Figure - available from: Journal of Extracellular Vesicles
This content is subject to copyright. Terms and conditions apply.
P16 fraction analysis. (a) Visualization of nanosized objects in P16 fraction and control PBS buffer using low‐voltage scanning electron microscopy (LVSEM). Arrowheads and arrows indicate nanosized near‐spherical objects in P16 fraction. (b) Immunoblotting based detection of CD9, Mitofusin2 and Ago2 proteins in platelet‐depleted plasma and its fractions S16 and P16.
Source publication
The aim of this study was to investigate cell source-dependent nucleic acids repertoire of diverse subpopulations of plasma extracellular vesicles (EVs). Blood plasma from nine healthy volunteers was used for the analysis. Samples of EVs were obtained by differential centrifugation of plasma. The application of high-sensitivity fluorescence-activat...
Citations
... How many miRNA can fit in a single EV, taking into account the inner vesicle space and outer membrane surface? Previously, we theoretically calculated the possible number of miRNAs packed inside a single vesicle [18]. Assuming that miRNAs inside the vesicle is presented as a protein complex [48], we can approximate it as a sphere with diameter equal to miRNA length. ...
... In the case of random packing, the density is 64% of the filled volume [61]. Thus, the available volume of the 100 nm vesicle is equal to ~244,000 nm 3 and its capacity is more than 1000 miRNAprotein complexes [18]. In these calculations, we ignore that vesicles are fitted not only with miRNA. ...
... Nevertheless, we can think of the number of molecules that are potentially transported inside a single EV. In addition, previously, we experimentally demonstrated that the number of miR-223-3p and miR199a-3p in the CD41+CD235a− EV was 38.2 and 2.8 molecules per event, respectively, whereas the numbers of miR-451a in the CD41-CD235a+ EVs and in the CD41-CD235a dim EVs were 24.7 and 3.2 molecules per event, respectively [18]. ...
There are many articles on the quantitative analysis of miRNAs contained in a population of EVs of different sizes under various physiological and pathological conditions. For such analysis, it is important to correctly quantify the miRNA contents of EVs. It should be considered that quantification is skewed depending on the isolation protocol, and different miRNAs are degraded by nucleases with different efficiencies. In addition, it is important to consider the contribution of miRNAs coprecipitating with the EVs population, because the amount of miRNAs in the EVs population under study is skewed without appropriate enzymatic treatment. By studying a population of EVs from the blood plasma of healthy donors, we found that the absolute amount of miRNA inside the vesicles is commensurate with the amount of the same type of miRNA adhered to the outside of the EVs. The inside/outside ratio ranged from 1.02 to 2.64 for different investigated miRNAs. According to our results, we propose the hypothesis that high occupancy of miRNAs on the outer surface of EVs influence on the transporting RNA repertoire no less than the inner cargo received from the host cell.
... The phenotyping of circulated extracellular vesicles was performed according to the official recommendations from the International Society for Extracellular Vesicles [100][101][102] and previously described and experimentally approved by our group [103][104][105]. ...
