Figure 2 - available via license: Creative Commons Attribution 4.0 International
Content may be subject to copyright.
MMP-12 protein expression in rats subjected to focal cerebral ischemia and reperfusion. (A) Immunoblot analysis depicting the protein expression of MMP-12 in the ipsilateral brain regions of rats subjected to ischemia and reperfusion. GAPDH was used as a loading control. Bar graph represents the quantification of MMP-12 protein expression. n = 6. R = reperfusion. *p < 0.05 vs. sham. (B) Immunofluorescence analysis depicting MMP-12 protein expression (green fluorescence) in the ipsilateral brain regions of sham controls and the rats subjected to a two-hour MCAO procedure followed by seven days or fourteen days reperfusion. Nuclei were stained with DAPI. n = 6.
Source publication
This study highlights the possible pathological role of MMP-12 in the context of ischemic stroke. Male rats were subjected to a two-hour middle cerebral artery occlusion (MCAO) procedure. MMP-12 shRNA expressing plasmid formulation was administered to these rats twenty-four hours after reperfusion. The results showed a predominant upregulation of M...
Citations
... Moreover, MMP-12 is an identified mediator of arterial stiffening in both acute and chronic situations via the elastolytic effect of MMP-12 [4]. As a result, it may be involved in some vascular and neurological diseases such as atherosclerosis and aneurysms, spinal cord injury (SCI), multiple sclerosis (MS), Theiler murine encephalomyelitis, intracerebral haemorrhage (ICH), and ischemic stroke [19,175,176]. ...
Matrix metalloproteinases (MMPs) are identifiable members of proteolytic enzymes that can degrade a wide range of proteins in the extracellular matrix (ECM). MMPs can be categorized into six groups based on their substrate specificity and structural differences: collagenases, gelatinases, stromelysins, matrilysins, metalloelastase, and membrane-type MMPs. MMPs have been linked to a wide variety of biological processes, such as cell transformation and carcinogenesis. Over time, MMPs have been evaluated for their role in cancer progression, migration, and metastasis. Accordingly, various MMPs have become attractive therapeutic targets for anticancer drug development. The first generations of broad-spectrum MMP inhibitors displayed effective inhibitory activities but failed in clinical trials due to poor selectivity. Thanks to the evolution of X-ray crystallography, NMR analysis, and homology modeling studies, it has been possible to characterize the active sites of various MMPs and, consequently, to develop more selective, second-generation MMP inhibitors. In this review, we summarize the computational and synthesis approaches used in the development of MMP inhibitors and their evaluation as potential anticancer agents.
... Matrix metalloproteinase-12 (MMP-12) is predominantly produced by macrophages/microglia and can stimulate TNFα production in microglia and boost the production of other proinflammatory mediators. Chelluboina et al. (2015) reported that MMP-12 is significantly upregulated in both acute and chronic ischemic brains of MCAO rats and that knockdown of MMP-12 via small hairpin RNAs (shRNA)-mediated silencing attenuates ischemic brain damage. The same group further examined the optimal timing of MMP-12 shRNA treatment and any gender-dependent efficacy of MMP-12 shRNA treatment. ...
... 22 25-28 In addition to these ECM components, several other biomolecules (myelin basic protein (MBP), plasminogen, progranulin, N-cadherin, α1antitrypsin, tissue factor pathway inhibitor and pro-tumour necrosis factor-α (TNFα) serve as substrates for MMP-12. [29][30][31][32][33][34][35] Overall, MMP-12 substrates include a wide range of biomolecules and ECM components. ...
... MMP-12 may be a potential target for IS treatment MMP-12's negative role on post-stroke brain damage and pathogenesis (ie, blood-brain barrier (BBB) breakdown, infarct development, inflammation, apoptosis and demyelination) as well as in neurological and functional impairments and recovery has been observed in rodent models of IS. [35][36][37][38][39] In these studies, suppressing MMP-12 gene expression shortly after IS decreased brain injury and promoted the recovery of sensorimotor and cognitive function. Reduced BBB breakdown and neuroinflammation in MMP-12-suppressed animals indicate that MMP-12 inhibition can be a promising strategy for preventing the haemorrhagic transformation caused by delayed tPA therapy, thereby allowing more patients to receive tPA treatment. ...
