Figure 1 - available via license: Creative Commons Attribution-NonCommercial 2.0 Generic
Content may be subject to copyright.
![Main steps of peptidoglycan synthesis in W. viridescens. The subunit consists of β-1-4-linked N-acetyl glucosamine (GlcNAc) and N-acetyl muramic acid (MurNAc) substituted by a depsipeptide which is linked to the d-lactoyl group of MurNAc by an amide bond. The assembly of the subunit starts in the cytoplasm by the synthesis of UDP-MurNAc, the first precursor dedicated to peptidoglycan synthesis (37). In the following steps, the Mur ligases sequentially add l-Ala, d-Glu, l-Lys, attached to the γ carboxyl of d-Glu (d-iGlu) and the depsipeptide d-Ala-d-Lac to form the stem pentadepsipeptide l-Ala1-d-iGlu2-l-Lys3-d-Ala4-d-Lac5. The FemXWv aminoacyl transferase adds the first residue of the side chain onto this nucleotide precursor. Synthesis of the subunit proceeds by the transfer of the phospho-MurNAc-pentadepsipeptide moiety of UDP-MurNAc-pentadepsipeptide to the C55 lipid carrier undecaprenyl phosphate to form lipid intermediate I (undecaprenyl-PP-MurNAc-pentadepsipeptide or lipid I). The addition of GlcNAc to lipid I leads to lipid intermediate II [undecaprenyl-PP-MurNAc-(pentadepsipeptide)GlcNAc] or lipid II. The second and third residues of the l-Ala-l-Ser and l-Ala-l-Ser-l-Ala side chains are added to the lipid intermediates by unknown Fem transferases. The α carboxyl of d-iGlu2 is amidated in mature peptidoglycan (d-iGln2). The insets indicate the relative abundance of precursors and muropeptides, which was determined by the absorbance at 260 and 195 nm, respectively.](profile/Matthieu-Fonvielle/publication/5913297/figure/fig4/AS:324819934564366@1454454515585/Main-steps-of-peptidoglycan-synthesis-in-W-viridescens-The-subunit-consists-of.png)
Main steps of peptidoglycan synthesis in W. viridescens. The subunit consists of β-1-4-linked N-acetyl glucosamine (GlcNAc) and N-acetyl muramic acid (MurNAc) substituted by a depsipeptide which is linked to the d-lactoyl group of MurNAc by an amide bond. The assembly of the subunit starts in the cytoplasm by the synthesis of UDP-MurNAc, the first precursor dedicated to peptidoglycan synthesis (37). In the following steps, the Mur ligases sequentially add l-Ala, d-Glu, l-Lys, attached to the γ carboxyl of d-Glu (d-iGlu) and the depsipeptide d-Ala-d-Lac to form the stem pentadepsipeptide l-Ala1-d-iGlu2-l-Lys3-d-Ala4-d-Lac5. The FemXWv aminoacyl transferase adds the first residue of the side chain onto this nucleotide precursor. Synthesis of the subunit proceeds by the transfer of the phospho-MurNAc-pentadepsipeptide moiety of UDP-MurNAc-pentadepsipeptide to the C55 lipid carrier undecaprenyl phosphate to form lipid intermediate I (undecaprenyl-PP-MurNAc-pentadepsipeptide or lipid I). The addition of GlcNAc to lipid I leads to lipid intermediate II [undecaprenyl-PP-MurNAc-(pentadepsipeptide)GlcNAc] or lipid II. The second and third residues of the l-Ala-l-Ser and l-Ala-l-Ser-l-Ala side chains are added to the lipid intermediates by unknown Fem transferases. The α carboxyl of d-iGlu2 is amidated in mature peptidoglycan (d-iGln2). The insets indicate the relative abundance of precursors and muropeptides, which was determined by the absorbance at 260 and 195 nm, respectively.
Source publication
The FemXWv aminoacyl transferase of Weissella viridescens initiates the synthesis of the side chain of peptidoglycan precursors by transferring l-Ala from Ala-tRNAAla to UDP-MurNAc-pentadepsipeptide. FemXWv is an attractive target for the development of novel antibiotics, since the side chain is essential for the last cross-linking
step of peptidog...