The process of aging is accompanied by a dynamic restructuring of the immune response, a phenomenon known as immunosenescence. Further, damage to the endothelium can be both a cause and a consequence of many diseases, especially in elderly people. The purpose of this study was to carry out immunological and biochemical profiling of elderly people with acute ischemic stroke (AIS), chronic cerebral circulation insufficiency (CCCI), prediabetes or newly diagnosed type II diabetes mellitus (DM), and subcortical ischemic vascular dementia (SIVD). Socio-demographic, lifestyle, and cognitive data were obtained. Biochemical, hematological, and immunological analyses were carried out, and extracellular vesicles (EVs) with endothelial CD markers were assessed. The greatest number of significant deviations from conditionally healthy donors (HDs) of the same age were registered in the SIVD group, a total of 20, of which 12 were specific and six were non-specific but with maximal differences (as compared to the other three groups) from the HDs group. The non-specific deviations were for the MOCA (Montreal Cognitive Impairment Scale), the MMSE (Mini Mental State Examination) and life satisfaction self-assessment scores, a decrease of albumin levels, and ADAMTS13 (a Disintegrin and Metalloproteinase with a Thrombospondin Type 1 motif, member 13) activity, and an increase of the VWF (von Willebrand factor) level. Considering the significant changes in immunological parameters (mostly Th17-like cells) and endothelial CD markers (CD144 and CD34), vascular repair was impaired to the greatest extent in the DM group. The AIS patients showed 12 significant deviations from the HD controls, including three specific to this group. These were high NEFAs (non-esterified fatty acids) and CD31 and CD147 markers of EVs. The lowest number of deviations were registered in the CCCI group, nine in total. There were significant changes from the HD controls with no specifics to this group, and just one non-specific with a maximal difference from the control parameters, which was α1-AGP (alpha 1 acid glycoprotein, orosomucoid). Besides the DM patients, impairments of vascular repair were also registered in the CCCI and AIS patients, with a complete absence of such in patients with dementia (SIVD group). On the other hand, microvascular damage seemed to be maximal in the latter group, considering the biochemical indicators VWF and ADAMTS13. In the DM patients, a maximum immune response was registered, mainly with Th17-like cells. In the CCCI group, the reaction was not as pronounced compared to other groups of patients, which may indicate the initial stages and/or compensatory nature of organic changes (remodeling). At the same time, immunological and biochemical deviations in SIVD patients indicated a persistent remodeling in microvessels, chronic inflammation, and a significant decrease in the anabolic function of the liver and other tissues. The data obtained support two interrelated assumptions. Taking into account the primary biochemical factors that trigger the pathological processes associated with vascular pathology and related diseases, the first assumption is that purine degradation in skeletal muscle may be a major factor in the production of uric acid, followed by its production by non-muscle cells, the main of which are endothelial cells. Another assumption is that therapeutic factors that increase the levels of endothelial progenitor cells may have a therapeutic effect in reducing the risk of cerebrovascular disease and related neurodegenerative diseases.
... In fact, most conventional flow cytometers are unable to detect and immunophenotype the vast majority of EVs because the reduced surface area of EVs results in low expression of surface proteins that can be masked by background noise [39,41]. The Cytoflex S flow cytometer used in this study has been shown to be useful for EV analysis [13,[42][43][44][45] and has been successfully used for surface protein identification on porcine sEVs [24,[46][47][48]. ...
Background
Porcine seminal plasma (SP) is endowed with a heterogeneous population of extracellular vesicles (sEVs). This study evaluated the immunophenotypic profile by high-sensitivity flow cytometry of eight sEV subpopulations isolated according to their size (small [S-sEVs] and large [L-sEVs]) from four different SP sources, namely three ejaculate fractions (the first 10 mL of the sperm rich fraction [SRF-P1], the remaining SRF [SRF-P2], and the post-SRF [PSRF]) and entire ejaculate (EE).
Methods
Seminal EVs were isolated using a size exclusion chromatography-based protocol from six SP pools (five ejaculates/pool) of each SP source and characterized using complementary approaches including total protein (BCA™assay), particle size distribution (dynamic light scattering), morphology (transmission electron microscopy), and purity (albumin by Western blot). Expression of CD9, CD63, CD81, CD44 and HSP90β was analyzed in all sEV subpopulations by high-sensitivity flow cytometry according to MIFlowCyt-EV guidelines, including an accurate calibration, controls, and discrimination by CFSE-labelling.
Results
Each sEV subpopulation exhibited a specific immunophenotypic profile. The percentage of sEVs positive for CD9, CD63, CD81 and HSP90β differed between S- and L-sEVs ( P < 0.0001). Specifically, the percentage of sEVs positive for CD9 and CD63 was higher and that for CD81 was lower in S- than L-sEVs in the four SP sources. However, the percentage of HSP90β-positive sEVs was lower in S-sEVs than L-sEVs in the SRF-P1 and EE samples. The percentage of sEVs positive for CD9, CD63, and CD44 also differed among the four SP sources ( P < 0.0001), being highest in PSRF samples. Notably, virtually all sEV subpopulations expressed CD44 (range: 88.04–98.50%).
