Figure - available from: Archives of Virology
This content is subject to copyright. Terms and conditions apply.
Prevalence of FPV, FBoV and FeAstV in diarrheic and healthy cats. (a) Total positive rates of these three viruses in diarrheic and healthy cats. The difference was evaluated using the chi-square test. Probability (p) values are shown on the bar chart. A p-value <0.05 was considered statistically significant. (b) Monoinfection and coinfection rates of these three viruses in diarrheic and healthy cats
Source publication
A multiplex polymerase chain reaction (mPCR) assay was developed to detect and distinguish feline panleukopenia virus (FPV), feline bocavirus (FBoV) and feline astrovirus (FeAstV). Three pairs of primers were designed based on conserved regions in the genomic sequences of the three viruses and were used to specifically amplify targeted fragments of...
Similar publications
Astroviruses, isolated from numerous avian and mammalian species including humans, are commonly associated with enteritis and encephalitis. Two astroviruses have previously been identified in cats, and while definitive evidence is lacking, an association with enteritis is suggested. Using metagenomic next-generation sequencing of viral nucleic acid...
Citations
... FPLV is a common disease with high morbidity and mortality. FPLV is spread worldwide with a high mortality rate of 25% to 90% and poses a serious threat to the life and health of cats (Niu et al., 2018;Zhang et al., 2019). Despite the routine use of effective vaccines, studies have shown that the cat population in many countries is not well protected and the circulation of the virus cannot be prevented by vaccination (Muz et al., 2012;Oğuzoğlu et al., 2013;Truyen and Parrish, 2013;Koç and Oğuzoğlu, 2016;Leal et al., 2020). ...
Feline parvovirus (FPV) infection, which is common in cats around the world, progresses with leukopenia, gastroenteritis and can lead to death in young animals. The virus is a non-enveloped, single-stranded DNA virus; located in the genus of Carnivore protoparvovirus 1. Feline panleukopenia virus (FPLV) and Canine Parvovirus (CPV-2), which causes the disease, are genetically closely related and show a high genomic similarity. Groups are formed according to the genomic differences of parvoviruses, especially in the VP2 gene. There are 3 groups as G1, G2, G3 in FPV and 3 groups as 2a, 2b and 2c in CPV-2. The present study aimed to determine the presence of infection, to perform molecular characterization of the virus at the VP2 gene level, and to investigate genomic differences. FPLV DNA was detected in 7 (36.84%) of the stool samples collected from 19 cats with diarrhea and vomiting symptoms. Genotyping and phylogenetic analysis of the positive samples were performed. It was observed that five of the FPLV positive samples obtained were in the G3, one sample was in the G1, and one sample was in the CPV-2b group. FPV was investigated for the first time in Balıkesir province and the data of the feline parvovirus sequence was defined to Genbank. Current phylogenetic information about the FPV in Turkey was obtained in the present study.
... Early signs include the presence of leukopenia, fever, lethargy, anorexia, and dehydration (Kruse et al., 2010), later manifesting into severe leukopenia, vomiting, diarrhea, to severe depression (Abd-Eldaim et al., 2009;Awad et al., 2018). Infections in fetuses and neonates cause clinical signs in the form of ataxia and eye disorders (Zhang et al., 2019), whereas infections in cats older than 4-6 weeks of age mainly cause gastrointestinal disturbances and leukopenia (Abd-Eldaim et al., 2009). Infection in adult cats causes clinical signs such as fever, lethargy, vomiting, diarrhea to dehydration (Kruse et al., 2010;Jacobson et al., 2021). ...
... The primers used in the study were Forward 5'-CATACATGGCAAACAAATAGAGCA-3' and Reverse 5'-TGTTTTAAATGGCCCTTG TGTAGA-3' (Zhang et al., 2019). The DNA electrophoresis process was carried out on a 2% agarose gel, and the electrophoresis process was run for 45 minutes at 70 volts. ...
... Animals that experience discomfort in their bodies tend to look lethargic, decrease their level of activity and appetite. Pain and stress can reduce appetite and cause anorexia (Zhang et al., 2019). Study before reported the same thing in their research, namely anorexia and lethargy were the most common early symptoms of FPV infection, both in young and adult cats (Levy et al., 2015;Awad et al., 2018). ...
