FIG 2 - uploaded by Masayuki Inui
Content may be subject to copyright.
Localization of the replication and stability regions. Construction of pMG101 derivatives is described in Table 1. The heavy horizontal lines indicate regions of plasmid pMG101 that were inserted into pHSG298. Replication was considered positive () when transformants were present and plasmid DNA was detected after alkaline lysis and gel electrophoresis and negative () when no transformants were obtained in three experiments. Plasmid stability in R. palustris was analyzed as described in Materials and Methods.
Source publication
A 15-kb cryptic plasmid was obtained from a natural isolate ofRhodopseudomonas palustris. The plasmid, designated pMG101, was able to replicate in R. palustris and in closely related strains of Bradyrhizobium japonicum and phototrophic Bradyrhizobium species. However, it was unable to replicate in the purple nonsulfur bacterium Rhodobacter sphaeroi...
Citations
... Then, based on pMG101, Escherichia coli-R. palustris shuttle vectors pMG103 (5.68 kb) and pMG105 (5.68 kb) were constructed, which were stably maintained in R. palustris (Inui et al., 2000). In R. palustris TIE-1, three genes crtE, hpnD and dxs were cloned into pMG103, and squalene production (15.8 mg/g DCW) was obtained . ...
Rhodopseudomonas palustris, a purple nonsulfur bacterium, is a bacterium with the properties of extraordinary metabolic versatility, carbon source diversity and metabolite diversity. Due to its biodetoxification and biodegradation properties, R. palustris has been traditionally applied in wastewater treatment and bioremediation. R. palustris is rich in various metabolites, contributing to its application in agriculture, aquaculture and livestock breeding as additives. In recent years, R. palustris has been engineered as a microbial cell factory to produce valuable chemicals, especially photofermentation of hydrogen. The outstanding property of R. palustris as a microbial cell factory is its ability to use a diversity of carbon sources. R. palustris is capable of CO2 fixation, contributing to photoautotrophic conversion of CO2 into valuable chemicals. R. palustris can assimilate short-chain organic acids and crude glycerol from industrial and agricultural wastewater. Lignocellulosic biomass hydrolysates can also be degraded by R. palustris. Utilization of these feedstocks can reduce the industry cost and is beneficial for environment. Applications of R. palustris for biopolymers and their building blocks production, and biofuels production are discussed. Afterward, some novel applications in microbial fuel cells, microbial electrosynthesis and photocatalytic synthesis are summarized. The challenges of the application of R. palustris are analyzed, and possible solutions are suggested.
... Colonization Pattern of SRB-109 on Sugarcane Plants SRB-109, an isolate from sugarcane roots exhibiting significant growth promotion effects, was selected for further study. To visualize the colonization patterns of SRB-109 on sugarcane plants, SRB-109 was labeled for GUS or red fluorescent protein (RFP) staining with pMG103-NPTII-GUS or pMG103-NPTII-RFP modified from pMG103-NPTII-GFP (Inui et al., 2000) using Sph I and EcoR I restriction endonuclease sites. Bacteria were labeled by electroporation . ...
Plant microbiota are of great importance for host nutrition and health. As a C 4 plant species with a high carbon fixation capacity, sugarcane also associates with beneficial microbes, though mechanisms underlying sugarcane root-associated community development remain unclear. Here, we identify microbes that are specifically enriched around sugarcane roots and report results of functional testing of potentially beneficial microbes propagating with sugarcane plants. First, we analyzed recruitment of microbes through analysis of 16S rDNA enrichment in greenhouse cultured sugarcane seedlings growing in field soil. Then, plant-associated microbes were isolated and assayed for beneficial activity, first in greenhouse experiments, followed by field trials for selected microbial strains. The promising beneficial microbe SRB-109, which quickly colonized both roots and shoots of sugarcane plants, significantly promoted sugarcane growth in field trials, nitrogen and potassium acquisition increasing by 35.68 and 28.35%, respectively. Taken together, this report demonstrates successful identification and utilization of beneficial plant-associated microbes in sugarcane production. Further development might facilitate incorporation of such growth-promoting microbial applications in large-scale sugarcane production, which may not only increase yields but also reduce fertilizer costs and runoff.
