Figure - available via license: Creative Commons Attribution 3.0 Unported
Content may be subject to copyright.
In situ hybridization analysis of Mipu1 mRNA in infarct endothelium and myocardium. A: Normal heart; B: Sham heart; C: Infracted myocardium; D: Blood vessels in the infracted myocardium; E: Negative control of normal heart; F: Negative control of infracted myocardium (200×). * vs Normal, P < 0.05, n=6.
Source publication
Myocardial ischemic preconditioning up-regulated protein 1 (Mipu1) was cloned in our laboratory. Male Wistar rats were subjected to left anterior coronary artery ligation and sham-operation and sacrificed at 1 h, 3 h, 6 h, 12 h, 24 h, 3 d or 5 d after ligation. Expression of Mipu1 mRNA and protein were assessed by Northern blotting, real-time quant...
Contexts in source publication
Context 1
... In Situ Hybridization showed that not only cardiomyocytes and endothelial cells of normal heart expressed Mipu1 mRNA but also more than half of those adjacent to the infarct zone and sham-operated hearts showed weak Mipu1 protein ( Figure 3A and B). The cardiomyocytes and endothelial cells in the left ventricle of 6 h MI rats expressed Mipu1 more strongly than those of sham-operated hearts ( Figure 3C and 3D). ...Context 2
... In Situ Hybridization showed that not only cardiomyocytes and endothelial cells of normal heart expressed Mipu1 mRNA but also more than half of those adjacent to the infarct zone and sham-operated hearts showed weak Mipu1 protein ( Figure 3A and B). The cardiomyocytes and endothelial cells in the left ventricle of 6 h MI rats expressed Mipu1 more strongly than those of sham-operated hearts ( Figure 3C and 3D). Negative control of normal heart and infracted myocardium were shown in Figure 3E (200×). ...Citations
... ZNF667, an N-terminal KRAB/c 2 H 2 zinc-finger superfamily protein, was identified in our laboratory because of its upregulation during the myocardial ischemic preconditioning process (21). In our previous studies, ZNF667 has been shown to serve an essential role in protecting cardiomyocytes against ischemiareperfusion or oxidation stress-induced injury (23,25,36,37). In the present study, to investigate the effects of ZNF667 on angiogenesis following AMI and its therapeutic potential, a mouse model of AMI was established through LAd ligation as an ischemia-reperfusion model of mouse heart is unsuitable for the investigation of angiogenesis. ...
Zinc finger protein 667 (ZNF667, also referred as Mipu1), a widely expressed KRAB/C2H2‑type zinc finger transcription factor, can protect against hypoxic‑ischemic myocardial injury. Pro‑angiogenesis is regarded as a promising strategy for the treatment of acute myocardial infarction (AMI). However, whether ZNF667 is involved in the angiogenesis following AMI remains to be elucidated. The present study reported that the expression of ZNF667 in CD31‑positive endothelial cells (ECs) was upregulated in the heart of AMI mice. Hypoxic challenge (1% oxygen) promoted the mRNA and protein expression of ZNF667 in the human umbilical vein endothelial cells (HUVECs) in a time‑dependent manner. Moreover, ZNF667 promoted hypoxia‑induced invasion and tube formation of HUVECs. Mechanically, ZNF667 could directly bind to the promoter of anti‑angiogenic gene VASH1 and inhibit its expression. Consequently, VASH1 overexpression abolished hypoxic challenge or ZNF667 overexpression‑induced invasion and tube formation of HUVECs. Further bioinformatic analyses suggested that overexpression of ZNF667 or knockdown of VASH1‑induced differentially expressed genes in HUVECs were greatly enriched in the Wnt signaling pathway (DAAM1, LEF1, RAC2, FRAT1, NFATc2 and WNT5A). Together, these data suggested that ZNF667 facilitates myocardial ischemia‑driven angiogenesis through transcriptional repression of VASH1 and regulation of Wnt signaling pathway.
... Like other KRAB/C2H2 zinc-finger proteins, Mipu1 is a DNA-binding protein and binds to the specific DNA sequence TGTCTTATCGAA, with CTTA as the core sequence, and Mipu1 acts as a transcriptional repressor, as determined by a reporter gene assay [18,19]. It has been identified that Mipul could reduce H 2 O 2 -and TNF-α-induced H9c2 apoptosis, via repressing Fas and Bax expression [18,20,21]. What's more, we recently discovered that Mipu1 overexpression reduces lipid intake and CD36 expression of macrophages in the presence of oxLDL [22]. ...
... It was also shown that Mipu1 protein was localized to the nucleus of H9c2 cardiomyocytes and was up-regulated after treatment with H 2 O 2 [20]. Another observation indicated that over-expression of Mipu1 reduced the growth arrest induced by serum withdrawal in C2C12 myogenic cells [18]. ...
