2 recipients. Five kits (#179, 180, 181, 182, and 183) were born (Fig. 3A). Genotyping using ear skin biopsies revealed that one animal Kit #182 is a single-gene mutant with indels in IL2RG, whereas the remaining 4 kits all carried indels in two or more genes (Fig. 3B). Kit #180 was DGM for RAG2 and IL2RG, whereas Kit#183 was DGM for RAG1 and PRKDC. Kit#179 was triple-gene mutant (TGM) for FOXN1, PRKDC, and IL2RG. Lastly, kit#181 was quadruple-gene mutant (QGM) with indels in FOXN1 (Nude), PRKDC (SCID), RAG1 (R), and IL2RG (G), thus named NuSRG (Fig. 3C). NuSRG rabbit was partially hairless reflecting FOXN1 KO. Furthermore, it was deficient of T cells and B cells as measured using flow cytometry (Fig. 3D). Similarly, all other 3 multigenic immunodeficient founders (#179, 180, and 183) were also T and B cell deficient as determined by flow cytometry (data not shown). These data show that multigenic immu- nodeficient rabbits can be efficiently produced via multiplex targeting. We want to point out that due to the lack of robust antibodies for rabbit NK cell markers (e.g. CD16), we were not able to evaluate if NK cells are defective in the NuSRG rabbit as well as other immunodeficient ...
Context 2
... of double-gene mutant rabbits of genes on the same chromosome. Next, we worked to exploit the multiplex capacity of Cas9 gene targeting. RAG1 (location: 175,821,314 to 175,834,519) and RAG2 (complement, location: 175,840,664 to 175,842,247) genes are adjacent to each other on rabbit Chromosome One, only 6.1 kb apart. We microinjected sgRNAs targeting both RAG1 and RAG2 along with Cas9 mRNA to pronuclear stage embryos. Fifteen embryos were transferred to one recipient animal, resulting in 3 kits ( Fig. 2A). Genotyping of ear skin biopsies revealed that all 3 kits (100%) carried indels in both RAG1 and RAG2 genes ( Fig. 2A). In one animal (#196), homozygous bialleic mutations were found for both genes (Fig. 2B); this animal was later confirmed to be deficient of CD4+/CD8+ T and IgM+ B lymphocytes in peripheral blood analyzed by Flow cytometry (Fig. 2C), consistent with reports of RAG1/2 deficient human patients and RAG1/2 deficient mice 16 . This work convincingly demonstrates that two genes as close as 6.1 kb apart on the same chromosome can be effectively targeted via CRISPR/Cas9. Production of multigenic immunodeficient rabbits. We next sought to test if more than two genes can be targeted simultaneously. We pooled sgRNAs targeting all five genes (i.e. FOXN1, PRKDC, IL2RG, RAG1 and RAG2) for microinjection. We transferred 45 such embryos to 2 recipients. Five kits (#179, 180, 181, 182, and 183) were born (Fig. 3A). Genotyping using ear skin biopsies revealed that one animal Kit #182 is a single-gene mutant with indels in IL2RG, whereas the remaining 4 kits all carried indels in two or more genes (Fig. 3B). Kit #180 was DGM for RAG2 and IL2RG, whereas Kit#183 was DGM for RAG1 and PRKDC. Kit#179 was triple-gene mutant (TGM) for FOXN1, PRKDC, and IL2RG. Lastly, kit#181 was quadruple-gene mutant (QGM) with indels in FOXN1 (Nude), PRKDC (SCID), RAG1 (R), and IL2RG (G), thus named NuSRG (Fig. 3C). NuSRG rabbit was partially hairless reflecting FOXN1 KO. Furthermore, it was deficient of T cells and B cells as measured using flow cytometry (Fig. 3D). Similarly, all other 3 multigenic immunodeficient founders (#179, 180, and 183) were also T and B cell deficient as determined by flow cytometry (data not shown). These data show that multigenic immu- nodeficient rabbits can be efficiently produced via multiplex targeting. We want to point out that due to the lack of robust antibodies for rabbit NK cell markers (e.g. CD16), we were not able to evaluate if NK cells are defective in the NuSRG rabbit as well as other immunodeficient ...