Feline panleukopenia (FPL) is a viral infectious disease caused by the feline panleukopenia virus (FPV) that affects cats of all ages. Clinical symptoms that appear in each individual cat vary greatly, depending on age, immune status, and the presence or absence of secondary infection. The aim of this research was to diagnose the FPL based on clinical signs and polymerase chain reaction (PCR) in cat with various ages. This study used 15 cats that showed one of clinical symptoms including lethargy, anorexia, fever, diarrhea, and vomiting. All cats were examined physically and by PCR of blood, then analyzed descriptively. The results showed that 10/15 (66.7%) cats were <7 months, 4/15 (26.7%) were 7-12 months, and 1/15 (6.6%) was >1 year old. Identification by PCR showed that 100% of the samples positive, so that all of cats diagnosed FPL. Clinical signs that commonly appeared in this study included anorexia (80%), fever (80%), vomiting (73.3%), lethargy (66.7%), and diarrhea (40%). Young cats <7 months commonly showed anorexia, fever, vomiting, and lethargy, cats aged 7-12 months commonly showed anorexia, fever, vomiting, and diarrhea, cat aged >12 months experienced anorexia and vomiting. Concluded that the predominant clinical symptoms of FPL in young cats were anorexia, fever, vomiting and lethargy, whereas in adult cats anorexia, fever, vomiting, and diarrhea. Clinical symptoms can be used for initial screening of FPL, but the causative diagnosis needs to be determined by polymerase chain reaction.
... FPV infection was typically characterized by vomiting, fever, leucopenia, and diarrhea (Pfankuche et al. 2018). Significantly, FPV poses a severe threat to young animals up to 6 months and is associated with a high mortality and morbidity rate in this population (Zhang et al. 2019). Moreover, FPV could persist in many cats as a subclinical infection, and cats infected with FPV can shed the virus for at least six weeks following infection (Stuetzer and Hartmann 2014). ...
... 1 40 microscopy, ELISA, and molecular testing (Veijalainen et al. 1986;Ikeda et al. 1998;Esfandiari and Klingeborn 2000;Decaro et al. 2008;DiGangi et al. 2011;Lane et al. 2016;Wang et al. 2019;Zhang et al. 2019). In recent years, though several detection methods have been developed commercially to detect FPV, nucleic acid testing is still the gold standard for FPV detection. ...
Feline parvovirus (FPV) is highly infectious for cats and other Felidae and often causes severe damage to young kittens. In this study, we incorporated recombinase polymerase amplification (RPA) and Cas12a-mediated detection and developed an RPA-Cas12a-based real-time or end-point fluorescence detection method to identify the NS1 gene of FPV. The total time of RPA-Cas12a-based fluorescence assay is approximately 25 min. The assay presented a limit of detection (LOD) of 1 copies/μl (25 copies/per reaction), with no cross-reactivity with several feline pathogens. The clinical performance of the assay was examined using total genomic DNA purified from 60 clinical specimens and then compared to results obtained with qPCR detection of FPV with 93.3% positive predictive agreement and 100% negative predictive agreement. Together, the rapid reaction, cost-effectiveness, and high sensitivity make the RPA-Cas12a-based fluorescence assay a fascinating diagnostic tool that will help minimize infection spread through instant detection of FPV.
... In the present study, 42.86% (9/21) of cats were coinfected with FPV and other viruses, and FCoV, FAstV and FBoV had a high-coinfection rate with FPV. The three coinfective viruses showed a high-prevalence rate in some regions of China [51,53,54]. The detection rate of FChPV was high in clinical cases. ...
... Though no targeted studies have been conducted on the role of the coinfective viruses in enteritis diseases, their positive rate in cats with diarrhea was much higher than that in cats without diarrhea. It suggested that coinfective viruses may be associated with hemorrhagic enteritis in cats [19,54]. The high coinfection revealed insufficient potency by immunization of current commercial vaccines or by treatment with parvovirus-specific antibodies, which could not give resistance to coinfective viruses, thus bringing challenge to the diagnosis and treatment of FPL. ...
