Fig 2 - uploaded by Hui-Ling Liao
Content may be subject to copyright.
Nonmetric multidimensional scaling (NMDS) plots based on Bray-Curtis dissimilarity matrix for metatranscriptome rRNA (a, b, d, e) and ampliconsequencing of cDNA (c, f). (a, d) NMDS plots of LR0R-MP and LR0R-MA. (b, e) NMDS plots of LR3-MP and LR3-MA. (c, f) NMDS plot of amplicons sequenced with LR0R and LR3. MA, metatranscriptome assembled; MP, metatranscriptome pair-merged; amp, amplicon sequencing. New Phytologist (2018) 218: 1597-1611 Ó 2018 The Authors New Phytologist Ó 2018 New Phytologist Trust www.newphytologist.com
Source publication
Diverse plant‐associated fungi are thought to have symbiotrophic and saprotrophic states because they can be isolated from both dead and living plant tissues. However, such tissues often are separated in time and space, and fungal activity at various stages of plant senescence is rarely assessed directly in fungal community studies.
We used fungal...
Similar publications
Illumina-MiSeq next-generation sequencing of ITS 5.8S rRNA gene demonstrated the transgenerational transmission of fungal seed-endophytes (mycobiome) across three consecutive wheat host generations under standard-control and drought conditions in the greenhouse. Drought-stressed plants experienced a positive shift in the seed mycobiome’s compositio...
Citations
... Composition and diversity of soil fungal community was determined using a modified form of the three-step PCR method targeting fungal ITS1 region, as Chen et al. [46] described. In brief, fungal ITS1 genes were amplified using the primer pair ITS1F ...
Background
Crop-associated microorganisms play a crucial role in soil nutrient cycling, and crop growth, and health. Fine-scale patterns in soil microbial community diversity and composition are commonly regulated by plant species or genotype. Despite extensive reports in different crop or its cultivar effects on the microbial community, it is uncertain how rhizoma peanut (RP, Arachis glabrata Benth.), a perennial warm-season legume forage that is well-adapted in the southern USA, affects soil microbial community across different cultivars.
Results
This study explored the influence of seven different RP cultivars on the taxonomic composition, diversity, and functional groups of soil fungal communities through a field trial in Marianna, Florida, Southern USA, using next-generation sequencing technique. Our results showed that the taxonomic diversity and composition of the fungal community differed significantly across RP cultivars. Alpha diversity (Shannon, Simpson, and Pielou’s evenness) was significantly higher in Ecoturf but lower in UF_Peace and Florigraze compared to other cultivars (p < 0.001). Phylogenetic diversity (Faith’s PD) was lowest in Latitude compared to other cultivars (p < 0.0001). The dominant phyla were Ascomycota (13.34%), Mortierellomycota (3.82%), and Basidiomycota (2.99%), which were significantly greater in Florigraze, UF_Peace, and Ecoturf, respectively. The relative abundance of Neocosmospora was markedly high (21.45%) in UF_Tito and showed large variations across cultivars. The relative abundance of the dominant genera was significantly greater in Arbrook than in other cultivars. There were also significant differences in the co-occurrence network, showing different keystone taxa and more positive correlations than the negative correlations across cultivars. FUNGuild analysis showed that the relative abundance of functional guilds including pathogenic, saprotrophic, endophytic, mycorrhizal and parasitic fungi significantly differed among cultivars. Ecoturf had the greatest relative abundance of mycorrhizal fungal group (5.10 ± 0.44), whereas UF_Peace had the greatest relative abundance of endophytic (4.52 ± 0.56) and parasitic fungi (1.67 ± 0.30) compared to other cultivars.
Conclusions
Our findings provide evidence of crop cultivar’s effect in shaping fine-scale fungal community patterns in legume-based forage systems.
Graphical abstract
... Amplicon sequencing libraries were prepared to target Symbiodiniaceae communities with the nuclear ribosomal Internal Transcribed Spacer 2 (ITS-2 rDNA) region primers ITS_D (Pochon et al., 2001) and ITS2Rev2 (Stat et al., 2009), fungal communities with the ITS rDNA primers ITS1F and 5.8Srev that amplifies the ITS1 region (Gardes and Bruns, 1993), and prokaryotic communities with the 16S rDNA primers 515F and 926R targeting the V4 region (Caporaso et al., 2011). Illu-mina™ MiSeq libraries were prepared following a three-step protocol as described previously (Benucci et al., 2019b;Chen et al., 2018). Detailed information on PCR amplification is available in the Supplementary methods and Supplementary Tables 1 & 2. Raw sequence reads have been deposited to the NCBI SRA archive under the accession number: PRJNA744218. ...
