Figure 6 - available via license: Creative Commons Attribution-NonCommercial 3.0 Unported
Content may be subject to copyright.
Polymerase-based fluorescent labeling strategies for nucleic acids. A) Direct enzymatic incorporation of fluorescent nucleotides. B) Two-step labeling approach. Enzymatic incorporation of a functional group for subsequent fluorescent labeling via click chemistry. Templates for polymerases are omitted.
Source publication
Labeling of nucleic acids is required for many studies aiming to elucidate their functions and dynamics in vitro and in cells. Out of the numerous labeling concepts that have been devised, covalent labeling provides the most stable linkage, an unrivaled choice of small and highly fluorescent labels and – thanks to recent advances in click chemistry...
Contexts in source publication
Context 1
... well tolerated by polymerases. 102 For a detailed overview how modified nucleotide analogs are incorporated into nascent DNA, we recommend the review from Hottin et al. 17 In this sub-chapter, we will elaborate on polymerase-based labeling strategies to directly incorporate fluorescent reporters into nucleic acids -a co-synthetic approach (Fig. 6A). In 2001, for the first time, the replacement of the complete set of dNTPs by analogs labeled with different fluorophores was reported. This primer extension synthesized DNA of up to 40 basepairs. Modified dUTPs bearing a coumarin or a fluorescein residue at the C5-position were successfully incorporated by three different DNA ...
Context 2
... Polymerase-based two-step labeling-This chapter focuses on the polymerase-based incorporation of modified nucleotides bearing a reactive handle for subsequent conjugation to a fluorescent reporter molecule (Fig. 6B). This approach has a broad scope since many polymerases accept (d)NTP analogs with small modifications that can be selectively converted using click chemistry. 119 Up to now, many functional groups of different sizes and reactivities have been co-synthetically incorporated into DNA and RNA (Fig. ...
Citations
... Here, we overview the latest developments and most essential steps in designing live-cell imaging techniques to visualize nucleic acids. Although there are already reviews addressing the general topic, [1][2][3][4] we want to highlight how this research area emerged and developed to put forth the first few methods for metabolic labeling of nucleic acids entirely compatible with studies in living cells. ...
Metabolic labeling of nucleic acids and live‐cell imaging are powerful tools of increasing interest for understanding the mechanisms involved in DNA‐ or RNA‐related biological processes such as replication or interactions between viral nucleic acids and host factors. Recent advances in these techniques will be summarized, particularly highlighting the fluorescence‐based development of approaches compatible with living systems. image
... In this context, numerous environmentally sensitive unnatural fluorescent nucleosides have been developed to fluorescently label nucleic acids via binding, intercalation, or covalent bonds [13,14]. The design of fluorescent nucleosides is a great challenge and has stimulated much research in various fields of photophysics, synthetic chemistry, and computational studies. ...
... (m, 9H). 13 ...
