Figure - available via license: Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International
Content may be subject to copyright.
Source publication
A breakdown in vascular integrity and excessive inflammation are hallmarks of serious pathological conditions including sepsis, acute respiratory distress syndrome (ARDs) and most recently, severe COVID-19. FK506 binding protein like (FKBPL) is a member of the immunophilin protein superfamily with potent anti tumor activity through inhibition of an...
Contexts in source publication
Context 1
... expression was determined by quantitative reverse transcription PCR (qPCR). Gene specific primers (Table 1; IDT, USA) were diluted 1/10 from stock 100 μM concentrations and PCR reaction was completed using a 7500 real time PCR system (ThermoFisher, USA) and Sybr Green (Invitrogen, Ireland). Changes in expression of genes of interest from untreated cells, or treatments were quantified by fold change-ΔΔCT from housekeeping genes β-Actin and GADPH (2-∆∆Ct). . ...Context 2
... copyright holder for this preprint this version posted February 25, 2021. ;https://doi.org/10.1101https://doi.org/10. /2021 Mouse GCGACATACTCAAGCAGGA GCA AGTGGTAACCGCTCAGGTGTT G IL-6 Mouse TACCACTTCACAAGTCGGAG GC CTGCAAGTGCATCATCGTTGTT C IL-1β Mouse TGGACCTTCCAGGATGAGGA CA GTTCATCTCGGAGCCTGTAGT G IL-1β Human CCACAGACCTTCCAGGAGA ATG GTGCAGTTCAGTGATCGTACA GG IL-6 Mouse TACCACTTCACAAGTCGGAG GC CTGCAAGTGCATCATCGTTGTT C . CC-BY-NC-ND 4.0 International license available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is ...Context 3
... list of phenotypes which met the traditional genome-wide association study (GWAS) significance threshold of p<= 5x10 -8 was compiled. The information obtained included the log fold change, average expression, P value and adjusted P value for each series (Supplementary Table 1). ...Context 4
... p=0.0314; n=6), IL-18 expression (rFKBPL p=0.0292; n=6); NFKB1 (AD-01, p=0.0239 rFKBPL, p=0.0185; n=5), COX2 (AD-01, p=0.0064 rFKBPL, p=0.0185; n=5) and IL-6 (rFKBPL, p=0.0439; n=5) ( Fig. 4E.). Similarly, in THP-1 human monocyte cell line, AD-01 (1 nM) significantly reduced mRNA expression of tnf, Il-β, Il-18, nlrp3, nfkb1 and casp1 following 6 h stimulation with LPS (1000 ng/ml) ( Supplementary Fig. 4). ...Similar publications
Hsp90 is an essential molecular chaperone responsible for the folding and activation of hundreds of ‘client’ proteins, including the glucocorticoid receptor (GR). Previously, we revealed that Hsp70 and Hsp90 remodel the conformation of GR to regulate ligand binding, aided by co-chaperones. In vivo, the co-chaperones FKBP51 and FKBP52 antagonistical...
Citations
... It was first identified in 1999 as a novel FK506-binding protein (FKBP) that exhibited homology with FKBP12, but with a different pattern of tissue expression. Since then, numerous studies have demonstrated that FKBPL plays a critical role in a variety of biological processes, including immune response [16], tumor growth [17], and angiogenesis [18]. Moreover, FKBPL is closely aligned with other members in a region where the tetra-trico-peptide repeat (TPR) domains are found. ...
The aim of this study was to investigate the potential antidepressant and anxiolytic effects of vitamin C and vitamin D in a stress-induced mouse model of depression, while also exploring the association between these effects and the levels of circulating NOx, periostin, and FKBPL. Our findings revealed that both vitamin C and vitamin D exhibited comparable antidepressant effects to escitalopram, a commonly used antidepressant, without demonstrating any anxiolytic effects. The antidepressant properties of vitamin C and vitamin D were linked to the normalization of Nox and FKBPL levels, while the levels of periostin showed no significant correlation. These results are consistent with previous research, indicating that the antidepressant effects of vitamin C and vitamin D may be attributed to their antioxidant and anti-inflammatory properties, as well as their modulation of neurotransmission and norepinephrine release. Additionally, our study uncovered elevated levels of periostin in stress-induced depression, which were only restored to normal levels by escitalopram, suggesting a potential role for periostin in mood disorders. Furthermore, FKBPL and NOx levels were increased in stress-induced depression and normalized by treatment with vitamin C, vitamin D, and escitalopram, indicating their involvement in the stress response and gene expression regulation. However, it is important to acknowledge certain limitations of our research, such as the use of a single depression induction model and limited dosing regimens. Future investigations should focus on examining these markers in specific brain regions, such as the hippocampus and prefrontal cortex, to gain a more comprehensive understanding of their potential implications for depression. Overall, our findings suggest that vitamin C, vitamin D, and escitalopram may possess antidepressant properties mediated by NOx and FKBPL levels, while emphasizing the potential significance of periostin in the context of depression.