... Three PCR amplification stages were used with a S1000 Thermal Cycler (Bio-Rad, USA) as described by [31]. More details of PCR amplification conditions were given by [34]. Following the manufacturer's instructions, the PCR products were purified using AMP Pure XP beads from Beckman Coulter and visualized on 1% agarose gels. ...
Soil microorganisms play key roles in soil nutrient transformations and have a notable effect on plant growth and health. Different plant genotypes can shape soil microbial patterns via the secretion of root exudates and volatiles, but it is uncertain how a difference in soil microorganisms induced by crop cultivars will respond to short-term seasonal variations. A field experiment was conducted to assess the changes in soil bacterial communities of seven rhizoma peanut (Arachis glabrata Benth, RP) cultivars across two growing seasons, April (Spring season) and October (Fall season). Soils’ bacterial communities were targeted using 16S rRNA gene amplicon sequencing. Bacterial community diversity and taxonomic composition among rhizoma peanut cultivars were significantly affected by seasons, cultivars, and their interactions (p < 0.05). Alpha diversity, as estimated by the OTU richness and Simpson index, was around onefold decrease in October than in April across most of the RP cultivars, while the soils from Arblick and Latitude had around one time higher alpha diversity in both seasons compared with other cultivars. Beta diversity differed significantly in April (R = 0.073, p < 0.01) and October (R = 0.084, p < 0.01) across seven cultivars. Bacterial dominant taxa (at phylum and genus level) were strongly affected by seasons and varied towards more dominant groups that have functional potentials involved in nutrient cycling from April to October. A large shift in water availability induced by season variations in addition to host cultivar’s effects can explain the observed patterns in diversity, composition, and co-occurrence of bacterial taxa. Overall, our results demonstrate an overriding effect of short-term seasonal variations on soil bacterial communities associated with different crop cultivars. The findings suggest that season-induced shifts in environmental conditions could exert stronger impacts on soil microorganisms than the finer-scale rhizosphere effect from crop cultivars, and consequently influence largely microbe-mediated soil processes and crop health in agricultural ecosystems.
... nih.gov/sra) database: Bioprojects (accession: PRJEB21674, ID: 393814; https://www.ncbi.nlm.nih.gov/bioproject/393814) and (PRJNA499105, ID: 499105; https://www.ncbi.nlm.nih.gov/bioproject/499105) (Chen et al., 2018(Chen et al., , 2019. Files were downloaded with SRA Toolkit (Leinonen et al., 2011) and converted to fastq format. ...
... The assembly of libraries was carried out using Trinity (Haas et al., 2013). From the original data presented by Chen et al., (2018Chen et al., ( , 2019 all contaminants and foreign sequences from fungi and bacteria were eliminated. Representative sequences of mosses and other identified taxa were used for BLASTX (Altschul et al., 1990) to obtain information on the taxonomic category of the transcripts found (E-value < 1e-6). ...
Class III peroxidases (POD: EC 1.11.1.7) are classical secretory plant peroxidases belonging to a large multi-gene family with diverse functions. Members of the POD family have been well-studied and characterized in many plants, including three species of bryophytes, but not from the moss Dicranum scoparium Hedw. Ecologically , D. scoparium is a very important species, which has a widespread distribution throughout the Hol-arctic. Here we present the first comprehensive report on the POD gene family in D. scoparium, identifying 22 genes encoding PODs (DsPODs), two of which were cloned for verification. All genes were deposited to Gen-Bank under the third-party annotation (Accession numbers TPA: BK061169 À BK061190). Here, we present an in silico study of the physicochemical properties of these proteins. Analyses of conserved domains and subcellular localization suggested that DsPODs have classical peroxidase domain structure; they are secre-tory proteins and most of them are extracellular. Eight DsPODs highly homologous to Class III peroxidases from the mosses Pohlia nutans and Physcomitrium patens were further microcharacterized. All eight DsPODs possess a haem ligand and active sites necessary for enzymatic activity; they also contained sites for post-translational modifications. Prediction of secondary structure indicated that these proteins mainly consist of a-helices and random coils. Experiments involving the reverse transcription quantitative real-time polymer-ase chain reaction (RT-qPCR) showed that DsPOD1, DsPOD2, DsPOD6, and DsPOD8 are differentially upregu-lated in response to stress. The stresses applied here included CdCl 2 , paraquat, unfavorable temperatures, and a hydration-desiccation-rehydration cycle. Our results indicate that Class III PODs contribute to the abi-otic stress tolerance of D. scoparium, and specific DsPOD genes may play diverse roles in the response of the moss to stress.