... 40 MMP-12 expression in these brain cells was also noticed in rat brains after cerebral ischaemia and reperfusion (IR). 35 Microglia of mice was subjected to photothrombotic stroke-expressed MMP-12. 42 Overall, it is evident that, with the exception of astrocytes, almost all brain cells express MMP-12. ...
This article focuses on the emerging role of matrix metalloproteinase-12 (MMP-12) in ischaemic stroke (IS). MMP-12 expression in the brain increases dramatically in animal models of IS, and its suppression reduces brain damage and promotes neurological, sensorimotor and cognitive functional outcomes. Thus, MMP-12 could represent a potential target for the management of IS. This article provides an overview of MMP-12 upregulation in the brain following IS, its deleterious role in the post-stroke pathogenesis (blood-brain barrier disruption, inflammation, apoptosis and demyelination), possible molecular interactions and mechanistic insights, its involvement in post-ischaemic functional deficits and recovery as well as the limitations, perspectives, challenges and future directions for further research. Prior to testing any MMP-12-targeted therapy in patients with acute IS, additional research is needed to establish the effectiveness of MMP-12 suppression against IS in older animals and in animals with comorbidities. This article also examines the clinical implications of suppressing MMP-12 alone or in combination with MMP-9 for extending the currently limited tissue plasminogen activator therapy time window. Targeting of MMP-12 is expected to have a profound influence on the therapeutic management of IS in the future.
... Notably, in a previous study, C3ar1 (C3a receptor) deletion rescued tau pathology and attenuated neuroinflammation, synaptic deficits, and neurodegeneration in the PS19 tauopathy mouse model [24]. Conversely, the proteasome subunit (Psmb8) and matrix metalloproteinase-12 (Mmp12) are associated with detrimental roles in the brain [25,26]. The inflammatory signaling score also differed significantly in WT-PBS versus Trem2 −/− PBS mice ( Figure 6E), suggesting that the annotation score differences arise from TREM2 loss. ...
The role of TREM2 in Alzheimer’s disease (AD) is not fully understood. Previous studies investigating the effect of TREM2 deletion on tauopathy mouse models without the contribution of b-amyloid have focused only on tau overexpression models. Herein, we investigated the effects of TREM2 deficiency on tau spreading using a mouse model in which endogenous tau is seeded to produce AD-like tau features. We found that Trem2−/− mice exhibit attenuated tau pathology in multiple brain regions concomitant with a decreased microglial density. The neuroinflammatory profile in TREM2-deficient mice did not induce an activated inflammatory response to tau pathology. These findings suggest that reduced TREM2 signaling may alter the response of microglia to pathological tau aggregates, impairing their activation and decreasing their capacity to contribute to tau spreading. However, caution should be exercised when targeting TREM2 as a therapeutic entry point for AD until its involvement in tau aggregation and propagation is better understood.
... The study was registered at ClinicalTrials.gov (accessed on 15 October 2022) (ID: NCT03585452). Patients were randomly divided into two groups via a simple 1:1 randomisation process using opaque envelopes: a control group (group CON) of patients receiving typical anaesthetic regimens and a dexmedetomidine group (group DEX) of patients receiving an additional dexmedetomidine infusion. ...
... MMP-12 upregulation has also been associated with brain ischemia in animal models, with post-ischemic induction higher for MMP-12 than for any other MMPs [40,41]. Other studies have demonstrated that MMP-12 induces brain injury by damaging the BBB after focal cerebral ischemia, while MMP-12 knockdown attenuates this effect [15,42]. Recent reports have revealed that MMP-12 suppression can improve neurological outcomes in animal models of brain ischemia, making MMP-12 a promising therapeutic target [24,31]. ...
Postoperative neurological deficits remain a concern for patients undergoing cardiac surgeries. Even minor injuries can lead to neurocognitive decline (i.e., postoperative cognitive dysfunction). Dexmedetomidine may be beneficial given its reported neuroprotective effect. We aimed to investigate the effects of dexmedetomidine on brain injury during cardiac surgery anaesthesia. This prospective observational study analysed data for 46 patients who underwent coronary artery bypass graft surgery with extracorporeal circulation between August 2018 and March 2019. The patients were divided into two groups: control (CON) with typical anaesthesia and dexmedetomidine (DEX) with dexmedetomidine infusion. Concentrations of the biomarkers matrix metalloproteinase-12 (MMP-12) and myelin basic protein (MBP) were measured preoperatively and at 24 and 72 h postoperatively. Cognitive evaluations were performed preoperatively, at discharge, and 3 months after discharge using Addenbrooke’s Cognitive Examination version III (ACE-III). The primary endpoint was the ACE-III score at discharge. Increased MMP-12 and MBP concentrations were observed in the DEX group 24 and 72 h postoperatively. No significant differences in ACE-III scores were observed between the groups at discharge; however, the values were increased when compared with initial values after 3 months (p = 0.000). The current results indicate that the administration of dexmedetomidine as an adjuvant to anaesthesia can increase MMP-12 and MBP levels without effects on neurocognitive outcomes at discharge and 3 months postoperatively.