Background/Aims: Our recent data indicated that Mipu1 overexpression reduces lipid intake and CD36 expression of macrophages in the presence of oxLDL. However, the mechanism of Mipu1 inhibiting lipid accumulation in macrophages is not elucidated. Methods: Real-time quantitative polymerase chain reaction (PCR) and western blot analysis were used to detect expression of Mipu1 and CD36. The promoter activity of CD36 was studied using luciferase assays. Chromatin immunoprecipitation (ChIP) was used to show the recruitment of Mipu1 onto the CD36 promoter. High-performance liquid chromatography and Dil-labeled lipoprotein were used to detect cholesterol accumulation. Results: Here, we show that CD36 overexpression rescues oxLDL-induced cholesterol accumulation in RAW264.7-Mipu1 cells. Analysis of the mouse CD36 promoter revealed two potential Mipu1-response elements (MRE), one of which (from -237bp to -244bp, ACTTAC) was shown, using mutagenesis and deletion analysis, to be functional. Mipu1 was demonstrated to bind to CD36 promoter, and oxLDL treatment resulted in increases in their interaction as assessed by ChIP. Conclusions: It was demonstrated that Mipu1 inhibited the lipid accumulation of macrophages and it down-regulated CD36 expression in the presence of oxLDL.
... The rat zinc finger protein 667, ZNF667, provisionally named myocardial ischemic preconditioning upregulated protein 1 (Mipu1) in our lab due to its upregulation during myocardial ischemia/reperfusion, belongs to the KRAB/C 2 H 2 zinc finger proteins that contains a KRAB domain at its N-terminus and 14 zinc fingers at its C-terminus. Both the ZNF667 mRNA and protein are expressed abundantly and predominantly in the brain and heart [1,2]. It has also been shown that ZNF667 is a nuclear protein that is localized to the nucleus through its KRAB domain or the linker adjacent to its zinc finger region, unlike most of the KRAB/C 2 H 2 zinc finger proteins where their zinc finger motifs are required for nuclear targeting. ...
... The molecular mechanism is involved in its inhibiting Bax expression. Although Our previous studies have implied that Mipu1 may confer cytoprotection [1,5,6,26], it is in this study that we for the first time shows that ZNF667/Mipu1 is a cytoprotective protein in H9c2 cardiomyocytes at least during H 2 O 2 /Dox stress. ...
ZNF667/Mipu1, a C2H2-type zinc finger transcription factor, was suggested to play an important role in oxidative stress. However, none of the target genes or potential roles of ZNF667 in cardiomyocytes have been elucidated. Here, we investigated the functional role of ZNF667 in H9c2 cell lines focusing on its molecular mechanism by which it protects the cells from apoptosis. We found that ZNF667 inhibited the expression and the promoter activity of the rat proapoptotic gene Bax gene, and at the same time prevented apoptosis of H9c2 cells, induced by H2O2 and Dox. Western immunoblotting analysis revealed that ZNF667 also inhibited Bax protein expression, accompanied by attenuation of the mitochondrial translocation of Bax protein, induced by H2O2. EMSA and target detection assay showed that the purified ZNF667 fusion proteins could interact with the Bax promoter sequence in vitro, and this interaction was dependent upon the ZNF667 DNA binding sequences or its core sequence in the promoter. Furthermore, ChIP assay demonstrated that a stimulus H2O2 could enhance the ability of ZNF667 protein binding to the promoter. Finally, a reporter gene assay showed that ZNF667 could repress the activity of the Bax gene promoter, and the repression was dependent upon its binding to the specific DNA sequence in the promoter. Our work demonstrates that ZNF667 that confers cytoprotection is a novel regulator of the rat Bax gene, mediating the inhibition of the Bax mRNA and protein expression in H9c2 cardiomyocytes in response to H2O2 treatment.
... The zinc finger proteins that contain KRAB, also called KRAB zinc finger proteins (KRAB-containing zinc finger proteins, KZNF), make up almost one-third (290 kinds) of all zinc finger proteins (799 kinds). They are the largest transcription repressor family in mammals and play an important role in embryonic development, cell differentiation, cell transformation, and cell cycle regulation (14)(15)(16)(17)(18) (Table 1; [19][20][21][22][23][24][25][26][27]. ...
... In studies of rat myocardial ischemia-reperfusion, Mipu1 expression increased at 3 h of reperfusion, following 30 min of myocardial ischemia, reached its peak level 6 h later, and maintained that level until a further 12 h later. In addition, Mipu1 expression in H9c2 cells could be induced by hydrogen peroxide (26), and it had an obviously higher expression in cerebral cortex and hippocampus after 12 and 24 h of reperfusion, after 3 min of ischemic preconditioning, than that of the sham surgery groups (32,34). Our results indicated that Mipu1 mRNA expression was significantly increased during hypoxia-reoxygenation or H 2 O 2 stimulation in H9c2 cells (5,31). ...
... Being a zinc finger nuclear transcriptional repressor, its DNA binding sequence is 5-TGTCTTATCGAA-3, within which CTTA is the core sequence binding site (25). Recent studies have also shown that Mipu1 can reduce apoptosis of H9c2 induced by H 2 O 2 and tumor necrosis factor alpha (TNF-a), and can repress the expression of the apoptosis-related genes Fas and Bax (25)(26)(27). Overexpression of Mipu1 represses transcriptional activity of serum response element (SRE) and activator protein-l (AP-1), and inhibition of Mipu1 expression by RNAi can increase the transcriptional activity of SRE and AP-1; that is, Mipu1 may be involved in the function of SRE and AP-1 during the transcriptional regulation process and plays an important role in the pathological process of heart and vascular diseases through regulating the mitogen-activated protein kinase (MAPK) signaling pathway (35). ...