... 21,22 Native, stably maintained plasmids have been isolated from R. palustris and developed as expression vectors. 23 However, these have shown poor expression performance in reporter assays when compared to non-native plasmids. 12 Long-term, stable expression would be better achieved by chromosomal integration with cassettes under the control of strong promoters, along with the ability to manipulate different genes repeatedly within the organism without the persistence of selection markers. ...
... The resulting plasmid was introduced into S. meliloti Sm1021ΔbacA by tri-parental conjugation and into E. coli BW25113ΔsbmA by electroporation. The same USDA110 bclA-encoding PCR fragment was also introduced in plasmid pMG103 47 . First, the trp promoter was amplified with primers GTGCCGAATTCGGCAAATATACTGAAATAGGTGTTG (forward) and GAGTGCATGCGGTA CCGGATCCATGGAATCTAGATTTAAAGTACTTCGAA (reverse) and introduced into the EcoRI and SphI sites of pMG103. ...
Legumes harbor in their symbiotic nodule organs nitrogen fixing rhizobium bacteria called bacteroids.
Some legumes produce Nodule-specific Cysteine-Rich (NCR) peptides in the nodule cells to control
the intracellular bacterial population. NCR peptides have antimicrobial activity and drive bacteroids
toward terminal differentiation. Other legumes do not produce NCR peptides and their bacteroids are
not differentiated. Bradyrhizobia, infecting NCR-producing Aeschynomene plants, require the peptide
uptake transporter BclA to cope with the NCR peptides as well as a specific peptidoglycan-modifying
DD-carboxypeptidase, DD-CPase1. We show that Bradyrhizobium diazoefficiens strain USDA110 forms
undifferentiated bacteroids in NCR-lacking soybean nodules. Unexpectedly, in Aeschynomene afraspera
nodules the nitrogen fixing USDA110 bacteroids are hardly differentiated despite the fact that this host
produces NCR peptides, suggesting that USDA110 is insensitive to the host peptide effectors and that
nitrogen fixation can be uncoupled from differentiation. In agreement with the absence of bacteroid
differentiation, USDA110 does not require its bclA gene for nitrogen fixing symbiosis with these two
host plants. Furthermore, we show that the BclA and DD-CPase1 act independently in the NCR-induced
morphological differentiation of bacteroids. Our results suggest that BclA is required to protect the
rhizobia against the NCR stress but not to induce the terminal differentiation pathway.
... We used the green fluorescence protein GFPmut2 [18] as a reporter protein to screen for the activity of different expression vectors in R. palustris under aerobic conditions. We tested two different plasmids as candidate expression vectors: (1) the endogenously derived pMG105 [19]; and (2) the broad-host pBBR1MCS-2 [20]. For detection by immunoreaction, we introduced a C-terminal 6X His tag prior to the termination site with PCR by the reverse primer (Table 1). ...
Background
Rhodopseudomonas palustris is a versatile microbe that encounters an innate redox imbalance while growing photoheterotrophically with reduced substrates. The resulting excess in reducing equivalents, together with ATP from photosynthesis, could be utilized to drive a wide range of bioconversions. The objective of this study was to genetically modify R. palustris to provide a pathway to reduce n-butyrate into n-butanol for maintaining redox balance.
Results
Here, we constructed and expressed a plasmid-based pathway for n-butanol production from Clostridium acetobutylicum ATCC 824 in R. palustris. We maintained the environmental conditions in such a way that this pathway functioned as the obligate route to re-oxidize excess reducing equivalents, resulting in an innate selection pressure. The engineered strain of R. palustris grew under otherwise restrictive redox conditions and achieved concentrations of 1.5 mM n-butanol at a production rate of 0.03 g L⁻¹ day⁻¹ and a selectivity (i.e., products compared to the consumed substrate) of close to 40%. Since the theoretical maximum selectivity is 45%, the engineered strain converted close to its maximum selectivity.