... Recently, we demonstrated the upregulation of matrix metalloproteinase-12 in the ischemic brain of young rodents during both the acute and chronic phases following an ischemic stroke (Chelluboina et al., 2015b;Nalamolu et al., 2018). We discovered that the upregulation of MMP-12 in the ischemic brain was approximately 8-200 times greater than any other MMP. ...
... We discovered that the upregulation of MMP-12 in the ischemic brain was approximately 8-200 times greater than any other MMP. MMP-12 expression increased gradually during the first week following transient focal cerebral ischemia and reperfusion, and remained elevated for 14 days, the longest post-reperfusion duration tested in our study (Chelluboina et al., 2015b). MMP-12 possesses autoproteolytic properties and can activate other MMPs (Chen, 2004). ...
... The level of expression in the ipsilateral brain gradually increased from day 1 to day 7. These results confirm and extend our previous report on the elevated expression of MMP-12 in the ipsilateral rat brain (Chelluboina et al., 2015b). Similar time-dependent increases in MMP-12 expression were observed earlier in animal models of SCI and ICH by our group and others (Power et al., 2003;Wells et al., 2003Wells et al., , 2005Lee et al., 2006;Veeravalli et al., 2009). ...
We recently showed that the post-ischemic induction of matrix metalloproteinase-12 (MMP-12) in the brain degrades tight junction proteins, increases MMP-9 and TNFα expression, and contributes to the blood-brain barrier (BBB) disruption, apoptosis, demyelination, and infarct volume development. The objectives of this study were to (1) determine the effect of MMP-12 suppression by shRNA-mediated gene silencing on neurological/functional recovery, (2) establish the optimal timing of MMP-12shRNA treatment that provides maximum therapeutic benefit, (3) compare the effectiveness of acute versus chronic MMP-12 suppression, and (4) evaluate potential sex-related differences in treatment outcomes. Young male and female Sprague-Dawley rats were subjected to transient middle cerebral artery occlusion and reperfusion. Cohorts of rats were administered either MMP-12shRNA or scrambled shRNA sequence (control) expressing plasmids (1 mg/kg; i.v.) formulated as nanoparticles. At designated time points after reperfusion, rats from various groups were subjected to a battery of neurological tests to assess their reflex, balance, sensory, and motor functions. Suppression of MMP-12 promoted the neurological recovery of stroke-induced male and female rats, although the effect was less apparent in females. Immediate treatment after reperfusion resulted in a better recovery of sensory and motor function than delayed treatments. Chronic MMP-12 suppression neither enhanced nor diminished the therapeutic effects of acute MMP-12 suppression, indicating that a single dose of plasmid may be sufficient. We conclude that suppressing MMP-12 after an ischemic stroke is a promising therapeutic strategy for promoting the recovery of neurological function.
... known as reperfusion. Transient cerebral ischemia followed by reperfusion leads to the upregulation of several matrix metalloproteinases (MMPs) in the ischemic brain (Chelluboina et al., 2015a;Nalamolu et al., 2018). The elevated MMPs damage essential components of the neurovascular matrix and blood-brain barrier (BBB), resulting in BBB leakage, leukocyte infiltration, brain edema, and hemorrhage (Sandoval and Witt, 2008). ...
... We previously studied the temporal expression of all MMPs in the brain following transient cerebral ischemia and reperfusion. We discovered that MMP-12 upregulation was many times higher than any other MMP (Chelluboina et al., 2015a;Nalamolu et al., 2018). MMP-12 knockdown using shRNA-mediated gene silencing attenuated ischemic brain damage, at least in part, by reducing the degradation of tight junction proteins and thereby the BBB disruption, MMP-9 upregulation, apoptosis, neuroinflammation, and myelin basic protein degradation (Chelluboina et al., 2015a(Chelluboina et al., , 2015b. ...