Context 3
... of double-gene mutant rabbits of genes on the same chromosome. Next, we worked to exploit the multiplex capacity of Cas9 gene targeting. RAG1 (location: 175,821,314 to 175,834,519) and RAG2 (complement, location: 175,840,664 to 175,842,247) genes are adjacent to each other on rabbit Chromosome One, only 6.1 kb apart. We microinjected sgRNAs targeting both RAG1 and RAG2 along with Cas9 mRNA to pronuclear stage embryos. Fifteen embryos were transferred to one recipient animal, resulting in 3 kits ( Fig. 2A). Genotyping of ear skin biopsies revealed that all 3 kits (100%) carried indels in both RAG1 and RAG2 genes ( Fig. 2A). In one animal (#196), homozygous bialleic mutations were found for both genes (Fig. 2B); this animal was later confirmed to be deficient of CD4+/CD8+ T and IgM+ B lymphocytes in peripheral blood analyzed by Flow cytometry (Fig. 2C), consistent with reports of RAG1/2 deficient human patients and RAG1/2 deficient mice 16 . This work convincingly demonstrates that two genes as close as 6.1 kb apart on the same chromosome can be effectively targeted via CRISPR/Cas9. Production of multigenic immunodeficient rabbits. We next sought to test if more than two genes can be targeted simultaneously. We pooled sgRNAs targeting all five genes (i.e. FOXN1, PRKDC, IL2RG, RAG1 and RAG2) for microinjection. We transferred 45 such embryos to 2 recipients. Five kits (#179, 180, 181, 182, and 183) were born (Fig. 3A). Genotyping using ear skin biopsies revealed that one animal Kit #182 is a single-gene mutant with indels in IL2RG, whereas the remaining 4 kits all carried indels in two or more genes (Fig. 3B). Kit #180 was DGM for RAG2 and IL2RG, whereas Kit#183 was DGM for RAG1 and PRKDC. Kit#179 was triple-gene mutant (TGM) for FOXN1, PRKDC, and IL2RG. Lastly, kit#181 was quadruple-gene mutant (QGM) with indels in FOXN1 (Nude), PRKDC (SCID), RAG1 (R), and IL2RG (G), thus named NuSRG (Fig. 3C). NuSRG rabbit was partially hairless reflecting FOXN1 KO. Furthermore, it was deficient of T cells and B cells as measured using flow cytometry (Fig. 3D). Similarly, all other 3 multigenic immunodeficient founders (#179, 180, and 183) were also T and B cell deficient as determined by flow cytometry (data not shown). These data show that multigenic immu- nodeficient rabbits can be efficiently produced via multiplex targeting. We want to point out that due to the lack of robust antibodies for rabbit NK cell markers (e.g. CD16), we were not able to evaluate if NK cells are defective in the NuSRG rabbit as well as other immunodeficient ...