... M pure = 2.7 g. Yield: quantitative. 1 (s, 3H, H 6 ′ , dia 2), −0.14 (s, 3H H 6 ′ , dia 1), −0.16 (s, 3H, H 6 ′ , dia 2). 13 C NMR (101 MHz, CDCl 3 ) δ 156.3 (C 1 , dia 1 or dia 2), 156.3 (C 1 , dia 1 or dia 2), 149.8 (C 5 , dia 1 or dia 2), 149.8 (C 5 , dia 1 or dia 2), 144.6 (C 9 , dia 1 or dia 2), 144.6 (C 9 , dia 1 or dia 2), 138.8 (C 3 , dia 1 or dia 2), 138.7 (C 3 , dia 1 or dia 2), 136.0 (C 17 , dia 1 or dia 2), 136.0 (C 17 , dia 1 or dia 2), 130.1 (C 2 , dia 1 or dia 2), 130.1 (C 2 , dia 1 or dia 2), 128.8 (C 12,16 or C 13,15 , dia 1 or dia 2), 128.7 (C 12,16 or C 13,15 , dia 1 or dia 2), 128.7 (C 12,16 or C 13,15 , dia 1 or dia 2), 127.8 (C 12,16 or C 13,15 , dia 1 or dia 2), 127.8 (C 14 , dia 1 or dia 2), 127.8 (C 14 , dia 1 or dia 2), 123.0 (C 4 , dia 1 or dia 2), 122.9 (C 4 , dia 1 or dia 2), 122.6 (C 10 , dia 1 or dia 2), 122.6 (C 10 , dia 1 or dia 2), 120.3 (CN, dia 1 or dia 2), 120.2 (CN, dia 1 or dia 2), 103.2 (C 6 , dia 1 or dia 2), 103.2 (C 6 , dia 1 or dia 2), 92.9 (C 1 ′ , dia 1 or dia 2), 92.8 (C 1 ′ , dia 1 or dia 2), 86.8 (C 4 ′ , dia 1 or dia 2), 86.6 (C 4 ′ , dia 1 or dia 2), 77.2 (C 2 ′ , dia 1 or dia 2), 77.2 (C 2 ′ , dia 1 or dia 2), 72.6 (C 3 ′ , dia 1 or dia 2), 72.4 (C 3 ′ , dia 1 or dia 2), 62.9 (C 5 ′ , dia 1 or dia 2), 62.8 (C 5 ′ , dia 1 or dia 2), 56.3 (C 7 or C 8 , dia 1 or dia 2), 56.2 (C 7 or C 8 , dia 1 or dia 2), 55.9 (C 7 or C 8 , dia 1 or dia 2), 55.9 (C 7 or C 8 , dia 1 or dia 2), 41.6 (C 11 , dia 1 or dia 2), 41.5 (C 11 , dia 1 or dia 2), 26.1 (3C 7 ′ , dia 1 or dia 2), 26.1 (3C 7 ′ , dia 1 or dia 2), 25.9 (3C 7 ′ , dia 1 or dia 2), 25.9 (3C 7 ′ , dia 1 or dia 2), 25.9 (3C 7 ′ , dia 1 or dia 2), 25.9 (3C 7 ′ , dia 1 or dia 2), 18.1 (3C 8 ′ , dia 1 or dia 2), 18.1 (3C 8 ′ , dia 1 or dia 2), −4.3 (2C 6 ′ , dia 1 or dia 2), −4.3 (2C 6 ′ , dia 1 or dia 2), −4.5 (2C 6 ′ , dia 1 or dia 2), −4.5 (2C 6 ′ , dia 1 or dia 2), −5.0 (2C 6 ′ , dia 1 or dia 2), −5.0 (2C 6 ′ , dia 1 or dia 2). IR (cm Under inert condition, in a sealed tube, sodium hydride (3 equiv., 60% in oil) was added to a stirred solution of compound 14 (295 mg, 0.4 mmol) in dry THF (0.2 M). 4-methoxyphenylacetonitrile (108.5 µL, 0.80 mmol) was added in one portion, and the reaction mixture was refluxed for 48 h. ...
In this article, we present the synthesis and the optical properties of three original molecules as potential fluorescent ribonucleoside analogues incorporating a 1,6-naphthyridin-7(6H)-one scaffold as a fluorescent nucleobase and a 1,2,3-triazole as a linkage. The nucleosides were prepared via a Cu alkyne-azide cycloaddition (CuAAC) reaction between a ribofuranosyl azide and a 4-ethynylpyridine partner. Construction of substituted 1,6-naphthyridin-7(6H)-ones was achieved through two additional steps. Optical property studies were investigated on nucleoside analogues. Powerful fluorescence properties have been evidenced with a remarkable change of emissivity depending on the polarity of the solvent, making these molecules suitable as a new class of artificial fluorescent nucleosides for investigating enzyme binding sites as well as probing nucleic acids. In addition, we are convinced that such analogues could be of great interest in the search for new antiviral or antitumoral drugs based on nucleosides.
... S it e-sp ec ific chemical modification methods that enable precise postsynthetic or post-transcriptional functionalization of RNA provide robust means to probe and manipulate RNA functions in vitro and in cells 1,2 . Chemoenzymatic strategies with repurposed methyltransferase (MTase) protein enzymes and S-adenosylmethionine (SAM or AdoMet) derivatives have emerged as powerful methods for targeted RNA modification [3][4][5][6] . ...