... We discovered that MMP-12 upregulation was many times higher than any other MMP (Chelluboina et al., 2015a;Nalamolu et al., 2018). MMP-12 knockdown using shRNA-mediated gene silencing attenuated ischemic brain damage, at least in part, by reducing the degradation of tight junction proteins and thereby the BBB disruption, MMP-9 upregulation, apoptosis, neuroinflammation, and myelin basic protein degradation (Chelluboina et al., 2015a(Chelluboina et al., , 2015b. Attenuating MMP-12 expression in the brain promotes post-stroke neurological and functional recovery (Challa et al., 2022). ...
Tissue-type plasminogen activator (t-PA) expression is known to increase following transient focal cerebral ischemia and reperfusion. Previously, we reported downregulation of t-PA upon suppression of matrix metalloproteinase-12 (MMP-12), following transient focal cerebral ischemia and reperfusion. We now present data on the temporal expression of t-PA in the brain after transient ischemia, as well as the interaction between MMP-12 and t-PA, two proteases associated with the breakdown of the blood-brain barrier (BBB) and ischemic brain damage. We hypothesized that there might be reciprocal interactions between MMP-12 and t-PA in the brain after ischemic stroke. This hypothesis was tested using shRNA-mediated gene silencing and computational modeling. Suppression of t-PA following transient ischemia and reperfusion in rats attenuated MMP-12 expression in the brain. The overall effect of t-PA shRNA administration was to attenuate the degradation of BBB tight junction protein claudin-5, diminish BBB disruption, and reduce neuroinflammation by decreasing the expression of the microglia/macrophage pro-inflammatory M1 phenotype (CD68, iNOS, IL-1β, and TNFα). Reduced BBB disruption and subsequent lack of infiltration of macrophages (the main source of MMP-12 in the ischemic brain) could account for the decrease in MMP-12 expression after t-PA suppression. Computational modeling of in silico protein-protein interactions indicated that MMP-12 and t-PA may interact physically. Overall, our findings demonstrate that MMP-12 and t-PA interact directly or indirectly at multiple levels in the brain following an ischemic stroke. The present findings could be useful in the development of new pharmacotherapies for the treatment of stroke.
... RNA extraction, cDNA synthesis and qRT-PCR were conducted according to the protocol introduced in one previous study. 15 Gene expression was quantified by calculating fold changes using the formula 2 −ΔΔCT method. GAPDH expression served as an internal control. ...
... Western blot was performed as described previously. 15 In brief, total proteins were extracted from cell or tissue samples. Then, protein concentrations were determined using the BCA assay (Pierce, Rockford, IL, USA). ...
Long non‐coding RNA (lncRNA) MIAT (myocardial infarction associated transcript) has been characterized as a functional lncRNA modulating cerebral ischaemic/reperfusion (I/R) injury. However, the underlying mechanisms remain poorly understood. This study explored the functional partners of MIAT in primary rat neurons and their regulation on I/R injury. Sprague‐Dawley rats were used to construct middle cerebral artery occlusion (MCAO) models. Their cerebral cortical neurons were used for in vitro oxygen‐glucose deprivation/reoxygenation (OGD/R) models. Results showed that MIAT interacted with EGLN2 in rat cortical neurons. MIAT overexpression or knockdown did not alter EGLN2 transcription. In contrast, MIAT overexpression increased EGLN2 stability after I/R injury via reducing its ubiquitin‐mediated degradation. EGLN2 was a substrate of MDM2, a ubiquitin E3 ligase. MDM2 interacted with the N‐terminal of EGLN2 and mediated its K48‐linked poly‐ubiquitination, thereby facilitating its proteasomal degradation. MIAT knockdown enhanced the interaction and reduced EGLN2 stability. MIAT overexpression enhanced infarct volume and induced a higher ratio of neuronal apoptosis. EGLN2 knockdown significantly reversed the injury. MIAT overexpression reduced oxidative pentose phosphate pathway flux and increased oxidized/reduced glutathione ratio, the effects of which were abrogated by EGLN2 knockdown. In conclusion, MIAT might act as a stabilizer of EGLN2 via reducing MDM2 mediated K48 poly‐ubiquitination. MIAT‐EGLN2 axis exacerbates I/R injury via altering redox homeostasis in neurons.