... [10] The FKBPL-based therapeutic peptide, AD-01, has been shown to inhibit endothelial dysfunction and inflammatory cytokines in low FKBPL settings using in vitro and in vivo models suggesting that AD-01 may have therapeutic potential at low doses to restore FKBPL early in pregnancy that may prevent preeclampsia if proven safe in pregnancy. [35] Here, for the first time, we established a prototype of the nanoparticles-based point of care testing that has the potential for rapid and accurate detection of preeclampsia by quantifying the circulating CD44 to FKBPL protein ratio in plasma samples. The high-quality UCNPs, employed in this work, have presented significant advances in this field of biodetections, due to their high brightness, nonbleaching, nonblinking, and uniformity in size and intensity. ...
Preeclampsia is a heterogeneous and multiorgan cardiovascular disorder of pregnancy. Here, we report the development of a novel strip‐based lateral flow assay (LFA) using lanthanide‐doped upconversion nanoparticles conjugated to antibodies targeting two different biomarkers for detection of preeclampsia. We first measured circulating plasma FKBPL and CD44 protein concentrations from individuals with early‐onset preeclampsia (EOPE), using ELISA. We confirmed that the CD44/FKBPL ratio is reduced in EOPE with a good diagnostic potential. Using our rapid LFA prototypes, we achieved an improved lower limit of detection: 10 pg ml⁻¹ for FKBPL and 15 pg ml⁻¹ for CD44, which is more than one order lower than the standard ELISA method. Using clinical samples, a cut‐off value of 1.24 for CD44/FKBPL ratio provided positive predictive value of 100 % and the negative predictive value of 91 %. Our LFA shows promise as a rapid and highly sensitive point‐of‐care test for preeclampsia.
... FK506-binding protein like (FKBPL) is a divergent member of the immunophilin family known for its role as a secreted anti-angiogenic protein that exhibits its action via CD44, establishing its critical role in angiogenesis [9,10]. Additionally, FKBPL has been shown to regulate steroid receptor and inflammatory signalling via CD44, HSP90 and STAT3, with an important regulatory function in vascular health [10][11][12]. ...
... FKBPL plays a critical role in developmental and pathological angiogenesis and vascular function, which has been demonstrated in previous studies in which a murine homozygous knockout of FKBPL was embryonically lethal, whereas heterozygous knockdown resulted in impaired vascular integrity [10,11,23]. Furthermore, FKBPL has been shown to operate via the STAT3 [13], CD44 [24] and nuclear factor kappa B (NF-kB) [9] inflammatory pathways that commonly underly HF pathophysiology [25]. Thus, vascular dysfunction due to aberrant endothelial cell homeostasis, pro-inflammatory signalling and restricted angiogenesis potentially implicate FKBPL in the development of HF. ...
Heart failure (HF) is the leading cause of hospitalisations worldwide, with only 35% of patients surviving the first 5 years after diagnosis. The pathogenesis of HF with preserved ejection fraction (HFpEF) is still unclear, impeding the implementation of effective treatments. FK506-binding protein like (FKBPL) and its therapeutic peptide mimetic, AD-01, are critical mediators of angiogenesis and inflammation. Thus, in this study, we investigated—for the first time—FKBPL’s role in the pathogenesis and as a biomarker of HFpEF. In vitro models of cardiac hypertrophy following exposure to a hypertensive stimulus, angiotensin-II (Ang-II, 100 nM), and/or AD-01 (100 nM), for 24 and 48 h were employed as well as human plasma samples from people with different forms of HFpEF and controls. Whilst the FKBPL peptide mimetic, AD-01, induced cardiomyocyte hypertrophy in a similar manner to Ang-II (p < 0.0001), when AD-01 and Ang-II were combined together, this process was abrogated (p < 0.01–0.0001). This mechanism appears to involve a negative feedback loop related to FKBPL (p < 0.05). In human plasma samples, FKBPL concentration was increased in HFpEF compared to controls (p < 0.01); however, similar to NT-proBNP and Gal-3, it was unable to stratify between different forms of HFpEF: acute HFpEF, chronic HFpEF and hypertrophic cardiomyopathy (HCM). FKBPL may be explored for its biomarker and therapeutic target potential in HFpEF.