Context 4
... of double-gene mutant rabbits of genes on the same chromosome. Next, we worked to exploit the multiplex capacity of Cas9 gene targeting. RAG1 (location: 175,821,314 to 175,834,519) and RAG2 (complement, location: 175,840,664 to 175,842,247) genes are adjacent to each other on rabbit Chromosome One, only 6.1 kb apart. We microinjected sgRNAs targeting both RAG1 and RAG2 along with Cas9 mRNA to pronuclear stage embryos. Fifteen embryos were transferred to one recipient animal, resulting in 3 kits ( Fig. 2A). Genotyping of ear skin biopsies revealed that all 3 kits (100%) carried indels in both RAG1 and RAG2 genes ( Fig. 2A). In one animal (#196), homozygous bialleic mutations were found for both genes (Fig. 2B); this animal was later confirmed to be deficient of CD4+/CD8+ T and IgM+ B lymphocytes in peripheral blood analyzed by Flow cytometry (Fig. 2C), consistent with reports of RAG1/2 deficient human patients and RAG1/2 deficient mice 16 . This work convincingly demonstrates that two genes as close as 6.1 kb apart on the same chromosome can be effectively targeted via CRISPR/Cas9. Production of multigenic immunodeficient rabbits. We next sought to test if more than two genes can be targeted simultaneously. We pooled sgRNAs targeting all five genes (i.e. FOXN1, PRKDC, IL2RG, RAG1 and RAG2) for microinjection. We transferred 45 such embryos to 2 recipients. Five kits (#179, 180, 181, 182, and 183) were born (Fig. 3A). Genotyping using ear skin biopsies revealed that one animal Kit #182 is a single-gene mutant with indels in IL2RG, whereas the remaining 4 kits all carried indels in two or more genes (Fig. 3B). Kit #180 was DGM for RAG2 and IL2RG, whereas Kit#183 was DGM for RAG1 and PRKDC. Kit#179 was triple-gene mutant (TGM) for FOXN1, PRKDC, and IL2RG. Lastly, kit#181 was quadruple-gene mutant (QGM) with indels in FOXN1 (Nude), PRKDC (SCID), RAG1 (R), and IL2RG (G), thus named NuSRG (Fig. 3C). NuSRG rabbit was partially hairless reflecting FOXN1 KO. Furthermore, it was deficient of T cells and B cells as measured using flow cytometry (Fig. 3D). Similarly, all other 3 multigenic immunodeficient founders (#179, 180, and 183) were also T and B cell deficient as determined by flow cytometry (data not shown). These data show that multigenic immu- nodeficient rabbits can be efficiently produced via multiplex targeting. We want to point out that due to the lack of robust antibodies for rabbit NK cell markers (e.g. CD16), we were not able to evaluate if NK cells are defective in the NuSRG rabbit as well as other immunodeficient ...
Citations
... The development of molecular genetic applications through techniques and a static approach has contributed to evaluating genetic variability, such as single genes [1] and genome-wide in rabbits [2]. The mitochondrial DNA (mtDNA) has allowed researchers to clarify rabbit evolution, demonstration, and migration [3][4][5]. ...
The current study aimed to detect the genetic variability of mitochondrial DNA (mtDNA) cytochrome B (CYTB) gene in 80 native Egyptian rabbits (NER) belonging to three populations in three different agriculture regions (Delta, Middle, and Upper Egypt) and also investigate the origin of these breeds by phylogenetic relationship analysis. A total of 62 haplotypes were recorded among the three NER populations. The native Upper Egypt rabbits (NUER) expressed the highest number of haplotypes, mutations, polymorphic sites, and haplotype diversity (23, 55, 51, and 1.00, respectively). While it gave the lowest values of nucleotide diversity (0.0262) and Tajima's D (− 0.01435), the percentage of mutual haplotypes was 4.8 % between the Middle and Delta Egypt populations. The phylogenetic analysis showed that there were more separated haplotypes of NUER compared to other populations. The same finding was also observed when supported by 31 sequences of different rabbit breeds retrieved from the GeneBank database. A mutual haplotype was observed between native Delta Egyptian rabbits (NDER) and New Zealand (NWZ) rabbits. The results of this study shed light on the importance of indigenous breeds in rural areas through mtDNA, which contributes to finding sustainable strategies to conserve and improve genetic resources in Egyptian rural areas.
... Approximately 1 mL of peripheral blood was collected from WT and Krt71-KO mice into an EDTA-coated tube. The red blood cells were lysed using a Red Blood Cell Lysis Buffer (C3702, Beyotime, Shanghai, China) as instructed by the manufacturer, and antibody incubation was performed as described in previous work [20]. Briefly, single cells were stained with a premixed FITC Rat Anti-Mouse CD4 antibody (553046, BD Biosciences, Shanghai, China) and PE Rat Anti-Mouse CD8a antibody (553032, BD Biosciences), which used a Facs buffer for 30 min at 4 • C, avoiding direct light, and was then washed with 500 µL of a cold Facs buffer for 5 min. ...