Post-transcriptional RNA modification methods are in high demand for site-specific RNA labelling and analysis of RNA functions. In vitro-selected ribozymes are attractive tools for RNA research and have the potential to overcome some of the limitations of chemoenzymatic approaches with repurposed methyltransferases. Here we report an alkyltransferase ribozyme that uses a synthetic, stabilized S-adenosylmethionine (SAM) analogue and catalyses the transfer of a propargyl group to a specific adenosine in the target RNA. Almost quantitative conversion was achieved within 1 h under a wide range of reaction conditions in vitro, including physiological magnesium ion concentrations. A genetically encoded version of the SAM analogue-utilizing ribozyme (SAMURI) was expressed in HEK293T cells, and intracellular propargylation of the target adenosine was confirmed by specific fluorescent labelling. SAMURI is a general tool for the site-specific installation of the smallest tag for azide-alkyne click chemistry, which can be further functionalized with fluorophores, affinity tags or other functional probes.
... The fluorescently-labeled DNA is widely used in various bioanalytical applications [1][2][3]. While DNA molecules bearing a single fluorescent tag are mostly employed, the multiple fluorescent labeling can be beneficial since it can enhance the detection sensitivity by increasing a signal-to-noise ratio. ...
... While DNA molecules bearing a single fluorescent tag are mostly employed, the multiple fluorescent labeling can be beneficial since it can enhance the detection sensitivity by increasing a signal-to-noise ratio. Short DNA fragments varying in a degree of labeling can be easily produced during the automated solid-phase chemical synthesis or postsynthetically, whereas the multiple labeling of long DNA fragments is commonly achieved via enzymatic synthesis employing fluorescently labeled nucleoside triphosphates [2]. However, the incorporation of nucleobase-modified nucleotides by DNA polymerases is considerably less effective than that of natural ones, even in the case of primer extension (PEX) on an unmodified DNA template [4]. ...
... Primer name Primer sequence Primer name Primer sequence F gctggccagtttgctacctt R acctccttcagtgcgaatcat F* (1) gct*ggccagt*t*t*gct*acct*t* R* (1) acct*cct*t*cagt*gcgaat*cat* F* (2) gct*ggccagt*t*t*gct*acct*t R* (4) acct*cct*t*cagt*gcgaat*cat F* (6) gct*ggccagt*t*t*gct*acctt -- can be responsible for a block of DNA amplification. Indeed, the presence of a bulky moiety attached to the 3'-nucleotide of primer can potentially create a steric hindrance for polymerase binding at the primer-template junction thus hindering DNA polymerization. ...
The fluorescently-labeled DNA is widely used in various bioanalytical applications. For a number of applications, a high level of labeling could be beneficial. One of the ways to produce DNA fragments bearing multiple fluorescent tags is to use polymerase chain reaction (PCR) with primers heavily labeled with fluorophores. Here we tested how primers with multiple fluorescein tags perform in PCR. It has been found that the positioning of fluorescein tags at or near the 3'-end upon primer multiple labeling can inhibit DNA amplification (up to a complete stop when tags are placed at the 3'- or adjacent nucleotide). The mechanism, by which the presence of fluorescein tags at or near the primer 3'-end affects the PCR performance, is rather ambiguous and can involve both a steric hindrance for polymerase binding from the fluorescein moiety, as well as destabilization of a primer-template duplex. Nonetheless, if multiple fluorescein tags are attached so that at least three nucleotides from the primer 3'-end are unmodified, the production of DNA fragments bearing multiple fluorescein molecules is possible even if both primers are heavily labeled, though on the expense of amplicon yield.
... Recently, fluorescent nucleobase probes have been developed for the direct analysis of nucleic-acid related biochemical processes. [18][19][20][21] Herein, we describe an efficient and selective fluorogenic probe for TdT activity that allows for rapid and real-time measurement of DNA primer extension and de novo DNA synthesis by TdT. The intact probe exhibits 63-fold lower fluorescence than the sizeexpanded nucleobase enabling monitoring of TdT activity in vitro and in Human T Cell Leukemia extract and cells. ...