... Newly generated sequences were accessioned to GenBank and received accession numbers MT157306, OP160001, OP162978-OP163006, OP163129-OP163165, and OP168761. Details are listed in SUPPLEMENTARY TABLE 3. Previously published sequences (Argüelles-Moyao et al. 2017;Bandini et al. 2019Bandini et al. , 2021aBandini et al. , 2021bBandini et al. , 2022aBandini et al. , 2022bBeker et al. 2010Beker et al. , 2013Beker et al. , 2016Beker et al. , 2018Bidartondo and Read 2008;Bizio and Castellan 2017;Bowman and Arnold 2021;Brock et al. 2009;Brown et al. 2022;Cervini et al. 2020;Chen et al. 2018;Cho et al. 2016;Christ et al. 2011;Clausing and Polle 2020;Cripps et al. 2019;Crous et al. 2018;Csizmár et al. 2021;Eberhardt et al. 2009Eberhardt et al. , 2013Eberhardt et al. , 2016aEberhardt et al. , 2016bEberhardt et al. , 2018Eberhardt et al. , 2020aEberhardt et al. , 2020bEberhardt et al. , 2021Eberhardt et al. , 2022aEberhardt et al. , 2022bEberhardt et al. , 2022cFan and Bau 2018;Frings et al. 2020;Garrido-Benavent et al. 2020;Grilli et al. 2016;Guzman-Davalos et al. 2003;Hallen et al. 2003;Harrower et al. 2011;Hashimoto et al. 2012;Holec et al. 2014Holec et al. , 2016Hughes et al. 2009;Hyde et al. 2016;Jabeen and Khalid 2020;Kasuya and Hosaka 2017;Katanić et al. 2016;Kennedy et al. 2011;Kranabetter et al. 2015;Krisai-Greilhuber et al. 2018;Kropp et al. 2013;Krüger et al. 2012;Landry et al. 2021;Larsson et al. 2009Larsson et al. , 2014Latha et al. 2016;Malysheva and Kiyashko 2011;Malysheva et al. 2016;Marchetti et al. 2014;Matheny 2005;Matheny and Bougher 2017;Matheny et al. 2002Matheny et al. , 2006Matheny et al. , 2007Matheny et al. , 2015Matheny et al. , 2020Niskanen et al. 2011Niskanen et al. , 2012Olchowik et al. 2021;Osmundson et al. 2013;Peintner et al. 2004;Rodríguez-Gutíerrez et al. 2020;Ryberg et al. 2008Ryberg et al. , 2010Schoch et al. 2012Schoch et al. , 2014Seger et al. 2017;Sesli 2021;Soop et al. 2019;Stensrud et al. 2014;Suz et al. 2014;Tedersoo et al. 2003Tedersoo et al. , 2006Tedersoo et al. , 2020Thorn et al. 1996;Tian and Matheny 2021;van der Walt et al. 2020;Vašutová et al. 2018;Vauras and Larsson 2020;Vesterholt et al. 2014;Vu et al. 2019;Walther et al. 2005;Yang et al. 2005;Zhang et al. 2017) Vašutová et al. 2018Vauras and Larsson 2020;Vesterholt et al. 2014;Vu et al. 2019;Walther et al. 2005;Yang et al. 2005;Zhang et al. 2017) used in this study are summarized in SUPPLEMENTARY TABLE 4. To determine the taxonomic relationships of sequences from collections that were not Hebeloma, BLAST searches were carried out against GenBank (Johnson et al. 2008), UNITE (Kõljalg et al. 2005), and BOLD (Ratnasingham and Hebert 2007) databases. BLAST searches against our own data were done in Geneious R10 (Biomatters, Auckland, New Zealand) with default settings. ...
... Flammuloides. Pholiota gregariiformis was matched by an environmental sequence from "Duke Forest, NC" (MF943005, Chen et al. 2018) but was not included in one of the clades corresponding to species recognized by Tian and Matheny (2021). ...