Similar publications
We report here the synthetic route of two constrained dinucleotides and the determination of the sugar puckering by NMR analyses of the starting nucleosides. Enzymatic ligation to microhelix-RNAs provide access to tRNA analogues containing a 3’ terminal A76 locked in South conformation. Biological evaluation of our tRNA analogues has been performed...
Citations
... Il a également été montré que FemX utilisait aussi efficacement des précurseurs possédant des extrémité D-Ala 4 -D-Lac 5 ou D-Ala 4 -D-Ala 5 . (Figure 11) (Francklyn and Schimmel, 1989;Villet et al., 2007). ...
La résistance aux antibiotiques constitue aujourd’hui l’une des plus graves menaces de santé publique à l’échelle mondiale et nécessite le développement urgent de nouveaux antibiotiques. La biosynthèse du peptidoglycane (PG), un composant majeur de la paroi bactérienne, est la cible des deux familles d’antibiotiques utilisées en thérapeutique humaine, les β-lactamines et les glycopeptides. Le PG est constitué de chaînes glycanes liées à des tiges peptidiques branchées entre elles par des ponts interpeptidiques. Chez de nombreuses bactéries à Gram positif, les chaînes latérales constituant ces ponts, sont synthétisées par les transférases de la famille Fem. Ces enzymes ont la particularité d’utiliser des ARNt aminoacylés comme substrats, qui sont des molécules également utilisées dans d’autres mécanismes biologiques importants, comme par exemple la synthèse des protéines via le ribosome. S. aureus possède trois transférases de la famille Fem (FmhB, FemA et FemB) qui catalysent le transfert séquentiel de cinq résidus glycyles des Gly-ARNtGly vers les précurseurs cytoplasmiques du peptidoglycane (lipide II). Ces enzymes, qui sont essentielles à la viabilité de la bactérie et qui n’ont pas d’équivalent chez les cellules eucaryotes, constituent des cibles thérapeutiques de choix pour le développement de nouvelles molécules antibactériennes actives sur des souches résistantes aux antibiotiques. De façon à comprendre le fonctionnement de ces enzymes, nous avons développé des méthodes de semi-synthèse d’ARNt aminoacylés, d’analogues de lipides II et de molécules bi-substrats. Ces outils, associés à des études structurales par rayons X et des tests enzymatiques in vitro nous ont permis de mieux comprendre les mécanismes catalytiques de ces enzymes, de comprendre le mode de reconnaissance des transférases Fem pour leurs substrats (ARNt et lipides) et enfin de synthétiser des inhibiteurs puissants de ces enzymes.
... tRNA Ala (5 -GGGGCCUUAGCUCAGCUGGGAGA GCGCCUGCUUUGCACGCAGGAGGUCAGCGG UUCGAUCCGCUAGGCUCCACCA-3 ), corresponding to 76 nt of tRNA Ala of E. faecalis strain V583, was obtained by in vitro transcription using T7 RNA polymerase (35). ...
... Here, we show that an enzymatic ligation catalyzed by T4 RNA ligase between an L-Ala-acylated dinucleotide and an XNA can be used to obtain tXNA Ala analogs. As FemX interacts mainly with the acceptor arm of tRNA Ala , we restricted the size of our XNA probes to 24-nt aminoacylated helices as mimics of the tRNA Ala (35). For this study, we synthesized six helices of 24-nt mimicking the acceptor arm of tRNA Ala ( Figure 3C) containing RNA, 2 F-RNA, HNA, 2 F-ANA or DNA, nucleotides in the double stranded portion of the helices (compounds 6a, 7a, 8a, 10a and 11a) or HNA in the full helix (compound 9a). ...
... For the 2 F-RNA complex, we also observe the Watson-Crick base pairing of G 1 -C 72 as well as G 2 -C 71 (Supplementary Figure S4A). We further observed enzyme residues in the vicinity of the C 71 and C 72 bases that we had previously identified as major determinants of FemX specificity towards tRNA Ala (Supplementary Figure S4B) (35). For the peptidyl-DNA (29) and peptidyl-2 F-ANA (28), C 75 is not well positioned to be in a -stacking interaction with C 74 . ...