Hypotrichosis simplex (HS) and woolly hair (WH) are rare and monogenic disorders of hair loss. HS, characterized by a diffuse loss of hair, usually begins in early childhood and progresses into adulthood. WH displays strong coiled hair involving a localized area of the scalp or covering the entire side. Mutations in the keratin K71(KRT71) gene have been reported to underlie HS and WH. Here, we report the generation of a mouse model of HS and WH by the co−injection of Cas9 mRNA and sgRNA, targeting exon6 into mouse zygotes. The Krt71−knockout (KO) mice displayed the typical phenotypes, including Krt71 protein expression deletion and curly hair in their full body. Moreover, we found that mice in 3–5 weeks showed a new phenomenon of the complete shedding of hair, which was similar to nude mice. However, we discovered that the mice exhibited no immune deficiency, which was a typical feature of nude mice. To our knowledge, this novel mouse model generated by the CRISPR/Cas9 system mimicked woolly hair and could be valuable for hair disorder studies.
... Cas9 is a promising gene editing nucleases given its ease of use, multiplex capacity, and unparalleled targeting efficiency [2][3][4]. Many groups including us have reported efficient Cas9 mediated gene editing in cultured cells [5,6] and animal embryos [7][8][9] for translational biomedical applications [10,11]. However, at least three major challenges remain as roadblocks for implementation of clinical gene editing therapeutics. ...
... To attain the high in vivo efficacy required of gene-editing based systems, we imagine that the HP-pDNA polyplexes may require a sustained release not achieved with polyplexes alone. Previous work from our lab has shown that increased duration of poly(lactic-co-glycolic acid) (PLGA) microsphere release can enhance the in vivo stability of miRNA delivery systems [8,25]. ...
Gene editing nucleases such as CRISPR/Cas9 have enabled efficient and precise gene editing in vitro and hold promise of eventually achieving in vivo gene editing based therapy. However, a major challenge for their use is the lack of a safe and effective virus-free system to deliver gene editing nuclease elements. Polymers are a promising class of delivery vehicle due to their higher safety compared to currently used viral vectors, but polymers suffer from lower transfection efficiency. Polymeric vectors have been used for small nucleotide delivery but have yet to be used successfully with plasmid DNA (pDNA), which is often several hundred times larger than small nucleotides, presenting an engineering challenge. To address this, we extended our previously reported hyperbranched polymer (HP) delivery system for pDNA delivery by synthesizing several variants of HPs: HP-800, HP-1.8K, HP-10K, HP-25K. We demonstrate that all HPs have low toxicity in various cultured cells, with HP-25K being the most efficient at packaging and delivering pDNA. Importantly, HP-25K mediated delivery of CRISPR/Cas9 pDNA resulted in higher gene-editing rates than all other HPs and Lipofectamine at several clinically significant loci in different cell types. Consistently, HP-25K also led to more robust base editing when delivering the CRISPR base editor “BE4-max” pDNA to cells compared with Lipofectamine. The present work demonstrates that HP nanoparticles represent a promising class of vehicle for the non-viral delivery of pDNA towards the clinical application of gene-editing therapy.
... We generated transgenic rabbits, including EJ-ras and HLA-A2.1 rabbits, to facilitate determination of the role of host oncogene and immune responses in the CRPV infection [33,46,50,134]. In recent years, novel gene modification technologies, especially CRISPR editing, have enabled rapid production of gene-modified rabbits [135][136][137]. ...