... MMP activity is regulated by specific tissue inhibitors of matrix metalloproteinases (TIMPs). Timp1 is a gene associated with neuroprotection by reducing blood-brain barrier destruction and infarction volume by inhibiting MMPs (Chelluboina et al. 2015;Tejima et al. 2009). We found that the genes metallopeptidase MMP12 were significantly increased in mice by 6 h, but not rats, which upregulate MMP12 over days, not hours (Tables 1 and 4) (Chelluboina et al. 2015). ...
... Timp1 is a gene associated with neuroprotection by reducing blood-brain barrier destruction and infarction volume by inhibiting MMPs (Chelluboina et al. 2015;Tejima et al. 2009). We found that the genes metallopeptidase MMP12 were significantly increased in mice by 6 h, but not rats, which upregulate MMP12 over days, not hours (Tables 1 and 4) (Chelluboina et al. 2015). We also found that Timp1 genes were significantly upregulated in rats, but not in mice, at 6 h after pMCAO (Tables 1 and 4). ...
Neuroprotection in acute stroke has not been successfully translated from animals to humans. Animal research on promising agents continues largely in rats and mice which are commonly available to researchers. However, controversies continue on the most suitable species to model the human situation. Generally, putative agents seem less effective in mice as compared with rats. We hypothesized that this may be due to inter-species differences in stroke response and that this might be manifest at a genetic level. Here we used whole-genome microarrays to examine the differential gene regulation in the ischemic penumbra of mice and rats at 2 and 6 h after permanent middle cerebral artery occlusion (pMCAO; Raw microarray CEL data files are available in the GEO database with an accession number GSE163654). Differentially expressed genes (adj. p ≤ 0.05) were organized by hierarchical clustering, correlation plots, Venn diagrams and pathway analyses in each species and at each time-point. Emphasis was placed on genes already known to be associated with stroke, including validation by RT-PCR. Gene expression patterns in the ischemic penumbra differed strikingly between the species at both 2 h and 6 h. Nearly 90% of significantly regulated genes and most pathways modulated by ischemia differed between mice and rats. These differences were evident globally, among stroke-associated genes, immediate early genes, genes implicated in stress response, inflammation, neuroprotection, ion channels, and signal transduction. The findings of this study may have significant implications for the choice of species for screening putative stroke therapies.
... Volume of ischemic area [9,12]: ...
Background. The purpose of present study was to assess the impact of maternal treadmill exercise during pregnancy on inflammation, oxidative stress, expression of Bax and Bcl-2 genes, and brain-derived neurotrophic factor (BDNF) level in neonatal rat brain after the hypoxia-ischemia injury. Material and Methods. A total of 24 female Wistar rats were utilized in this research. Two groups are randomly considered for rats: (1) not exercised through pregnancy and (2) exercised during pregnancy. Offsprings were divided into four groups including after delivery: (1) sham, (2) sham/exercise (sham/EX), (3) HI, and (4) HI+exercise. HI was induced in pups at postnatal day 8. Neurobehavioral tests were done seven days after HI induction. Then, the brain tissue was taken from the skull to estimate Bcl-2 and Bax gene expressions, BDNF, cerebral edema, infarct volume, inflammatory factors, oxidative stress, and neurological function. Results. The BDNF level in the HI+exercise group was considerably higher than the HI, sham, and sham/EX groups. Tumor necrosis factor (TNF-α), C-reactive protein (CRP), and the whole oxidant capacity (TOC) levels in the HI group were significantly higher than the sham and sham/EX groups. TNF-α, CRP, and TOC levels in the HI+exercise group were significantly lower than the HI group. Total antioxidant capacity (TAC) level in the HI+exercise group was significantly higher than the HI group. Infarct volume and edema percent in the HI+exercise group were significantly lower than the HI group. Neurological function in the HI+exercise group was significantly better than the HI group. Bax expression in the HI+exercise group was significantly lower than the HI group. Bcl-2 expression in the HI+exercise group was significantly higher than the HI group. In the sham group, BDNF, TNF-α, CRP, TAC, TOC, edema levels, and neurological function had no significant difference with the sham/EX group. Conclusion. It appears that the maternal treadmill exercise during pregnancy exerts a supportive impact against neonatal HI brain injury through increasing antioxidant capacity, Bcl-2 expression, and BDNF levels and decreasing inflammation that is resulted in the lower infarct volume and sensorimotor dysfunction.