... FKBPL belongs to the immunophilin protein group and has been shown to have roles in the regulation of glucocorticoid, androgen and estrogen receptor signaling, stem cell differentiation, inflammation and inhibition of angiogenesis; the latter three mediated via the CD44 cell surface receptor [24][25][26][27][28][29][30][31][32]. Furthermore, recent data have demonstrated that FKBPL could be used as a diagnostic and/or treatment target for cardiovascular diseases (CVDs), placental health and preeclampsia [22,[33][34][35]. ...
... To our knowledge, this regulatory effect of TNF-α on the expression of FKBPL has not previously been shown. Along with emerging evidence identifying FKBPL's role in regulating nuclear factor-κB (NF-κB) signaling, this could contribute to our understanding of the importance of FKBPL in inflammatory pathways [32]. In addition, various studies suggest that Gal-3 is under the positive control of TNF-α [76][77][78]. ...
Preeclampsia is a pregnancy-specific cardiovascular disorder, involving significant maternal endothelial dysfunction. Although inappropriate placentation due to aberrant angiogenesis, inflammation and shallow trophoblast invasion are the root causes of preeclampsia, pathogenic mechanisms are poorly understood, particularly in early pregnancy. Here, we first confirm the abnormal expression of important vascular and inflammatory proteins, FK506-binding protein-like (FKBPL) and galectin-3 (Gal-3), in human plasma and placental tissues from women with preeclampsia and normotensive controls. We then employ a three-dimensional microfluidic placental model incorporating human umbilical vein endothelial cells (HUVECs) and a first trimester trophoblast cell line (ACH-3P) to investigate FKBPL and Gal-3 signaling in inflammatory conditions. In human samples, both circulating (n = 17 controls; n = 30 preeclampsia) and placental (n ≥ 6) FKBPL and Gal-3 levels were increased in preeclampsia compared to controls (plasma: FKBPL, p < 0.0001; Gal-3, p < 0.01; placenta: FKBPL, p < 0.05; Gal-3, p < 0.01), indicative of vascular dysfunction in preeclampsia. In our placenta-on-a-chip model, we show that endothelial cells are critical for trophoblast-mediated migration and that trophoblasts effectively remodel endothelial vascular networks. Inflammatory cytokine tumour necrosis factor-α (10 ng/mL) modulates both FKBPL and Gal-3 signaling in conjunction with trophoblast migration and impairs vascular network formation (p < 0.005). Our placenta-on-a-chip recapitulates aspects of inappropriate placental development and vascular dysfunction in preeclampsia.
... In addition to the immunosuppressant effects, immunophilins have shown to have important roles in inflammation [21], cancer [22], cardiovascular disease and neurodegenerative disorders [23][24][25], by regulating soluble protein retrotransport through the interaction with dynein motors [4], neurodifferentiation and neuroregeneration [26], adipocytes differentiation [27], transcriptional regulation [28], steroid binding capacity [29], cell division [30] and apoptosis [31]. Even though fibrosis develops as a sequela of inflammation, the role of immunophilins in the process of fibrosis development has not yet been elucidated. ...