William Alphonso Murrill was an American mycologist of the early 20th century. He described 1453 new species of Agaricales, Boletales, and Polyporales. Within these were 44 taxa that he described as Hebeloma or that he recombined into Hebeloma. Additionally, there are five species, of which we are aware, that Murrill described within other genera that should be referred to the genus Hebeloma. A further three species described from northern America by J. P. F. C. Montagne, and transferred to Hebeloma by Saccardo, were commented on by Murrill and not accepted within the genus. These 52 taxa are analyzed here, both morphologically and molecularly, as far as possible. For 18 of his types, internal transcribed spacer (ITS) sequences were generated. For two species (H. harperi and H. subfastibile), which were mixed collections, lectotypes are designated. Twenty-three of the taxa analyzed are Hebeloma, as the genus is recognized today, and six of these (H. australe, H. harperi, H. paludicola, H. subaustrale, H. subfastibile, and H. viscidissimum) are regarded as current, i.e., they are names that should be accepted and used. Hebeloma paludicola is an earlier name for H. hygrophilum, described from Europe. Gymnopilus viscidissimus is synonymous with H. amarellum but has priority and is here recombined into Hebeloma. The remaining 17 Hebeloma taxa are synonymized with other species that have priority. The remaining 29 species belong to a range of genera; molecularly supported were Agrocybe, Cortinarius, Inocybe, Inosperma, Phlegmacium, Pholiota, Pseudosperma, and Pyrrhulomyces. Recombinations and synonymizations are made as appropriate and necessary. The names H. alachuanum and H. vatricosum, respectively Inocybe vatricosa, are considered doubtful and should be avoided.
... Alternatively, elevated metabolic diversity in endophytic genomes may be associated with these fungi being able to exploit multiple lifestyles throughout their lifecycle [26, [113][114][115], including utilizing decaying plant biomass [116][117][118]. Indeed, each of the endophytic Trichoderma isolates in our dataset are more or less "ecological generalists" that have been associated with multiple lifestyles (S1 Table). ...
Trichoderma is a cosmopolitan genus with diverse lifestyles and nutritional modes, including mycotrophy, saprophytism, and endophytism. Previous research has reported greater metabolic gene repertoires in endophytic fungal species compared to closely-related non-endophytes. However, the extent of this ecological trend and its underlying mechanisms are unclear. Some endophytic fungi may also be mycotrophs and have one or more mycoparasitism mechanisms. Mycotrophic endophytes are prominent in certain genera like Trichoderma , therefore, the mechanisms that enable these fungi to colonize both living plants and fungi may be the result of expanded metabolic gene repertoires. Our objective was to determine what, if any, genomic features are overrepresented in endophytic fungi genomes in order to undercover the genomic underpinning of the fungal endophytic lifestyle. Here we compared metabolic gene cluster and mycoparasitism gene diversity across a dataset of thirty-eight Trichoderma genomes representing the full breadth of environmental Trichoderma 's diverse lifestyles and nutritional modes. We generated four new Trichoderma endophyticum genomes to improve the sampling of endophytic isolates from this genus. As predicted, endophytic Trichoderma genomes contained, on average, more total biosynthetic and degradative gene clusters than non-endophytic isolates, suggesting that the ability to create/modify a diversity of metabolites potential is beneficial or necessary to the endophytic fungi. Still, once the phylogenetic signal was taken in consideration, no particular class of metabolic gene cluster was independently associated with the Trichoderma endophytic lifestyle. Several mycoparasitism genes, but no chitinase genes, were associated with endophytic Trichoderma genomes. Most genomic differences between Trichoderma lifestyles and nutritional modes are difficult to disentangle from phylogenetic divergences among species, suggesting that Trichoderma genomes maybe particularly well-equipped for lifestyle plasticity. We also consider the role of endophytism in diversifying secondary metabolism after identifying the horizontal transfer of the ergot alkaloid gene cluster to Trichoderma .
... Metatranscriptome data for the moss D. scoparium deposited to the Sequence Read Archive in the NCBI under accession numbers: PRJEB21674, ID: 393814 and PRJNA499105, ID: 499105 were extracted from the database [29,30]. The files were downloaded using the SRA Toolkit [31] and then converted to fastq format. ...
... Library assembly was performed using Trinity software [34]. All contaminants and foreign fungal and bacterial sequences were removed from the original data [29,30]. ...