Xenobiotic nucleic acids (XNAs) offer tremendous potential for synthetic biology, biotechnology, and molecular medicine but their ability to mimic nucleic acids still needs to be explored. Here, to study the ability of XNA oligonucleotides to mimic tRNA, we synthesized three L-Ala-tXNAs analogs. These molecules were used in a non-ribosomal peptide synthesis involving a bacterial Fem transferase. We compared the ability of this enzyme to use amino-acyl tXNAs containing 1′,5′-anhydrohexitol (HNA), 2′-fluoro ribose (2′F-RNA) and 2′-fluoro arabinose. L-Ala-tXNA containing HNA or 2′F-RNA were substrates of the Fem enzyme. The synthesis of peptidyl-XNA and the resolution of their structures in complex with the enzyme show the impact of the XNA on protein binding. For the first time we describe functional tXNA in an in vitro assay. These results invite to test tXNA also as substitute for tRNA in translation.
... Essentially, this special T-box controls the availability of glycine to not only ribosomal protein synthesis through glycyl-tRNA Gly supply (served by P1 tRNA Gly GCC and P2 tRNA Gly UCC ), but also the exoribosomal synthesis of pentaglycine peptides that stabilize the S. aureus cell wall. The synthesis of pentaglycine bridges utilizes nonproteinogenic (NP1 tRNA Gly UCC , NP2 tRNA Gly UCC and NEW tRNA Gly UCC ) glycyl-tRNA Gly isoacceptors as substrates for the family of Fem factors (factors essential for methicillin resistance; FemXAB) (34)(35)(36). It was shown previously that the S. aureus glyS T-box consists of stem I with low conservation compared to its bacilli counterparts and an unstructured linker sequence with no stem II, followed by a rather typical stem III, and interestingly the terminator/antiterminator domain besides the conserved T-box bulge includes the appended stem Sa insertion (42 nt), which serves as an additional selectivity and specificity node for the tRNA Gly isoacceptors and is present in all staphylococci. ...
T-box riboswitches (T-boxes) are essential RNA regulatory elements with a remarkable structural diversity, especially among bacterial pathogens. In staphylococci, all glyS T-boxes synchronize glycine supply during synthesis of nascent polypeptides and cell wall formation and are characterized by a conserved and unique insertion in their antiterminator/terminator domain, termed stem Sa. Interestingly, in Staphylococcus aureus the stem Sa can accommodate binding of specific antibiotics, which in turn induce robust and diverse effects on T-box-mediated transcription. In the present study, domain swap mutagenesis and probing analysis were performed to decipher the role of stem Sa. Deletion of stem Sa significantly reduces both the S. aureus glyS T-box-mediated transcription readthrough levels and the ability to discriminate among tRNAGly isoacceptors, both in vitro and in vivo. Moreover, the deletion inverted the previously reported stimulatory effects of specific antibiotics. Interestingly, stem Sa insertion in the terminator/antiterminator domain of Geobacillus kaustophilus glyS T-box, which lacks this domain, resulted in elevated transcription in the presence of tigecycline and facilitated discrimination among proteinogenic and nonproteinogenic tRNAGly isoacceptors. Overall, stem Sa represents a lineage-specific structural feature required for efficient staphylococcal glyS T-box-mediated transcription and it could serve as a species-selective druggable target through its ability to modulate antibiotic binding.
... Finally, Weissella viridescens harbors either a L-Ala-L-Ser or a L-Ala-L-Ser-L-Ala interpeptide chain [85]. Villet et al. showed that the C 71 and C 72 from the tRNA Ala are critical nucleotides for recognition by FemX, whereas the G 3 -U 70 , base pair considered as a strong identity determinant for recognition by AlaRS is dispensable [86]. Because MurM and FemX of W. viridescens recognize only two aa-tRNAs [87,88], it has been suggested that these two proteins may be involved in the complex discrimination between protein and peptidoglycan synthesis [89]. ...