Conclusions
This study demonstrated the utility of high-sensitivity flow cytometry for sEV immunophenotyping, allowing the identification of distinct sEV subpopulations that may have different cellular origin, cargo, functions, and target cells.
... Levels of cgr-miR-92a-3p, cgr-miR-23a-3p, cgr-miR-21-5p, cgr-miR-25-3p, and mmu-let-7c-5p were assessed in both CHO EVs and CHO cells on Days 1, 3, 6, and 9 of culture. Highly sensitive TaqMan assays combined with spike-in control cel-miR-39-3p enabled the calculation of miR copy number per EV via the ∆∆ 2 C − t method (Livak & Schmittgen, 2001), which is an increasingly popular method for EV miR cargo quantification (Kondratov et al., 2020;Perge et al., 2017). It should be noted that EV count is dependent on the method of counting (e.g., nanoparticle tracking analysis [NTA] or flow cytometry). ...
... Previous investigations of EVs from other cell types have found abundant miR species to exist in EVs at anywhere from 1 copy per 10-100 EVs (Chevillet et al., 2014;Wei et al., 2017) to 10-100 copies per 1 EV (Kondratov et al., 2020;Stevanato et al., 2016). The individual miR copy numbers (per EV) identified in this study fit quite reasonably within these ranges, with especially notable expression (>100 copies) of miR-92a per EV observed in two samples. ...
Chinese hamster ovary (CHO) cells release and exchange large quantities of extracellular vesicles (EVs). EVs are highly enriched in microRNAs (miRs, or miRNAs), which are responsible for most of their biological effects. We have recently shown that the miR content of CHO EVs varies significantly under culture stress conditions. Here, we provide a novel stoichiometric (“per‐EV”) quantification of miR and protein levels in large CHO EVs produced under ammonia, lactate, osmotic, and age‐related stress. Each stress resulted in distinct EV miR levels, with selective miR loading by parent cells. Our data provide a proof of concept for the use of CHO EV cargo as a diagnostic tool for identifying culture stress. We also tested the impact of three select miRs (let‐7a, miR‐21, and miR‐92a) on CHO cell growth and viability. Let‐7a—abundant in CHO EVs from stressed cultures—reduced CHO cell viability, while miR‐92a—abundant in CHO EVs from unstressed cultures—promoted cell survival. Overexpression of miR‐21 had a slight detrimental impact on CHO cell growth and viability during late exponential‐phase culture, an unexpected result based on the reported antiapoptotic role of miR‐21 in other mammalian cell lines. These findings provide novel relationships between CHO EV cargo and cell phenotype, suggesting that CHO EVs may exert both pro‐ and antiapoptotic effects on target cells, depending on the conditions under which they were produced.
... 127 In addition, the development of high sensitivity FAVS (hs-FAVS), which yields purified EVs in sufficient quantities, enables further comprehensive profiling of nucleic acid or proteomic characteristics of distinct EV subpopulations. 110,128 Recently, nano-flow cytometry (nFCM) has improved the sensitivity and resolution of side scattering and fluorescence detection of nanoparticles by reducing the probe size and extending the transit time of individual particles in the focused laser beam. 129,130 The highly sensitive multicolor and multiplex platform has offered valuable insights into high throughput quantitative and qualitative mapping of the highly diverse distribution of biological molecules on EVs at the single vesicle resolution. ...
Extracellular vesicles (EVs) are extensively dispersed lipid bilayer membrane vesicles involved in the delivery and transportation of molecular payloads to certain cell types to facilitate intercellular interactions. Their significant roles in physiological and pathological processes make EVs outstanding biomarkers for disease diagnosis and treatment monitoring as well as ideal candidates for drug delivery. Nevertheless, differences in the biogenesis processes among EV subpopulations have led to a diversity of biophysical characteristics and molecular cargos. Additionally, the prevalent heterogeneity of EVs has been found to substantially hamper the sensitivity and accuracy of disease diagnosis and therapeutic monitoring, thus impeding the advancement of clinical applications. In recent years, the evolution of single EV (SEV) analysis has enabled an in-depth comprehension of the physical properties, molecular composition, and biological roles of EVs at the individual vesicle level. This review examines the sample acquisition tactics prior to SEV analysis, i.e., EV isolation techniques, and outlines the current state-of-the-art label-free and label-based technologies for SEV identification. Furthermore, the challenges and prospects of biomedical applications based on SEV analysis are systematically discussed.