Plant dehydration-responsive element binding (DREB) transcription factors (TFs) play important roles during stress tolerance by regulating the expression of numerous genes involved in stresses. DREB TFs have been extensively studied in a variety of angiosperms and bryophytes. To date, no information on the identification and characterization of DREB TFs in Dicranum scoparium has been reported. In this study, a new DBF1 gene from D. scoparium was identified by cloning and sequencing. Analysis of the conserved domain and physicochemical properties revealed that DsDBF1 protein has a classic AP2 domain encoding a 238 amino acid polypeptide with a molecular mass of 26 kDa and a pI of 5.98. Subcellular prediction suggested that DsDBF1 is a nuclear and cytoplasmic protein. Phylogenetic analysis showed that DsDBF1 belongs to group A-5 DREBs. Expression analysis by reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR) revealed that DsDBF1 was significantly upregulated in response to abiotic stresses such as desiccation/rehydration, exposure to paraquat, CdCl2, high and freezing temperatures. Taken together, our data suggest that DsDBF1 could be a promising gene candidate to improve stress tolerance in crop plants, and the characterization of TFs of a stress tolerant moss such as D. scoparium provides a better understanding of plant adaptation mechanisms.
... Further refinement of this classification can be obtained by considering the overall establishment success, from T. squarrosa, the most successful species, to the very low success of D. scoparium. In fact, the low success of D. scoparium was striking and it might be related to the low resistance of the species to the fragmentation disturbance or to an absence of the necessary fungal communities in lab conditions (see 73 ). ...
Colonization of new habitat patches is a key aspect of metacommunity dynamics, particularly for sessile organisms. Mosses can establish in new patches through fragmentation, with different vegetative structures acting as propagules. Despite the importance of these propagules for successful colonization the specific aspects that favour moss colonization by vegetative propagules remain poorly understood, including the effect of propagule size. We examine the intra‑ and interspecific variation of establishment and colonization success in culture of propagules of different sizes in six widespread soil moss species of contrasting growth form (Dicranum scoparium, Homalotheciumaureum, Hypnum cupressiforme, Ptychostomum capillare, Syntrichia ruralis and Tortella squarrosa). We obtained three different size classes of propagules from artificially fragmented vegetative material, and assessed their establishment under controlled light and temperature conditions. We characterize the size, shape, apparent viability, morphological type and size changes due to hydration states of the propagules, all of them traits with potentially significant influence in their dispersal pattern and establishment. Then we assess the effect of these traits on moss establishment, using indicators of surface establishment (number of established shoots and colonized surface) and biomass production (viable biomass) as proxies of colonization success. The establishment indicators related to colonization surface and biomass production differ among species and propagule sizes. The magnitude of the interspecific differences of all indicators of establishment success was larger at the smaller propagule size class. T. squarrosa was the most successful species, and D. scoparium showed the lowest performance. We also found interspecific differences in the hydration dynamics of the propagules. The process of establishment by vegetative fragments operates differently among moss species. Besides, differences between hydration states in propagules of some species could be part of syndromes for both dispersal and establishment. This study unveils several functional traits relevant for moss colonization, such as wet versus dry area and length of fragments, which may improve our understanding of their spatial dynamics.
... Amplicon sequencing libraries were prepared with ITS1F and ITS2 primers (81,82), targeting the ITS1 region of fungal nuclear ribosomal DNA (nrITS). To amplify the target region and to attach a barcode sequence for each sample, a three-step PCR approach was performed, as described previously (83). Briefly, the ITS region was amplified using standard primer sets (ITS1F, 59CTTGGTCATTTAGAGGAAGTAA39; ITS2, 59GCTGCGTTCTTCATCGATGC39) with 10 cycles (81,82). ...
... The raw reads were submitted to the National Center for Biotechnology Information (NCBI) Sequence Read Archive (BioProject identifier [ID], PRJNA733319). Whenever a Sanger sequencing verification step was involved, we used ITS1F and LR3 (84) primer sets and followed the work of Chen et al. (83) for PCR preparation and sequencing. ...