Approximately 5% of all human cancers are attributable to human papillomavirus (HPV) infections. HPV-associated diseases and cancers remain a substantial public health and economic burden worldwide despite the availability of prophylactic HPV vaccines. Current diagnosis and treatments for HPV-associated diseases and cancers are predominantly based on cell/tissue morphological examination and/or testing for the presence of high-risk HPV types. There is a lack of robust targets/markers to improve the accuracy of diagnosis and treatments. Several naturally occurring animal papillomavirus models have been established as surrogates to study HPV pathogenesis. Among them, the Cottontail rabbit papillomavirus (CRPV) model has become known as the gold standard. This model has played a pivotal role in the successful development of vaccines now available to prevent HPV infections. Over the past eighty years, the CRPV model has been widely applied to study HPV carcinogenesis. Taking advantage of a large panel of functional mutant CRPV genomes with distinct, reproducible, and predictable phenotypes, we have gained a deeper understanding of viral–host interaction during tumor progression. In recent years, the application of genome-wide RNA-seq analysis to the CRPV model has allowed us to learn and validate changes that parallel those reported in HPV-associated cancers. In addition, we have established a selection of gene-modified rabbit lines to facilitate mechanistic studies and the development of novel therapeutic strategies. In the current review, we summarize some significant findings that have advanced our understanding of HPV pathogenesis and highlight the implication of the development of novel gene-modified rabbits to future mechanistic studies.
... Multiplex gene KO Immunodeficiency [84][85][86] CRISPR/Cas9 FUT1; FUT2; SEC1 KO Fucosyltransferases enzymes activity [87] CRISPR/Cas9 ROSA 26 KI Safe harbor gene [88,89] [91] YFE-BE4max TYR p.Q68Stop Oculocutaneous albinism [92] nNme2-CBE FGF5 p.Q79Stop Long hair [93] eA3G-BE TYR p.Q48stop Oculocutaneous albinism [94] NG-ABEmax HOXC13 p.Q271R Hair and nail ectodermal dysplasia [95] BE4max ...
Animal models have great importance in the research of human neurodegenerative diseases due to their value in symptom mimicking, mechanism investigation, and preclinical tests. Although non-human primate and large animal models have good performance in disease modeling due to their high maintenance cost and critical ethical standards, rodent models are commonly used. Rodent models have been successfully applied in modeling many neurological diseases; however, their genetic background, neuroanatomical features, and nervous system development are different from those of humans. Moreover, the short lifespan and small body size of rodent models also limit the monitoring of disease progression and observation of clinical symptoms in studying neuronal disorders that are late-onset or have a long course of progression. In comparison with rodents, rabbits are phylogenetically closer to humans and have closer similarities to humans in brain development, thus are an alternate animal model for human neurological diseases.
... We recently reported the production of immunodeficient rabbits by CRISPR-Cas9-mediated disruption of genes involved in lymphocyte development or function, such as IL2RG, RAG1, RAG2, PRKDC, and FOXN1 (Song et al., 2017). We reasoned that an immunodeficient animal model of larger size and longer lifespan than its mouse counterpart may prove useful in many translational studies. ...
... Previously we produced FOXN1 mutant rabbits by CRISPR-Cas9-mediated gene disruption (Song et al., 2017). The founder animals (F0) are mosaic, carrying wild-type (WT) alleles encoding the full-length FOXN1 protein consisting of 667 amino acids (aa) and one or more mutant alleles (Song et al., 2017). ...
... Previously we produced FOXN1 mutant rabbits by CRISPR-Cas9-mediated gene disruption (Song et al., 2017). The founder animals (F0) are mosaic, carrying wild-type (WT) alleles encoding the full-length FOXN1 protein consisting of 667 amino acids (aa) and one or more mutant alleles (Song et al., 2017). The present work is based on three different mutant alleles within the founder rabbits (Figure 1A): (1) D5, a deletion of 5 bp, predicted to result in a frameshift from proline at aa position 84 (P84) with a truncated size of 120 aa; (2) D10, a deletion of 10 bp, predicted to result in a frameshift from threonine at aa position 81 (T81) with a truncated size of 299 aa; and (3) D11, a deletion of 11 bp, predicted to result in a frameshift from glutamine at aa position 83 (Q83) with a truncated size of 118 aa. ...