Terminal deoxynucleotidyl Transferase (TdT) is a template‐independent DNA polymerase that plays an essential role in the human adaptive immune system and is upregulated in several types of leukemia. It has therefore gained interest as a leukemia biomarker and potential therapeutic target. Herein, we describe a FRET‐quenched fluorogenic probe based on a size‐expanded deoxyadenosine that reports directly on TdT enzymatic activity. The probe enables real‐time detection of primer extension and de novo synthesis activity of TdT and displays selectivity over other polymerase and phosphatase enzymes. Importantly, TdT activity and its response to treatment with a promiscuous polymerase inhibitor could be monitored in human T‐lymphocyte cell extract and Jurkat cells using a simple fluorescence assay. Finally, employing the probe in a high‐throughput assay resulted in the identification of a non‐nucleoside TdT inhibitor.
... In the past decade, numerous approaches have been explored to impart endogenous stimuli-responsive behaviors to nucleic acid constructs for conditional control their structures and functions. [28][29][30] For example, enzyme-responsive activation of DNA sensor activities was developed based on the incorporation of specific chemical modifications. 20,31,32 ATP-or/and pH-activated DNA computation circuits were reported for subcellular mRNA imaging. ...
... [9] Fully functionalized small molecule probes containing an alkyne handle and a photo reactive group linked or embedded in a bioactive scaffold have been developed for integrated phenotypic screening and target identification. [10] With intense research interest on the development of more bio-orthogonal reactions for chemical biological applications, [11] the incorporation of bioorthogonal groups in small-molecule regulators of miRNA holds the promise to elucidate the complex miRNA-involved regulatory network inside cells. ...
By virtue of their key roles in pathologies, miRNAs represent a promising class of therapeutic targets. While high‐fidelity small‐molecule modulators of miRNAs can be identified via high‐throughput screening using cellular reporter systems, their modes of action are elusive due to the lack of proper tools. Here, we report a small‐molecule probe, 1 a, that is capable of elucidating its biological target along miRNA inhibition. Derived from norathyriol, a nature product, 1 a possessed a bioorthogonal alkyne moiety for subsequent labeling via copper‐catalyzed azide‐alkyne cycloaddition chemistry. We demonstrated that 1 a inhibited a panel of different miRNAs by blocking their loading onto argonaute 2 (AGO2), which is the key protein responsible for miRNA function. With the alkyne handle, we successfully identified AGO2 as an intracellular target of 1 a. Therefore, this work presents a novel small‐molecule tool for suppressing and probing miRNA regulatory pathways.
... 1a). These nucleosides accumulate inside cells over time and enter nucleotide salvage pathways for conversion into the transcription-active nucleotide triphosphates [33][34][35][36] . The respective nucleoside analogues include 5-bromouridine (5BrU), 5-ethynyluridine (5EU), 5-ethynylcytidine (5EC) 37,38 , 4-thiouridine (4sU) 6,10,12 , 6-thioguanosine (6sG) 28 , vinyl nucleosides (5-vinyluridine (5VU), 5-vinylcytidine (5VC), 2-vinyladenosine (2VA), 8-vinylguanosine (8VG)) 39 , 2′-azidocytidine, 2′-azidouridine, 2′-azidoadenosine and 2′-azidoguanosine (2′AzC, 2′AzU, 2′AzA, 2′AzG) [40][41][42] and N 6 -cyclopropene-modified adenosine (cpA) 43 . ...
Single-cell RNA genomics technologies are revolutionizing biomedical science by profiling single cells with unprecedented resolution, providing fundamental insights into the role of different cellular states and intercellular heterogeneity in health and disease. The combination of single-cell RNA sequencing (scRNA-seq) with metabolic RNA labelling approaches now enables time-resolved monitoring of transcriptional responses for thousands of genes in thousands of individual cells in parallel. This facilitates and accelerates direct characterization of the temporal dimension of biological processes, which has been largely missing in current data. In this Primer, we provide an overview of the various metabolic RNA labelling approaches and their combination with currently available scRNA-seq and multi-omics platforms. We summarize the main challenges in the design of such experiments and discuss the various applications of time-resolved scRNA-seq in vitro and in vivo. We outline the computational tools and challenges to the analyses of the temporal dynamics of transcriptional responses at the single-cell level. We discuss the prospect of integrating data obtained by the respective time-resolved scRNA-seq approaches with complementary methods to elucidate gene regulatory networks that underlie molecular mechanisms. Finally, we discuss open questions and challenges in the field and give our thoughts for future development and applications. The combination of single-cell RNA sequencing with metabolic RNA labelling enables a time-resolved view of transcriptional responses in individual cells. In this Primer, Erhard and Saliba et al. discuss metabolic labelling approaches and how to assess the temporal dynamics of transcriptional responses in different conditions.