Immunophilins are a family of proteins encompassing FK506-binding proteins (FKBPs) and cyclophilins (Cyps). FKBPs and Cyps exert peptidyl-prolyl cis-trans isomerase (PPIase) activity, which facilitates diverse protein folding assembly, or disassembly. In addition, they bind to immunosuppressant medications where FKBPs bind to tacrolimus (FK506) and rapamycin, whereas cyclophilins bind to cyclosporin. Some large immunophilins have domains other than PPIase referred to as tetratricopeptide (TPR) domain, which is involved in heat shock protein 90 (Hsp90) and heat shock protein 70 (Hsp 70) chaperone interaction. The TPR domain confers immunophilins’ pleotropic actions to mediate various physiological and biochemical processes. So far, immunophilins have been implicated to play an important role in pathophysiology of inflammation, cancer and neurodegenerative disorders. However, their importance in the development of fibrosis has not yet been elucidated. In this review we focus on the pivotal functional and mechanistic roles of different immunophilins in fibrosis establishment affecting various organs. The vast majority of the studies reported that cyclophilin A, FKBP12 and FKBP10 likely induce organ fibrosis through the calcineurin or TGF-β pathways. FKBP51 demonstrated a role in myelofibrosis development through calcineurin-dependant pathway, STAT5 or NF-κB pathways. Inhibition of these specific immunophilins has been shown to decrease the extent of fibrosis suggesting that immunophilins could be a novel promising therapeutic target to prevent or reverse fibrosis.
... The RUPP model is one of the most reliable in vivo models for studying preeclampsia. Although there is substantial evidence published exploring this model's reflection of human features of preeclampsia, we aimed to confirm the cardiovascular phenotype in RUPP rats and to determine the regulation of an emerging anti-angiogenic protein, FKBPL, which also regulates some key inflammatory pathways [26,53]. This is the first study that explores the cardiovascular health in the RUPP model of preeclampsia and the association of FKBPL in cardiac dysfunction in preeclampsia. ...
... This is aligned with the positive correlation observed previously between FKBPL plasma levels and diastolic dysfunction or BNP plasma levels in human samples [20]. Recent studies show that FKBPL regulates inflammatory STAT3 signalling, via CD44 and NFkB, which are both implicated in preeclampsia [26,53,64,65]. This data supports our hypothesis that FKBPL may be a novel mechanism of cardiovascular damage in preeclampsia. ...
Background
Preeclampsia is a dangerous cardiovascular disorder of pregnancy that leads to an increased risk of future cardiovascular and metabolic disorders. Much of the pathogenesis and mechanisms involved in cardiac health in preeclampsia are unknown. A novel anti-angiogenic protein, FKBPL, is emerging as having a potential role in both preeclampsia and cardiovascular disease (CVD). Therefore, in this study we aimed to characterise cardiac health and FKBPL regulation in the rat reduced uterine perfusion pressure (RUPP) and a 3D cardiac spheroid model of preeclampsia.
Methods
The RUPP model was induced in pregnant rats and histological analysis performed on the heart, kidney, liver and placenta ( n ≥ 6). Picrosirius red staining was performed to quantify collagen I and III deposition in rat hearts, placentae and livers as an indicator of fibrosis. RT-qPCR was used to determine changes in Fkbpl , Icam1 , Vcam1, Flt1 and Vegfa mRNA in hearts and/or placentae and ELISA to evaluate cardiac brain natriuretic peptide (BNP45) and FKBPL secretion. Immunofluorescent staining was also conducted to analyse the expression of cardiac FKBPL. Cardiac spheroids were generated using human cardiac fibroblasts and human coronary artery endothelial cells and treated with patient plasma from normotensive controls, early-onset preeclampsia (EOPE) and late-onset preeclampsia (LOPE); n = 3. FKBPL and CD31 expression was quantified by immunofluorescent labelling.
Results
The RUPP procedure induced significant increases in blood pressure ( p < 0.001), collagen deposition ( p < 0.001) and cardiac BNP45 ( p < 0.05). It also induced a significant increase in cardiac FKBPL mRNA ( p < 0.05) and protein expression ( p < 0.01). RUPP placentae also exhibited increased collagen deposition and decreased Flt1 mRNA expression ( p < 0.05). RUPP kidneys revealed an increase in average glomerular size ( p < 0.05). Cardiac spheroids showed a significant increase in FKBPL expression when treated with LOPE plasma ( p < 0.05) and a trend towards increased FKBPL expression following treatment with EOPE plasma ( p = 0.06).
Conclusions
The rat RUPP model induced cardiac, renal and placental features reflective of preeclampsia. FKBPL was increased in the hearts of RUPP rats and cardiac spheroids treated with plasma from women with preeclampsia, perhaps reflective of restricted angiogenesis and inflammation in this disorder. Elucidation of these novel FKBPL mechanisms in cardiac health in preeclampsia could be key in preventing future CVD.