The aminoacyl-tRNA synthetases (aaRSs) are responsible for the formation of aminoacyl-tRNAs used by the translational machinery. The subcellular relocalization of these proteins is often associated with non-canonical functions. The yeast S. cerevisiae contains a multisynthetasic complex, called AME complex, composed of the methionyl- and glutamyl-tRNA synthetases (MRS and ERS) and the cofactor Arc1. Even if the complex has been described as exclusively cytosolic, the two aaRSs can relocate in different subcellular compartments. These proteins are thus referred as cytosolic or organellar echoforms. Moreover, Arc1 interacts with vacuolar lipids in vitro, suggesting a vacuolar localization in vivo. To visualize mitochondrial and vacuolar (vace) echoforms of cytosolic proteins, we engineered two epifluorescence microscopy tools. We identified a new mitochondrial echoform for two aaRSs, as well as vacuolar echoforms for all the cytosolic aaRSs tested and the AME components. A potential implication of vaceMRS in TORC1 inhibition was also observed.
... Finally, Weissella viridescens harbors either a L-Ala-L-Ser or a L-Ala-L-Ser-L-Ala interpeptide chain [85]. Villet et al. showed that the C 71 and C 72 from the tRNA Ala are critical nucleotides for recognition by FemX, whereas the G 3 -U 70 , base pair considered as a strong identity determinant for recognition by AlaRS is dispensable [86]. Because MurM and FemX of W. viridescens recognize only two aa-tRNAs [87,88], it has been suggested that these two proteins may be involved in the complex discrimination between protein and peptidoglycan synthesis [89]. ...
The aminoacylation reaction is one of most extensively studied cellular processes. The so-called “canonical” reaction is carried out by direct charging of an amino acid (aa) onto its corresponding transfer RNA (tRNA) by the cognate aminoacyl-tRNA synthetase (aaRS), and the canonical usage of the aminoacylated tRNA (aa-tRNA) is to translate a messenger RNA codon in a translating ribosome. However, four out of the 22 genetically-encoded aa are made “noncanonically” through a two-step or indirect route that usually compensate for a missing aaRS. Additionally, from the 22 proteinogenic aa, 13 are noncanonically used, by serving as substrates for the tRNA- or aa-tRNA-dependent synthesis of other cellular components. These nontranslational processes range from lipid aminoacylation, and heme, aa, antibiotic and peptidoglycan synthesis to protein degradation. This chapter focuses on these noncanonical usages of aa-tRNAs and the ways of generating them, and also highlights the strategies that cells have evolved to balance the use of aa-tRNAs between protein synthesis and synthesis of other cellular components.
... Studies showing the specificity of Fem proteins for their tRNA and lipid substrates have been reported (210,221). Villet et al. demonstrate that posttranscriptional modifications and recognition of the acceptor stem of the tRNA are important criteria for the recognition by Fem proteins (222). Mutational analysis of S. pneumoniae MurM chimeras with substitutions in a 30-amino-acid region in the coil-coil domain demonstrates that this region determines residue specificity (Ala versus Ser) (223). ...
Acetylation is a conserved modification used to regulate a variety of cellular pathways, such as gene expression, protein synthesis, detoxification, and virulence. Acetyltransferase enzymes transfer an acetyl moiety, usually from acetyl coenzyme A (AcCoA), onto a target substrate, thereby modulating activity or stability. Members of the GCN5-
N
-acetyltransferase (GNAT) protein superfamily are found in all domains of life and are characterized by a core structural domain architecture. These enzymes can modify primary amines of small molecules or of lysyl residues of proteins. From the initial discovery of antibiotic acetylation, GNATs have been shown to modify a myriad of small-molecule substrates, including tRNAs, polyamines, cell wall components, and other toxins. This review focuses on the literature on small-molecule substrates of GNATs in bacteria, including structural examples, to understand ligand binding and catalysis. Understanding the plethora and versatility of substrates helps frame the role of acetylation within the larger context of bacterial cellular physiology.
... Finally, Weissella viridescens harbors either a L-Ala-L-Ser or a L-Ala-L-Ser-L-Ala interpeptide chain [85]. Villet et al. showed that the C 71 and C 72 from the tRNA Ala are critical nucleotides for recognition by FemX, whereas the G 3 -U 70 , base pair considered as a strong identity determinant for recognition by AlaRS is dispensable [86]. Because MurM and FemX of W. viridescens recognize only two aa-tRNAs [87,88], it has been suggested that these two proteins may be involved in the complex discrimination between protein and peptidoglycan synthesis [89]. ...