Grasses harbor diverse fungi, including some that produce mycotoxins or other secondary metabolites. Recently, Florida cattle farmers reported cattle illness, while the cattle were grazing on warm-season grass pastures, that was not attributable to common causes, such as nutritional imbalances or nitrate toxicity. To understand correlations between grass mycobiome and mycotoxin production, we investigated the mycobiomes associated with five prominent, perennial forage and weed grasses [Paspalum notatum Flügge, Cynodon dactylon (L.) Pers., Paspalum nicorae Parodi, Sporobolus indicus (L.) R. Br., and Andropogon virginicus (L.)] collected from six Florida pastures actively grazed by livestock. Black fungal stromata of Myriogenospora and Balansia were observed on P. notatum and S. indicus leaves and were investigated. High-throughput amplicon sequencing was applied to delineate leaf mycobiomes. Mycotoxins from P. notatum leaves were inspected using liquid chromatography-mass spectrometry (LC-MS/MS). Grass species, cultivars, and geographic localities interactively affected fungal community assemblies of asymptomatic leaves. Among the grass species, the greatest fungal richness was detected in the weed S. indicus. The black fungal structures of P. notatum leaves were dominated by the genus Myriogenospora, while those of S. indicus were codominated by the genus Balansia and a hypermycoparasitic fungus of the genus Clonostachys. When comparing mycotoxins detected in P. notatum leaves with and without M. atramentosa, emodin, an anthraquinone, was the only compound which was significantly different (P < 0.05). Understanding the leaf mycobiome and the mycotoxins it may produce in warm-season grasses has important implications for how these associations lead to secondary metabolite production and their subsequent impact on animal health. IMPORTANCE The leaf mycobiome of forage grasses can have a major impact on their mycotoxin contents of forage and subsequently affect livestock health. Despite the importance of the cattle industry in warm-climate regions, such as Florida, studies have been primarily limited to temperate forage systems. Our study provides a holistic view of leaf fungi considering epibiotic, endophytic, and hypermycoparasitic associations with five perennial, warm-season forage and weed grasses. We highlight that plant identity and geographic location interactively affect leaf fungal community composition. Yeasts appeared to be an overlooked fungal group in healthy forage mycobiomes. Furthermore, we detected high emodin quantities in the leaves of a widely planted forage species (P. notatum) whenever epibiotic fungi occurred. Our study demonstrated the importance of identifying fungal communities, ecological roles, and secondary metabolites in perennial, warm-season grasses and their potential for interfering with livestock health.
... For bacteria, the V4 hypervariable region of 16S rRNA genes was amplified using 515F/806R primers (Caporaso et al., 2011), and the Illumina compatible libraries were prepared using primers containing both the target sequences and the dual indexed Illumina compatible adapters (Kozich et al., 2013) by Michigan State University (MSU) Research Technology Support Facility (RTSF) Genomics core. For fungi, ITS1 region was amplified using ITS1-F/ITS2 primers (White et al., 1990), and libraries were multiplexed using a three-step PCR sequence as described by Chen et al. (2018). The completed libraries were normalized using Invitrogen SequalPrep DNA Normalization plates and pooled and cleaned up using AmpureXP magnetic beads. ...
Switchgrass (Panicum virgatum L.), as a dedicated bioenergy crop, can provide cellulosic feedstock for biofuel production while improving or maintaining soil quality. However, comprehensive evaluations of how switchgrass cultivation and nitrogen (N) management impact soil and plant parameters remain incomplete. We conducted field trials in three years (2016–2018) at six locations in the North Central Great Lakes Region to evaluate the effects of cropping systems (switchgrass, restored prairie, undisturbed control) and N rates (0, 56 kg N ha‐1 yr‐1) on biomass yield and soil physicochemical, microbial, and enzymatic parameters. Switchgrass cropping system yielded an aboveground biomass 2.9–3.3 times higher than the other two systems (Jayawardena et al., In submission) but our study found that this biomass accumulation didn’t reduce soil dissolved organic C (DOC), total dissolved N (TDN), or bacterial diversity. The annual aboveground biomass removal for bioenergy feedstock, however, reduced soil microbial biomass C (MBC) and N (MBN) and bacterial richness in the 2nd and 3rd years; despite this, continuous monocropping of switchgrass improved soil TDN, inorganic N, bacterial diversity, and shoot biomass in the 2nd and/or 3rd years when compared to the 1st year. N fertilization increased aboveground biomass yield by 1.2 times and significantly increased soil TDN, MBN, and the shoot biomass of switchgrass when compared to the unfertilized control. Locations with higher C and N contents and lower C:N ratio had higher aboveground biomass, MBC, MBN, and the activity of BG, CBH, and UREA enzymes; by contrast, locations with higher pH had higher soil TDN and activity of NAG and LAP enzymes. Our research demonstrates that switchgrass cultivation could improve or maintain soil N content and N fertilization can increase plant biomass yield. The comprehensive data also can inform future biogeochemical models to successfully implement switchgrass for bioenergy production.