... As discussed in the introduction, FKBPL is a protein member of the immunophilin family with important roles in immune regulation (58). Furthermore, FKBPL was described recently as a regulator of inflammation and vascular integrity via modulating NF-kB signalling (59). Our results revealed that FKBPL expression is reduced in T1D placentae suggesting that FKBPL may also have a role in modulating immune adaptation and inflammation in this setting. ...
Diabetes in pregnancy is associated with adverse pregnancy outcomes including preterm birth. Although the mechanisms leading to these pregnancy complications are still poorly understood, aberrant angiogenesis and endothelial dysfunction play a key role. FKBPL and SIRT-1 are critical regulators of angiogenesis, however, their roles in pregnancies affected by diabetes have not been examined before in detail. Hence, this study aimed to investigate the role of FKBPL and SIRT-1 in pre-gestational (type 1 diabetes mellitus, T1D) and gestational diabetes mellitus (GDM). Placental protein expression of important angiogenesis proteins, FKBPL, SIRT-1, PlGF and VEGF-R1, was determined from pregnant women with GDM or T1D, and in the first trimester trophoblast cells exposed to high glucose (25 mM) and varying oxygen concentrations [21%, 6.5%, 2.5% (ACH-3Ps)]. Endothelial cell function was assessed in high glucose conditions (30 mM) and following FKBPL overexpression. Placental FKBPL protein expression was downregulated in T1D (FKBPL; p<0.05) whereas PlGF/VEGF-R1 were upregulated (p<0.05); correlations adjusted for gestational age were also significant. In the presence of GDM, only SIRT-1 was significantly downregulated (p<0.05) even when adjusted for gestational age (r=-0.92, p=0.001). Both FKBPL and SIRT-1 protein expression was reduced in ACH-3P cells in high glucose conditions associated with 6.5%/2.5% oxygen concentrations compared to experimental normoxia (21%; p<0.05). FKBPL overexpression in endothelial cells (HUVECs) exacerbated reduction in tubule formation compared to empty vector control, in high glucose conditions (junctions; p<0.01, branches; p<0.05). In conclusion, FKBPL and/or SIRT-1 downregulation in response to diabetic pregnancies may have a key role in the development of vascular dysfunction and associated complications affected by impaired placental angiogenesis.
Systemic juvenile idiopathic arthritis (SJIA) is a severe rheumatic disease in children. It is a subgroup of juvenile idiopathic arthritis (JIA; MIM #604302), which is the most common rheumatic disease in children. The diagnosis of SJIA often comes with a significant delay, and the classification between autoinflammatory and autoimmune disease is still discussed. In this study, we analyzed the immunological responses of patients with SJIA, using human proteome arrays presenting immobilized recombinantly expressed human proteins, to analyze the involvement of autoantibodies in SJIA. Results from group comparisons show several differentially reactive antigens involved in inflammatory processes. Intriguingly, many of the identified antigens had a high reactivity against proteins involved in the NF-κB pathway, and it is also notable that many of the detected DIRAGs are described as dysregulated in rheumatoid arthritis. Our data highlight novel proteins and pathways potentially dysregulated in SJIA and offer a unique approach to unraveling the underlying disease pathogenesis in this chronic arthropathy.
Preeclampsia is a heterogeneous and multiorgan cardiovascular disorder of pregnancy. Here, we report the development of a novel strip‐based lateral flow assay (LFA) using lanthanide‐doped upconversion nanoparticles conjugated to antibodies targeting two different biomarkers for detection of preeclampsia. We first measured circulating plasma FKBPL and CD44 protein concentrations from individuals with early‐onset preeclampsia (EOPE), using ELISA. We confirmed that the CD44/FKBPL ratio is reduced in EOPE with a good diagnostic potential. Using our rapid LFA prototypes, we achieved an improved lower limit of detection: 10 pg ml ⁻¹ for FKBPL and 15 pg ml ⁻¹ for CD44, which is more than one order lower than the standard ELISA method. Using clinical samples, a cut‐off value of 1.24 for CD44/FKBPL ratio provided positive predictive value of 100 % and the negative predictive value of 91 %. Our LFA shows promise as a rapid and highly sensitive point‐of‐care test for preeclampsia.