... The FemABX family of nonribosomal peptidyltransferases (65) has a unique catalytic mechanism (66). The specificity of FemXs depends mainly upon the sequence of the tRNA, although the wobble base pair G3:U70, the main identity determinant of AlaRS, is not essential for FemX recognition (67). These aminoacyl transferases discriminate between Ala-tRNA Ala and Ser-tRNA Ser . ...
The homochirality of amino acids is vital for the functioning of the translation apparatus. L-Amino acids predominate in proteins and D-amino acids usually represent diverse regulatory functional physiological roles in both pro- and eukaryotes. Aminoacyl-tRNA-synthetases (aaRSs) ensure activation of proteinogenic or nonproteinogenic amino acids and attach them to cognate or noncognate tRNAs. Although many editing mechanisms by aaRSs have been described, data about the protective role of aaRSs in D-amino acids incorporation remained unknown. Tyrosyl- and alanyl-tRNA-synthetases were represented as distinct members of this enzyme family. To study the potential to bind and edit noncognate substrates, Thermus thermophilus alanyl-tRNA-synthetase (AlaRS) and tyrosyl-tRNA-synthetase were investigated in the context of D-amino acids recognition. Here, we showed that D-alanine was effectively activated by AlaRS and D-Ala-tRNAAla, formed during the erroneous aminoacylation, was edited by AlaRS. On the other hand, it turned out that D-aminoacyl-tRNA-deacylase (DTD), which usually hydrolyzes D-aminoacyl-tRNAs, was inactive against D-Ala-tRNAAla. To support the finding about DTD, computational docking and molecular dynamics simulations were run. Overall, our work illustrates the novel function of the AlaRS editing domain in stereospecificity control during translation together with trans-editing factor DTD. Thus, we propose different evolutionary strategies for the maintenance of chiral selectivity during translation.
... These enzymes contribute to cell wall homeostasis and methicillin resistance by catalyzing the addition of specific amino acids to precursors of peptidoglycan (Favrot et al., 2016). Interestingly, Fem enzymes were shown to use amino-acyl tRNAs that bind poorly to elongation factor EF-Tu and therefore do not participate to translation, representing a specialized class of tRNAs (Villet et al., 2007;Giannouli et al., 2009). These different instances illustrate the versatility of the GNAT fold in terms of the substrates they can process and the functions they are involved with. ...
Type II toxin-antitoxin (TA) systems are widespread in bacterial and archeal genomes. These modules are very dynamic and participate in bacterial genome evolution through horizontal gene transfer. TA systems are commonly composed of a labile antitoxin and a stable toxin. Toxins appear to preferentially inhibit the protein synthesis process. Toxins use a variety of molecular mechanisms and target nearly every step of translation to achieve their inhibitory function. This review focuses on a recently identified TA family that includes acetyltransferase toxins. The AtaT and TacT toxins are the best-characterized to date in this family. AtaT and TacT both inhibit translation by acetylating the amino acid charged on tRNAs. However, the specificities of these 2 toxins are different as AtaT inhibits translation initiation by acetylation of the initiator tRNA whereas TacT acetylates elongator tRNAs. The molecular mechanisms of these toxins are discussed, as well as the functions and possible evolutionary origins of this diverse toxin family.
... Comparison of the Microbispora tRNA Glu CUC substrate with E. coli tRNA Glu suggested that the acceptor stem sequence might be important for recognition by MibB (Figure 3). Consistent with this hypothesis, previous work on FemX, MprF, CDPS, and a NisB-tRNA docking model had suggested that the aminoacyl moiety and the acceptor stem are the main areas of contact between these enzymes and aa-tRNA [23,36,40,41]. Mutagenesis experiments and subsequent activity assays with MibB supports the recognition of the discriminator base and the preceding base of the acceptor stem [38]. ...
The breadth of unprecedented enzymatic reactions performed during the formation of microbial natural products has continued to expand as new biosynthetic gene clusters are unearthed by genome mining. Enzymes that use aminoacyl-tRNA (aa-tRNA) outside of the translation machinery have been known for decades, and accounts of their use in natural product biosynthesis are just beginning to accumulate. This review will highlight the recent discoveries and advances in our mechanistic understanding of aa-tRNA-dependent enzymes that play key roles in the biosynthesis of a growing number of microbial natural products.