Loss-of-function mutations in the forkhead box N1 (FOXN1) gene lead to nude severe combined immunodeficiency, a rare inherited syndrome characterized by athymia, severe T cell immunodeficiency, congenital alopecia, and nail dystrophy. We recently produced FOXN1 mutant nude rabbits (NuRabbits) by using CRISPR-Cas9. Here we report the establishment and maintenance of the NuRabbit colony. NuRabbits, like nude mice, are hairless, lack thymic development, and are immunodeficient. To demonstrate the functional applications of NuRabbits in biomedical research, we show that they can successfully serve as the recipient animals in xenotransplantation experiments using human induced pluripotent stem cells or tissue-engineered blood vessels. Our work presents the NuRabbit as a new member of the immunodeficient animal model family. The relatively large size and long lifespan of NuRabbits offer unique applications in regenerative medicine, cancer research, and the study of a variety of other human conditions, including immunodeficiency.
... For example, it can be employed to generate gene knockout and knock-in animals as disease models. Our team has established a robust platform in generating knockout and knock-in rabbit models (Yang et al., 2014;Song et al., 2016;Yang et al., 2016;Song et al., 2017;Yang et al., 2019;Song et al., 2020). Furthermore, CRISPR/Cas9 can be used to correct disease causing mutations hence holds the promise for gene editing based therapeutics. ...
Cystic Fibrosis (CF) is a lethal autosomal recessive disease caused by mutations in the gene encoding the cystic fibrosis transmembrane conductance regulator (CFTR). The most common mutation is the deletion of phenylalanine residue at position 508 (ΔF508). Here we report the production of CFTR-ΔF508 rabbits by CRISPR/Cas9-mediated gene editing. After microinjection and embryo transfer, 77 kits were born, of which five carried the ΔF508 mutation. To confirm the germline transmission, one male ΔF508 founder was bred with two wild-type females and produced 16 F1 generation kits, of which six are heterozygous ΔF508/WT animals. Our work adds CFTR-ΔF508 rabbits to the toolbox of CF animal models for biomedical research.
... Generation of CF rabbits using CRISPR/Cas9 technology. CF founder rabbits were produced by CRISPR/Cas9 using a well-established gene-editing platform in New Zealand White (NZW) rabbits (22)(23)(24). Due to the inherent nature of CRISPR/Cas9-mediated gene targeting in which the specific mutation types are generally unpredictable, founder animals carried different mutation alleles. Founder animals were bred with WT rabbits to verify germline transmission, and 3 lines of CF rabbits were established carrying the following insertion or deletion (indel) types: (a) CFΔ1, with 1 nucleotide deletion (Δ1) that generates a premature stop codon after amino acid 477; (b) CF+1, with 1 nucleotide insertion (+1) that generates a premature stop codon after amino acid 480; and (c) CFΔ9, with a 9-nucleotide deletion (Δ9) that results in deletion of amino acids P477, S478, and E479 (Supplemental Figure 1, A-C). ...
... A robust CRISPR/Cas9 gene-editing platform developed in NZW rabbits was used (22,24,71), utilizing the Cas9 expression plasmid JDS246 and sgRNA expression plasmid DR274 (Addgene). The sgRNA (GGAGAGTTGGAGCCTTCAGA), located on exon 11 of the rabbit CFTR gene, 87 bp upstream of the F508 locus, was designed using Zifit software (http://zifit. ...