1. Introduction
In cardiovascular, metabolic, endocrine, and musculoskeletal systems of the mother and external elements like nutritional intake, emotional support, and environmental situations, pregnancy induces complex biological modifications that have a significant role to modulate intrauterine milieu and ongoing fetal development [1]. The mother’s condition during pregnancy has profound effects on how the fetus grows and develops. Changes in the health of the pregnant mother can affect the condition of important organs of the fetus, such as the cardiovascular organs and the nervous system [1]. Studies have shown that exercise during pregnancy has beneficial effects on the condition of the fetus in various ways, such as increasing the secretion of growth factors [1].
Preventive treatments through pregnancy can be efficient methods modulating the mother-fetus unit. Physical activity through pregnancy can decrease complications in the mother and fetus during the advancement of intrauterine environment that might have permanent impacts on future health of offspring [2]. Exercise for a pregnant mother can reduce maternal complications. It also provides a better intrauterine environment for fetal growth, which will have lasting effects on the future health of the children [2]. Hypoxia-ischemia (HI) is a common cause of brain damage and long-term disability in human infants. Injuries such as sensory, motor, and cognitive impairment may remain with the child for the rest of her/his life [2, 3].
Due to a decrease in brain blood and/or oxygen flow, hypoxic-ischemia (HI) takes place which compromises the oxidative metabolism, resulting in a reducing in energy levels and increased glutamate release, resulting in excitotoxicity damage cascade, metabolic failure, alterations in neuron-glia coupling, and cell death [4, 5]. Neonatal HI occurs during pregnancy, delivery, or postnatal period, which includes decreased oxygenation or/and blood flow to the fetus [4].
Studies have shown that exercise during pregnancy has beneficial effects on the fetal nervous system. These effects include increased secretion of growth factors and increased neurogenesis [4]. It has been shown that exercise training enhances the antioxidant defense system in the brain regions of a rat [6]. Scientific evidences show the favorable effect of physical exercise on the balance between pro- and anti-inflammatory activities in the brain in the face of various disorders [7, 8]. It also enhances the potential of exercise therapy in reducing the risk of neuroinflammation disorders [7]. Inflammatory responses and oxidative stress are important factors in the spread of injury after neonatal hypoxia-ischemia [9].
Considering the fact that exercise can reduce oxidative stress and inflammation, this study evaluated the effect of treadmill exercise during pregnancy on the neonatal brain damage caused by HI in rats.
2. Materials and Methods
2.1. Animals
Twenty female Wistar rats (200-220 g) were provided from Laboratory Animal Research Center of Zahedan University of Medical Sciences, Zahedan, Iran. The animals were adapted to laboratory environment one week before beginning the experiment. They were kept in standard temperature (°C), on a 12/12 h light/dark cycle, with food and water available ad libitum.
The research protocol was confirmed by Faculty of Medicine Ethics Committee for animal Research of Zahedan University of Medical Sciences, (ethical code: IR.ZAUMS.REC.1399.514).
2.2. Experimental Design
Two female Wistar rats were maintained along with one male Wistar rat in a cage to pregnancy induction [9]. The animals’ vaginas were tested to find any sperm every morning, and if the test was positive, they were separated and maintained in other cages [9].
Pregnant rats were divided into two groups: (1) the group which not exercised during pregnancy (the pups of the sham and HI groups were chosen from the offsprings of these animals) and (2) the group which daily exercised through pregnancy (pups of the sham/EX and HI+exercise groups were chosen from offsprings of these animals). Offsprings were divided into four groups (20 rats in every group) after delivery: the (1) sham group: surgery was done in this group, and the right common carotid artery (CCA) was not occluded and hypoxia was not induced; (2) sham/EX group: animals of this group were also selected from dams who exercised during pregnancy and the right CCA of the rats was exposed, but not occluded and they did not experience hypoxia; (3) HI group: pups of this group were subjected to right CCA occlusion and exposed to 8% oxygen for 90 minutes; and (4) HI+exercise group: pups of this group were chosen from dams who exercised through pregnancy, and the right CCA of pups was occluded and then exposed to 8% oxygen for 90 minutes.