... 63 One paper of particular note analyzed only large EV fractions (i.e., MPs sorted using flow cytometry) and identified 25-35 copies of abundant miRNA species in each particle. 36 A rough approximation of volume in a 100 nm EV also suggests capacity for up to 1000 miRNA-protein complexes. 36 While our flow cytometry-based MkEV counts suggest miRNA levels similar to these higher values, our NTA-based MkEV counts reflect much lower miRNA levels. ...
... 36 A rough approximation of volume in a 100 nm EV also suggests capacity for up to 1000 miRNA-protein complexes. 36 While our flow cytometry-based MkEV counts suggest miRNA levels similar to these higher values, our NTA-based MkEV counts reflect much lower miRNA levels. The reality is probably somewhere in the middle. ...
Megakaryocytic extracellular vesicles (MkEVs) promote the growth and megakaryopoiesis of hematopoietic stem and progenitor cells (HSPCs) largely through endogenous miR‐486‐5p and miR‐22‐3p cargo. Here, we examine the impact of biomechanical force and culture age/differentiation on the formation, properties, and biological efficacy of MkEVs. We applied biomechanical force to Mks using two methods: shake flask cultures and a syringe pump system. Force increased MkEV production in a magnitude‐dependent manner, with similar trends emerging regardless of whether flow cytometry or nanoparticle tracking analysis was used for MkEV counting. Both methods produced MkEVs that were relatively depleted of miR‐486‐5p and miR‐22‐3p cargo. However, while the shake flask‐derived MkEVs were correspondingly less effective in promoting megakaryocytic differentiation of HSPCs, the syringe pump‐derived MkEVs were more effective in doing so, suggesting the presence of unique, unidentified miRNA cargo components. Higher numbers of MkEVs were also produced by “older” Mk cultures, though miRNA cargo levels and MkEV bioactivity were unaffected by culture age. A reduction in MkEV production by Mks derived from late‐differentiating HSPCs was also noted. Taken together, our results demonstrate that biomechanical force has an underappreciated and deeply influential role in MkEV biology, though that role may vary significantly depending on the nature of the force. Given the ubiquity of biomechanical force in vivo and in biomanufacturing, this phenomenon must be grappled with before MkEVs can attain clinical relevance.
... Increasing researches have demonstrated that varied microRNAs (miRNAs) are in great abundance in malignant tumors-derived exosomes [8][9][10]. For instance, exosomal miRNA-21 (miR-21) has been reported as an oncogene and anti-apoptotic indicator for various cancer cells [11] and is widely involved in tumor growth and metastasis [12,13]. Consequently, tumor-derived exosomes possess unique miRNA profiles that could be exploited as prominent clues for tracking their original cells [14]. ...
Accurate determination of single exosomal inclusions in situ presents a significant challenge due to their extremely low abundance as well sub-100 nm vesicle dimensions. Here, we created a Liposome Fusogenic Enzyme-free circuit (LIFE) approach for the high-fidelity identification of exosome-encapsulated cargoes without destroying the vesicle integrity. The probe-loaded cationic fusogenic liposome could capture and fuse with a single target exosome, enabling probes delivery and target biomolecule-initiated cascaded signal amplification in situ. Then the DNAzyme probe encountered conformal change upon exosomal microRNA activation, and generated a convex DNAzyme structure to cleave the RNA site of substrate probe. After that, the target microRNA could be released to introduce a cleavage cycle to yield amplified fluorescence readout. Therefore, trace cargoes in a single exosome could be accurately determined by elaborately controlling the ratio of introduced LIFE probe, paving the way toward the exploration of a universal sensing platform for the assessment of exosomal cargoes to facilitate early disease diagnosis and personalized treatment.
... EVs are released by erythrocytes, endothelial cells, leucocytes, and platelets [24] as fragments of a submicron size following activation or apoptosis. EVs contribute to intercellular communication, inflammation, and coagulation processes [25][26][27][28][29][30][31][32]. The increased concentrations of plasma EVs were postulated to reflect cells' activations and to be associated with an increased risk of cardiovascular complications, including acute myocardial infarction or stroke [33]. ...