Conclusions
The innate redox imbalance of R. palustris can be used to drive the reduction of n-butyrate into n-butanol after expression of a plasmid-based enzyme from a butanol-producing Clostridium strain.
Electronic supplementary material
The online version of this article (doi:10.1186/s13068-017-0864-3) contains supplementary material, which is available to authorized users.
... palustris pMG103. 22) A vector fragment containing a phytoene desaturase gene (crtI) and a chloramphenicol acetyltransferase gene (cat) was amplified with the inverse PCR using a primer set of 5′-CATCTA-GATTAAGGAGGTACCCATGCTCG and 5′-AATCTA-GAGTCGACCTGCAGAAAAAAAGCG, where XbaI sites were italicized, and pMG103ΩParsarsRcrtIcat as a template DNA to form an empty vector (EV) pMG103-ΩcrtIcat. FLmodE, CTmodE, and pMG103ΩcrtIcat were digested with XbaI, and FLmodE and CTmodE were separately ligated with an XbaI site of pMG103ΩcrtIcat to form pMG103ΩFLmodEcrtIcat and pMG103ΩCT-modEcrtIcat, respectively. ...
As molybdenum (Mo) is an indispensable metal for plant nitrogen metabolisms, accumulation of dissolved Mo into bacterial cells may connect to the development of bacterial fertilizers that promote plant growth. In order to enhance Mo bioaccumulation, nitrogen removal and light illumination were examined in anoxygenic photosynthetic bacteria (APB) because APB possess Mo nitrogenase whose synthesis is strictly regulated by ammonium ion concentration. In addition, an APB, Rhodopseudomonas palustris, transformed with a gene encoding Mo-responsive transcriptional regulator ModE was constructed. Mo content was most markedly enhanced by the removal of ammonium ion from medium and light illumination while their effects on other metal contents were limited. Increases in contents of trace metals including Mo by the genetic modification were observed. Thus, these results demonstrated an effective way to enrich Mo in the bacterial cells by the culture conditions and genetic modification.
... For complementation experiments in the ORS285 background, the bclA and bacA genes were transferred from the pRF771 plasmids as EcoRI-BamHI fragments into the plasmid pMG103 (Inui et al. 2000), which stably replicates in Bradyrhizobium sp. strain ORS285 (Bonaldi et al. 2010a). ...
Nodules of legume plants are highly integrated symbiotic systems shaped by millions of years of evolution. They harbor nitrogen-fixing rhizobium bacteria called bacteroids. Several legume species produce peptides called nodule-specific cysteine-rich (NCR) peptides in the symbiotic nodule cells which house the bacteroids. NCR peptides are related to antimicrobial peptides of innate immunity. They induce the endosymbionts into a differentiated, enlarged, and polyploid state.
The bacterial symbionts, on their side, evolved functions for the response to the NCR peptides. Here, we identified the bclA gene of Bradyrhizobium sp. strains ORS278 and ORS285, which is required for the formation of differentiated and functional bacteroids in the nodules of the NCR peptide-producing Aeschynomene legumes. The BclA ABC transporter promotes the import of NCR peptides and provides protection against the antimicrobial activity of these peptides. Moreover, BclA can complement the role of the related BacA transporter of Sinorhizobium
meliloti, which has a similar symbiotic function in the interaction with Medicago legumes.
... Out of 400 strains of PNSB (environmental isolates) screened for plasmids smaller than 20 kb, Inui, Roh, Zahn, and Yukawa (2000) identified one isolate, R. palustris S55, which contained a 15-kb cryptic plasmid named pMG101. The shuttle vector pMG101Km derived from this plasmid was transferred into other strains by electroporation and shown to replicate in other R. palustris strains and phototrophic Bradyrhizobium species, but not in R. sphaeroides ATCC 17023 or in non-phototrophic Rhizobium species. ...