Feline panleukopenia (FPL) is a highly contagious infectious disease caused by infection with feline parvovirus (FPV) and canine parvovirus type 2 (CPV-2). In recent years, the number of cats with FPL has increased with the expansion of pet cat population in China. The feces of 51 cats with diarrhea symptoms collected from 2021 to 2022 in Eastern Shandong, China, were detected by polymerase chain reaction for parvovirus and other viruses related to feline diarrhea to investigate the prevalence and gene variation of parvovirus in cats. In all the 51 samples, 45.1% (23/51) were positive for at least one viral pathogen, and the positivity of parvovirus was 41.2% (21/51), showing a high prevalence. Multiple-pathogen testing indicated high-coinfection rates of 42.9% (9/21) with other common viruses in parvovirus-positive cats. Most of the coinfections are feline coronavirus (FCoV), followed by feline astrovirus (FAstV) and feline bocavirus (FBoV). The complete VP2 sequences of 21 parvoviruses were obtained. Among them, 20 sequences were identified as FPV, and only one was CPV-2c of Asian origin, which was first detected from cats in Eastern Shandong, China. A phylogenetic tree of the 20 FPVs was constructed together with 698 FPVs (cat/dog host) worldwide on the basis of complete VP2. The 18 FPVs displayed high-sequence identity to one another (99.8%–100%), and they were clustered into FPV-G1 group, whereas the other two were clustered into FPV-G3 group. The FPV-G1 group increased dramatically to become predominant after 2019 in China, contributing to the prevalence of A91S mutation due to 96.07% FPV-G1 with A91S mutation as well as 100% of FPV-G2 and 99.12% of FPV-G3 with 91A in the statistical analysis. This study enriched the understanding of the prevalence, molecular evolution, and cross-species transmission of parvovirus in cats and provided a basis for responding to challenges in the diagnosis and treatment of FPL.
... The clinical manifestations and pathological alterations of FPLV in cats are not definitive to confirm the presence of the disease because they may interfere with other diseases such as feline immunodeficiency virus and feline leukemia virus [19,20], feline calcivirus [21,22] and feline bocavirus or feline astrovirus [23]. Therefore, there are several laboratory techniques developed to confirm FPLV in cats such as viral isolation, hemagglutination assay (HA), immunofluorescence assay (IFA), electron microscopy, and polymerase chain reaction technique [24], virus neutralization and hemagglutination inhibition test [25,26], direct enzyme linked immunosorbent assay as immunochromatography rapid tests [16], and indirect enzyme linked immunosorbent assay and immune chromatography assay [15]. ...
... Therefore, there are several laboratory techniques developed to confirm FPLV in cats such as viral isolation, hemagglutination assay (HA), immunofluorescence assay (IFA), electron microscopy, and polymerase chain reaction technique [24], virus neutralization and hemagglutination inhibition test [25,26], direct enzyme linked immunosorbent assay as immunochromatography rapid tests [16], and indirect enzyme linked immunosorbent assay and immune chromatography assay [15]. Moreover, conventional polymerase chain reaction (cPCR) technique [27], Real time PCR technique [28], and Multiplex PCR technique [23]. ...
... Furthermore, various studies worldwide indicated varying prevalence rate of FPV in cats using diverse laboratory tools such as in Saudi Arabia was 4.48% using indirect fluorescent antibody test (IFA) [33], in different province of Turkey was 10% and 25%, using c-PCR and RT-PCR respectively [27,29], in Iran was 34% using ICA [34], United Arab Emirates (UAE) was 2.2% using ICA [35], in Indonesia and Bangladesh was 72.7% and 18.375 respectively [36,37], in Egypt was 35% and 43 using ICA and c-PCR respectively [38], in Korea, Germany and Italy was 36.36%, 48.7% and 73.5% respectively using real time PCR [24,28,39], and in China was 37.06% using multiplex PCR [23]. The variations in prevalence of FPV in variety of regions and countries were caused by varying management strategies, environmental circumstances, effective diagnostic procedures utilized in various studies, and the presence and/or absence of other parameters including the age, physical and immunological status of the host [27,[38][39][40]. ...
... Two sets of primers that simultaneously amplify two different DNA fragments of the VP2 gene of FPLV (236bp) and of CPV (583bp) were used in this assay. Primers, FPLV (Forward CATACATGG-CAAACAAATAGAGCA, Reverse TGTTTTAAAT-GGCCCTTGTGTAGA) (Zhang et al. 2019) and CPV (Forward CAGGAAGATATCCAGAAGGA, Reverse CAGGAAGATATCCAGAAGGA) (Buonavoglia et al. 2001) have been previously described but never used in a combination. ...
... The dPCR was conducted in 50 μl volumes, consisting of 25 μl of 2X TOPsimple DyeMix-nTaq (enzynomics) (Korea) Catalogue No.(P510T) ,1 μl of FPLV forward and reverse primers, 1 μl of CPV forward and reverse primers, 3 μl of (100 ng)FPLV gDNA , 3 μl of (100 ng)CPV gDNA and 15 μl of PCR grade water. The PCR thermal profile involved primary denaturation at 94 °C for 5 min, 30 cycles of 94 °C /45 sec, 55 °C /45 sec 70 °C/1min then 72 °C /5 min (Zhang et al. 2019) (Buonavoglia et al. 2001) .A negative reaction with no template DNA was also involved. Amplified PCR products were visualized through 1 % agarose gel electrophoresis using 8 μl of 100 bp DNA Ladder (Thermo Scientific). ...