Mechanical circulatory support (MCS) allows for functional left and right heart ventricle replacement. MCS induces a systemic inflammatory reaction and prothrombotic state leading to an increased risk of thrombus formation. The extracellular vesicles (EVs) are nanoparticles released from active/injured cells characterized by prothrombotic properties. Simple inflammatory parameters from whole blood count analysis have established a clinical role in everyday practice to describe immune-inflammatory activation. We hypothesized that increased plasma concentrations of EVs might be associated with the proinflammatory and pro-thrombotic characteristics of left ventricle assist device (LVAD) and right ventricle assist device (RVAD) devices. We presented a pilot study showing the concentration of peripheral blood serum, right and left ventricle mechanical assist device extracellular concentration in relation to thrombotic complication in patients treated with a biventricular pulsatile assist device (BIVAD). The observation was based on 12 replacements of pulsatile pumps during 175 days of observation. The proinflammatory characteristics of LVAD were noted. The proinflammatory and procoagulant activation by RVAD was observed. The results may provide possible explanations for the worse results of right-sided mechanical supports observed in clinical practice.
... Total RNA was isolated from CSF and plasma by phenol-chloroform extraction using the TRIzol LS reagent (Life Technologies Co., Carlsbad, CA, USA) as described in Kondratov et al. 2020 [41]. Briefly, 200 µL of CSF or plasma sample was mixed with 600 µL of TRIzol LS containing 1 µg of Escherichia coli tRNA (Sigma-Aldrich, St. Louis, MO, USA # R1753-100UN) and 10 8 molecules of Caenorhabditis elegans synthetic oligoribonucleotide synth-cel-miR-39-3p (UCACCGGGUGUAAAUCAGCUUG) (Syntol, Moscow, Russia) identical to mature cel-miR-39-3p (iRbase: MIMAT000001). ...
In recent decades, significant progress has been achieved in understanding the mechanisms of disturbance and restoration of consciousness in patients after severe brain damage resulting in prolonged disorders of consciousness (pDOC). MicroRNAs (miRs) may be potential candidates as possible biomarkers for the classification of disease subtypes, and prognosis in patients with pDOC. The aim of the study was to analyze miRs expression levels (hsa-miR-21-5p, hsa-miR-93-5p, hsa-miR-191-5p, mmu-miR-499-5p, hsa-let-7b-5p) by a real-time polymerase chain reaction in plasma and cerebrospinal fluid (CSF) from patients with pDOC and to identify a potential biomarker for dividing patients into groups according to disease severity. We analyzed the levels of investigated miRs in pDOC patients, divided by etiology, CRSI, and the total group compared with controls. Our results showed that dividing patients with pDOC into groups according to the etiology of the disease resulted in the most significant differences in the levels of miR-93, -21, and -191 in CSF and plasma samples between groups of patients. Among the analyzed miRs, we did not find a marker that would help to distinguish VS/UWS patient groups from MCS. Examining of miRs as possible prognostic markers in patients with pDOC, the starting point seems to be the cause that led to the development of the disease.
... Besides, the subpopulation of apoVs cannot be distinguished (Bordanaba-Florit et al., 2021). To further separate the apoVs subclasses, it is recommended that this approach be performed in combination with other methods such as immunoaffinity separation (Koliha et al., 2016) and high-sensitivity fluorescence-activated sorting (Kondratov et al., 2020). ...
Apoptotic vesicles (apoVs) are specific extracellular vesicles generated during apoptosis and play important roles in multiple physiological and pathophysiological settings. Here, we present a protocol using differential centrifugation to separate apoVs from human mesenchymal stem cells (MSCs) after induction of apoptosis. We describe how to characterize apoV size and morphology by nanoparticle tracking analysis (NTA) and transmission electron microscopy (TEM), and determination of specific biomarker expression by immunoblotting. Our protocol will be useful for preparing apoVs for further functional analysis.
For complete details on the use and execution of this protocol, please refer to Zheng et al. (2021).