Existing animal models of cystic fibrosis (CF) have provided key insights into CF pathogenesis but have been limited by short lifespans, absence of key phenotypes, and/or high maintenance costs. Here, we report the CRISPR/Cas9-mediated generation of CF rabbits, a model with a relatively long lifespan and affordable maintenance and care costs. CF rabbits supplemented solely with oral osmotic laxative had a median survival of approximately 40 days and died of gastrointestinal disease, but therapeutic regimens directed toward restoring gastrointestinal transit extended median survival to approximately 80 days. Surrogate markers of exocrine pancreas disorders were found in CF rabbits with declining health. CFTR expression patterns in WT rabbit airways mimicked humans, with widespread distribution in nasal respiratory and olfactory epithelia, as well as proximal and distal lower airways. CF rabbits exhibited human CF-like abnormalities in the bioelectric properties of the nasal and tracheal epithelia. No spontaneous respiratory disease was detected in young CF rabbits. However, abnormal phenotypes were observed in surviving 1-year-old CF rabbits as compared with WT littermates, and these were especially evident in the nasal respiratory and olfactory epithelium. The CF rabbit model may serve as a useful tool for understanding gut and lung CF pathogenesis and for the practical development of CF therapeutics.
... In 2017, Xu's group at the University of Michigan produced multiple lines of ID rabbits, including FOXN1, RAG2, IL2RG, and PRKDC knockouts by multiplex sgRNA microinjection and multiplex embryo transfer [58]. In the multiplex sgRNA microinjection approach, different sgRNAs targeting different genes were pooled and microinjected to the same embryo, leading to the production of founder rabbits carrying multiple gene knockouts. ...
Production of immunodeficient (ID) models in non-murine animal species had been extremely challenging until the advent of gene-editing tools: first zinc finger nuclease (ZFN), then transcription activator-like effector nuclease (TALEN), and most recently clustered regularly interspaced short palindromic repeats-associated protein 9 (CRISPR)/Cas9. We and others used those gene-editing tools to develop ID rabbits carrying a loss of function mutation in essential immune genes, such as forkhead box protein N1 (FOXN1), recombination activating gene 1/2 (RAG1/2), and interleukin 2 receptor subunit gamma (IL2RG). Like their mouse counterparts, ID rabbits have profound defects in their immune system and are prone to bacterial and pneumocystis infections without prophylactic antibiotics. In addition to their use as preclinical models for primary immunodeficient diseases, ID rabbits are expected to contribute significantly to regenerative medicine and cancer research, where they serve as recipients for allo- and xeno-grafts, with notable advantages over mouse models, including a longer lifespan and a much larger body size. Here we provide a concise review of the history and current status of the development of ID rabbits, as well as future perspectives of this new member in the animal model family.
... In 2017, Xu's group at the University of Michigan produced multiple lines of ID rabbits, including FOXN1, RAG2, IL2RG, and PRKDC knockouts by multiplex sgRNA microinjection and multiplex embryo transfer [58]. In the multiplex sgRNA microinjection approach, different sgRNAs targeting different genes were pooled and microinjected to the same embryo, leading to the production of founder rabbits carrying multiple gene knockouts. ...
Production of immunodeficient (ID) models in non-murine animal species had been extremely challenging until the advent of gene-editing tools: first zinc finger nuclease (ZFN), then transcription activator-like effector nuclease (TALEN), and most recently clustered regularly interspaced short palindromic repeats-associated protein 9 (CRISPR)/Cas9. We and others used those gene-editing tools to develop ID rabbits carrying a loss of function mutation in essential immune genes, such as forkhead box protein N1 (FOXN1), recombination activating gene 1/2 (RAG1/2), and interleukin 2 receptor subunit gamma (IL2RG). Like their mouse counterparts, ID rabbits have profound defects in their immune system and are prone to bacterial and pneumocystis infections without prophylactic antibiotics. In addition to their use as preclinical models for primary immunodeficient diseases, ID rabbits are expected to contribute significantly to regenerative medicine and cancer research, where they serve as recipients for allo- and xeno-grafts, with notable advantages over mouse models, including a longer lifespan and a much larger body size. Here we provide a concise review of the history and current status of the development of ID rabbits, as well as future perspectives of this new member in the animal model family.