2.3. Exercise Protocol
Rats were trained to move on the treadmill (four-line animal treadmill) through pregnancy. Animals moved on treadmill as follows: (1) at 15 minutes in 5-7 meter/min without a slope; (2) treadmill training in 18 meter/min during 35 min in a slope of zero; (3) after one week, the rats in 18 meter/min during 40 min in a slope of 5°; and (4) the rats were located in the speed of 18 meter/min at 45 min in slope of 10° in the next week [10].
2.4. Neonatal Hypoxia-Ischemia Induction
For neonatal HI induction in rat pups, the Rice-Vannucci approach was utilized [9, 11]. To HI induction, 8-day-old pups were anesthetized by ketamine (100 mg/kg) and xylazin (10 mg/kg). Then, the right carotid artery (CCA) was separated from the vagus nerve and surrounding tissue and then CCA permanently occluded with 6.0 silk thread. Also, animals were permitted to recover for one hour (h) and exposed to 8% oxygen for 90 minutes [9]. Neurobehavioral tests were performed seven days after HI induction (postnatal 15th day), and the animals were sacrificed and brain tissues were gathered to measure the expression of Bcl-2 and Bax genes, BDNF, cerebral edema, infarct volume, inflammatory factors, and oxidative stress.
2.5. Assessment of Cerebral Edema and Infarction Volume
Pups were anesthetized (ketamine (100 mg/kg) and xylazin (10 mg/kg)) seven days after HI (15-day-old pups), and their heads isolated from the body. The brain was taken from the skull and then put on 10% formalin. Then, 6 micron slices were taken utilizing a rotary microtome (Leica RM 2135, Leica Instruments, Nussloch, Germany). Then, slices were stained with hematoxylin-eosin.
Their images were captured by a scanner (Scanjet, Hewlett-Packard, USA) and assessed utilizing ImageJ software (NIH), and the area of ischemic region was measured. At last, the following formula was utilized to compute ischemic area volume:
Volume of ischemic area [9, 12]:
The following formula was utilized to compute cerebral edema [9, 13]:
2.6. Biochemical Measurements
Furthermore, brain tissue samples were provided and located in a cold buffer (0.1 M phosphate-buffered saline, pH 7.4, involving protease inhibitor cocktail (Roche)); for 15 minutes, it was homogenized and centrifuged at 3500 rpm, and supernatants were gathered. TNF-α (Zellbio, Germany), C-reactive protein (CRP) (Zellbio, Germany), BDNF (Zellbio, Germany), total antioxidant capacity (TAC) (Zellbio, Germany), and total oxidant capacity (TOC) (Zellbio, Germany) were measured utilizing special kits.
2.7. Bax and Bcl-2 Expression Measurement
Utilizing RNase mini kit (Qiagen, USA), RNA extraction was done based on the manufacturer’s instructions and RNA was synthesized from cDNA samples. Also, microtubes were stored at -20°C.
2.8. Polymerase Chain Reaction
Polymerase chain reaction (PCR) was utilized for Bcl-2 expression, Bax genes as target genes, and β-actin as a structural gene for internal control and confirmation of PCR. PCR was handled by cDNA synthesized due to protocol and utilizing primers (Table 1). Primary denaturation was performed at 95°C for 5 min. Binding temperature for primer Bcl-2, Bax, and β-actin was identified at gradient temperature of 56 to 60°C for 30 seconds. The replication temperature for every cycle was 72°C for 20 seconds and for the primers 35 cycles and the latest replication of amplified DNA was performed for 5 minutes at 72°C. PCR product was electrophoresed on 1.5% agarose gel. Gene samples were incubated with the gene marker at 110 V for 30 min, and also, agarose gel was embedded in the dock gel and bands were visualized under UV light docking device (Bio-Rad, USA) and the ratio was identified. Due to the amount of β-actin gene of the same group and plotted, the target gene band density of every group was assessed.
Gene
Reference
Primer sequence (5-3)
Annealing (°C)
Bcl-2
13
F: CTGGTGGACAACATCGCTCTG
R: GGTCTGCTGACCTCACTTGTG
63
Bax
13
F: TCCACGATCGAGCAGA
R: AAGTAGAAGAGGGCAACC
52
β-Actin
13
F: ATTGTAACCAACTGGGACG
R: TTGCCGATAGTGATGACCT
55