Feline Panleukopenia virus (FPLV) and Canine Parvovirus type 2 (CPV) cause fatal gastroenteritis in cats and dogs. In this study we developed a duplex polymerase chain reaction (dPCR) assay for the concurrent detection of FPLV and CPV-2 in a single PCR tube. Two primers were used based on nucleic acid conserved regions of the two viruses which specifically amplify 237 bp of the VP2 gene of FPLV and 583 bp of the VP2 gene of CPV 2.Sensitivity and Specificity of the dPCR were evaluated. A total of 30 rectal/fecal swabs were collected from domestic cats in Kafrelsheikh province, Egypt and were tested for FPLV and CPV-2 viruses using the dPCR assay. The results revealed that this dPCR assay was sensitive, as it could detect a minimum of 1 × 105 copies of genomic DNA of the two viruses. The dPCR assay was highly specific as there was no amplification of nucleic acid of other feline and canine pathogens. The positive ratio was 83.3% (25/30) for FPLV and 16.6% (5/30) for CPV respectively. Further analyses of CPV samples by Restriction Fragment Length Polymorphism (RFLP) revealed that they are classified as CPV 2a/2b variants. This study reports the first detection of CPV 2a/2b from symptomatic cats in Egypt using dPCR assay that can detect FPLV and CPV in a single tube reaction.
... There are many types of PCR such as Standard PCR-Variants, Reverse Transcription-PCR (RT-PCR), Real time-PCR or quantitative PCR (qPCR) RT-PCR/qPCR combined etc and out of them qPCR is useful to estimate viral load in clinical samples (Singh et al., 2014) [14] . There are many PCR based diagnostic techniques to diagnose FPV infection in cats such as standard conventional PCR ( 19] and qPCR (Jacobson et al., 2021;Cao et al., 2022) [7,3] . In most PCR techniques VP2 gene was used as target gene for genetic identification of FPV. ...
Feline panleukopenia is one of the deadly enteric viral diseases affecting cats caused by the feline parvovirus. Early diagnosis is the key factor which decides the survivability of the infected cat. This study was designed to standardize and validate TaqMan Real-Time PCR to detect FPV from faecal samples of infected cats. The R 2 value and % E of TaqMan Real-Time qPCR were 0.9707 and 90.8058 per cent respectively. A total of 50 samples, which included 25 conventional PCR positive and 25 conventional PCR negative samples were tested to validate the Real-Time PCR. The sensitivity, specificity, and kappa statistics values of TaqMan Real-Time qPCR were, 100%, 92.59%, and 0.913 respectively. In conclusion, the TaqMan qPCR protocol is highly sensitive, specific, and perfect agreement with conventional PCR.
... Different from conventional PCR, mPCR could amplify multiple target fragments by adding several specific primer pairs into the same reaction system. mPCR has the distinct advantages such as high throughput, high specificity, simple operation, and low cost, and has been widely used to detect viruses (Hao et al. 2019;Zhang et al. 2019), foodborne pathogens (Villamizar-Rodriguez et al. 2015;Wei et al. 2018), meat adulterants (Dantas et al. 2019;Zhao et al. 2021), transgenic crops (Shrestha et al. 2008;Randhawa et al. 2009), and so on. However, the application of mPCR detects harmful algae is still in the infant stage. ...
It is urgent to develop techniques that can simultaneously detect multiple microalgae, due to the diversity of harmful algal blooms (HABs)-forming algal species. The target algae species in this study are Heterosigma akashiwo, Prorocentrum donghaiense and Karenia mikimotoi. These algae are the dominant species that cause HABs in the East China Sea, and the multiple detection technique focusing on these three algae is not common. Therefore, this study established a multiplex polymerase chain reaction(mPCR) to diagnose the three algae, which is simple and low cost. First, the corresponding specific primers were designed based on the D1-D2 region of the large subunit (LSU) ribosomal DNA sequence. Then, mPCR was established and the reaction conditions were optimized. And the specificity, sensitivity, and stability of mPCR were evaluated. The result of specificity test showed that the established mPCR had good specificity for the target microalgae and did not cross-react with eighteen non-target microalgae. The sensitivity of experiment was 3.3 × 10⁻¹ ng μL⁻¹, and the established mPCR was not affected by the interfering microalgae. Moreover, the practicability evaluation of mPCR by using the simulated natural water samples showed that the detection limit of target microalgae was 100 cells mL⁻¹, which could meet the demand for early warning of HABs. In summary, the established mPCR is characterized by strong specificity, good stability, and multiple analysis to detect H. akashiwo, P. donghaiense, and K. mikimotoi.