... The shuttle vector pMG101Km derived from this plasmid was transferred into other strains by electroporation and shown to replicate in other R. palustris strains and phototrophic Bradyrhizobium species, but not in R. sphaeroides ATCC 17023 or in non-phototrophic Rhizobium species. A 3.0-kb restriction fragment containing the replication region of pMG101, including the repA and parA genes, has been sequenced (Inui et al., 2000;accession no. 031076) and shown to have a lower G + C content (57.9%) than the overall R. palustris genome. ...
... Curing of small endogenous plasmids from marine Rhodobacter sp. NKPB 002106 (Matsunaga et al., 1986), R. palustris S55 (Inui et al., 2000) and R. palustris CGA009 (Berne, Allainmat, & Garcia, 2005) gave no detectable phenotype. Furthermore, R. capsulatus strains B10 and AD2 cured of their single endogenous plasmids were found to be photosynthetically competent (Willison, 1990;Willison et al., 1987). ...
Corresponding authors: E-mail: gomelsky@uwyo.edu; jzeilst@bgsu.edu
... Indeed, a large amount of genomic information, as well as genetic tools, is now available concerning the photosynthetic bradyrhizobia. In particular, a plasmid that originated from Rhodopseudomonas palustris is stably maintained in ORS285 (5,21). Thanks to this plasmid, into which we introduced the GFP-encoding gene, it was possible to show in this study that intercellular invasion of soybean nodules could occur, although at a low frequency. ...
The ability of photosynthetic Bradyrhizobium strains ORS285 and ORS278 to nodulate soybeans was investigated. While the nod gene-deficient ORS278 strain induced bumps only on soybean roots, the nod gene-containing ORS285 strain formed nitrogen-fixing nodules. However, symbiotic efficiencies differed drastically depending
on both the soybean genotype used and the culture conditions tested.
... The fusion PCR product was then cloned into vector yT&A for sequencing and subcloning. R. palustris expression plasmid pMGCThydA was created from pMG105 (Inui et al. 2000; a generous gift from Hideaki Yukawa, Research Institute of Innovative Technology for the Earth, Japan) by inserting the SacI/XbaI fragment of yT&A-CThydA. To construct pMG105P, the promoter PpckA1 was PCR amplified with the pckA-F/R primer pair from genomic DNA from R. palustris 636, a local PNSB strain in Taiwan, and then inserted into the EcoRI and BamHI sites of pMG105. ...
The working temperature of a photobioreactor under sunlight can be elevated above the optimal growth temperature of a microorganism. To improve the biohydrogen productivity of photosynthetic bacteria at higher temperatures, a [FeFe]-hydrogenase gene from the thermophile Clostridium thermocellum was expressed in the mesophile Rhodopseudomonas palustris CGA009 (strain CGA-CThydA) using a log-phase expression promoter PpckA
to drive the expression of heterogeneous hydrogenase gene. In contrast, a mesophilic Clostridium acetobutylicum [FeFe]-hydrogenase gene was also constructed and expressed in R. palustris (strain CGA-CAhydA). Both transgenic strains were tested for cell growth, in vivo hydrogen production rate, and in vitro hydrogenase activity at elevated temperatures. Although both CGA-CThydA and CGA-CAhydA strains demonstrated enhanced growth over the vector control at temperatures above 38 °C, CGA-CThydA produced more hydrogen than the other strains. The in vitro hydrogenase activity assay, measured at 40 °C, confirmed that the activity of the CGA-CThydA hydrogenase was higher than the CGA-CAhydA hydrogenase. These results showed that the expression of a thermophilic [FeFe]-hydrogenase in R. palustris increased the growth rate and biohydrogen production at elevated temperatures. This transgenic strategy can be applied to a broad range of purple photosynthetic bacteria used to produce biohydrogen under sunlight.