... Fluorescence offers high sensitivity, with single-molecule detection possible for brightly labeled analytes, and many wavelength options confer broad utility. While non-covalent dyes that associate with DNAs have proven useful for in vitro applications such as real-time PCR, covalent attachment enables greater specificity by localizing fluorescence to one species 1 . In addition, covalent labeling offers multiplexing capabilities as well as in vivo imaging 2 . ...
... As a result of this broad utility, many methods for covalent labeling of DNA have been developed 1,5 , and are classified broadly into strategies for direct incorporation of fluorophores into DNA during chemical or enzymatic DNA synthesis (co-synthetic labeling), or post-synthetic DNA labeling by forming bonds with reactive groups (such as amine groups) that have been incorporated beforehand. Direct incorporation during chemical synthesis of oligodeoxynucleotides (ODNs) with fluorophore-conjugated phosphoramidite reagents offers high yields and precise positioning, but these are notably unstable and costly compounds, and their use is limited to DNAs shorter than ∼200 nt and to laboratories with oligonucleotide synthesis capabilities. ...
... Post-synthetic labeling of fluorophores can bypass the limitations of enzyme-substrate tolerance by allowing one to use modified nucleotides containing smaller reactive handles (such as azide and alkyne) as substrates for polymerases 1 . Additional promising strategies for post-synthetic labeling involve the use of DNA methyltransferases and β-glucosyltransferase with modified Sadenosyl methionine cofactors as a fluorophore donors 5 . ...
Fluorescence labeling of DNAs is broadly useful, but methods for labeling are expensive and labor-intensive. Here we describe a general method for fluorescence labeling of oligonucleotides readily and cost-efficiently via base excision trapping (BETr), employing deaminated DNA bases to mark label positions, which are excised by base excision repair enzymes generating AP sites. Specially designed aminooxy-substituted rotor dyes trap the AP sites, yielding high emission intensities. BETr is orthogonal to DNA synthesis by polymerases, enabling multi-uracil incorporation into an amplicon and in situ BETr labeling without washing. BETr also enables labeling of dsDNA such as genomic DNA at a high labeling density in a single tube by use of nick translation. Use of two different deaminated bases facilitates two-color site-specific labeling. Use of a multi-labeled DNA construct as a bright fluorescence tag is demonstrated through the conjugation to an antibody for imaging proteins. Finally, double-strand selectivity of a repair enzyme is harnessed in sensitive reporting on the presence of a target DNA or RNA in a mixture with isothermal turnover and single nucleotide specificity. Overall, the results document a convenient and versatile method for general fluorescence labeling of DNAs.
... They can be covalently attached to the base, sugar, or the phosphates of nucleotides. [39][40][41][42] Although longliving under air and in neutral aqueous buffer, reaction conditions typical for the solid-phase synthesis of oligonucleotides and for enzymatic ligation steps are known to cause partial decomposition of nitroxides. Accordingly, spin labels are introduced after chain assembly in many cases and even noncovalent attachment is often used. ...
The nitroxide TPA (2,2,5,5‐tetramethyl‐pyrrolin‐1‐oxyl‐3‐acetylene) is an excellent spin label for EPR studies of RNA. Previous synthetic methods, however, are complicated and require special equipment. Herein, we describe a uridine derived phosphoramidite with a photocaged TPA unit attached. The light sensitive 2‐nitrobenzyloxymethyl group can be removed in high yield by short irradiation at 365 nm. Based on this approach, a doubly spin‐labeled 27mer neomycin sensing riboswitch was synthesized and studied by PELDOR. The overall thermal stability of the fold is not much reduced by TPA. In‐line probing nevertheless detected changes in local mobility.