... In order of sequence read abundance, the findings were as follows: FPV, FKoV, feline bocavirus (FBV), feline astrovirus (FeAstV), canine adenovirus 2 (CAV-2), FCoV, human papillomavirus (HPV), felis catus papillomavirus (FcaPV), canine circovirus (CCV), feline calicivirus, feline torque teno virus, and human gemycircularvirus (HGmV) (Fig. S1). The results showed that FPV, FKoV, FBV, and FeAstV were the four predominant viruses in cat diarrhea feces in Southwest China, in agreement with other regions [5,6]. FPV is the major virus that causes diarrhea in cats, while the role of FKoV, FBV, and FeAstV in cat diarrhea is not clear [5,6]. ...
... The results showed that FPV, FKoV, FBV, and FeAstV were the four predominant viruses in cat diarrhea feces in Southwest China, in agreement with other regions [5,6]. FPV is the major virus that causes diarrhea in cats, while the role of FKoV, FBV, and FeAstV in cat diarrhea is not clear [5,6]. Interestingly, we found CAV-2, CCV, HGmV, and HPV in cat feces, suggesting that these viruses may have potential cross-species transmission between humans, canines, and felines or household environmental contamination due to co-living of viral hosts. ...
Feline viral diarrhea is a significant cause of death in kittens. In this study, 12 mammalian viruses were identified by metagenomic sequencing in diarrheal feces in 2019, 2020, and 2021, respectively. Interestingly, a novel of felis catus papillomavirus (FcaPV) was identified for the first time in China. Subsequently, we investigated the prevalence of FcaPV in 252 feline samples, including 168 diarrheal feces and 84 oral swabs, with a total of 57 (22.62%, 57/252) samples detected positive. Of the 57 positive samples, FcaPV genotype 3 (FcaPV-3) was detected at high prevalence rate (68.42%, 39/57), followed by FcaPV-4 (22.8%, 13/57), FcaPV-2 (17.54%, 10/57), and FcaPV-1 (1.75%, 1/55), while no FcaPV-5 and FcaPV-6. In addition, two novel putative FcaPVs were identified, which were the highest similarity to Lambdapillomavirus from Leopardus wiedii or canis familiaris, respectively. Therefore, this study was the first characterization of the viral diversity in feline diarrheal feces and the prevalence of FcaPV in Southwest China.
... Due to the complexity of pathogens associated with feline respiratory and intestinal tracts, rapid diagnosis and detection of these pathogens are important for disease prevention, epidemiological investigation and clinical treatment. Although there are many multiplex polymerase chain reaction (mPCR) methods for feline intestinal and respiratory pathogens, most of these methods can detect only between approximately two and four pathogens, and emerging pathogens are not covered [23][24][25][26]. To provide strong support tools for the rapid diagnosis and epidemiology of sick cats, in this study, the current mPCR method is improved, and two new mPCRs are established to simultaneously detect five types of pathogens associated with feline respiratory (PAFR, namely, FCV, FHV-1, FeLV, C. felis and IAV) and four types of pathogens associated with intestinal tracts (PAIT, namely, FCoV, FeAstV, FPV and FeKoV). ...
Respiratory tract and intestinal diseases are common threats to feline health. Coinfection with multiple pathogens is not rare among clinical infectious cases. Rapid diagnosis of these coinfections is of great significance for timely and effective clinical treatment. In this study, two novel multiplex polymerase chain reactions (mPCRs) were established for simultaneous detection of four pathogens associated with the feline intestinal tract (feline coronavirus (FCoV), feline astrovirus (FeAstV), feline panleukopenia virus (FPV) and feline kobuvirus (FeKoV)) and five pathogens associated with the respiratory tract (feline calicivirus (FCV), feline herpesvirus 1 (FHV-1), feline leukemia virus (FeLV), Chlamydia felis (C. felis) and influenza A virus (IAV)). The results of sensitivity analysis revealed that the detection limits for FeKoV, FPV, FeAstV, FCoV, IAV, C. felis, FeLV, FHV-1 and FCV were 103, 104, 103, 103, 103, 104, 104, 105 and 105 copies/µL, respectively. Moreover, the specificity of the two mPCRs was high. When the two mPCRs were applied to clinical samples, the assay worked well. In conclusion, we established two mPCR methods that provide an excellent tool for the diagnosis and monitoring of pathogens associated with the feline respiratory and intestinal tracts.