Myocardial ischemic preconditioning upregulated protein 1 (Mipu1) is a newly discovered upregulated gene produced in rats during the myocardial ischemic preconditioning process. Mipu1 cDNA contains a 1824-base pair open reading frame and encodes a 608 amino acid protein with an N-terminal Krüppel-associated box (KRAB) domain and classical zinc finger C2H2 motifs in the C-terminus. Mipu1 protein is located in the cell nucleus. Recent studies found that Mipu1 has a protective effect on the ischemia-reperfusion injury of heart, brain, and other organs. As a nuclear factor, Mipu1 may perform its protective function through directly transcribing and repressing the expression of proapoptotic genes to repress cell apoptosis. In addition, Mipu1 also plays an important role in regulating the gene expression of downstream inflammatory mediators by inhibiting the activation of activator protein-1 and serum response element.
... It has an open reading frame of 1827 bp for encoding 608 amino acids with a KRAB domain and 14 C-terminal C2H2 zinc fingers (Yuan et al., 2004;Jiang et al., 2007). It has been proved that Mipul can inhibit the apoptosis of H9c2 induced by H 2 O 2 and TNF-a, and repress the expression of apoptosis-related genes Fas and Bax ( Jiang et al., 2007;Wang et al., 2009). Recently, Wang et al. (2009) reported that hypoxia-inducible factor-1a (HIF-1a) bound to the hypoxia response element within the Mipu1 promoter region and promoted its transcription, the cytoprotection of HIF-1 against H 2 O 2 -mediated injury in H9c2 cells partly through the regulation of Mipu1 expression (Wang et al., 2013). ...
... It has been proved that Mipul can inhibit the apoptosis of H9c2 induced by H 2 O 2 and TNF-a, and repress the expression of apoptosis-related genes Fas and Bax ( Jiang et al., 2007;Wang et al., 2009). Recently, Wang et al. (2009) reported that hypoxia-inducible factor-1a (HIF-1a) bound to the hypoxia response element within the Mipu1 promoter region and promoted its transcription, the cytoprotection of HIF-1 against H 2 O 2 -mediated injury in H9c2 cells partly through the regulation of Mipu1 expression (Wang et al., 2013). However, the role of Mipu1 overexpression on oxLDL-induced lipid accumulation in macrophages has not been elucidated. ...
Mipu1 (myocardial ischemic preconditioning upregulated protein 1) is a novel N-terminal Kruppel-associated box (KRAB)/C2H2 zinc finger superfamily protein, that displays a powerful effect in protecting H9c2 cells from oxidative stress-induced cell apoptosis. The present study aims to investigate the effect of Mipu1 overexpression on oxidized low-density lipoprotein (oxLDL)-induced foam cell formation, cell apoptosis, and its possible mechanisms. New Zealand healthy rabbits were used to establish atherosclerosis model, and serum levels of triglycerides, total cholesterol, high-density lipoprotein cholesterol, and low-density lipoprotein cholesterol were detected by an automatic biochemical analyzer. Sudan IV staining was used to detect atherosclerotic lesions. The RAW264.7 macrophage cell line was selected as the experimental material. Oil red O staining, high-performance liquid chromatography, and Dil-labeled lipoprotein were used to detect cholesterol accumulation qualitatively and quantitatively, respectively. Flow cytometry was used to determine cell apoptosis. Real-time quantitative PCR was used to detect the mRNA expression of the main proteins that are associated with the transport of cholesterol, such as ABCA1, ABCG1, SR-BI, and CD36. Western blot analysis was used to detect the protein expression of Mipu1. There were atherosclerotic lesions in the high-fat diet group with Sudan IV staining. High-fat diet decreased Mipu1 expression and increased CD36 expression significantly at the 10th week compared with standard-diet rabbits. Mipu1 overexpression decreased oxLDL-induced cholesterol accumulation, oxLDL uptake, cell apoptosis, and cleaved caspase-3. Mipu1 overexpression inhibited the oxLDL-induced CD36 mRNA and protein expression, but it did not significantly inhibit the mRNA expression of ABCA1, ABCG1, and SR-BI. Mipu1 overexpression inhibits oxLDL-induced foam cell formation and cell apoptosis. Mipu1 overexpression reduces the lipid intake of macrophages and might be associated with the downregulation of CD36 expression in the presence of oxLDL.
... It is termed as Mipu1 because of its up-regulation after myocardial ischemic preconditioning. Mipu1 has an open reading frame of 1 827 bp for encoding 608 amino acids which contains a Krϋppel-associated box (KRAB) domain at the N terminal, 14 successive C2H2 type zinc finger domains at the C terminal and a bipartite nuclear targeting sequence at amino acid residues 193 to 277 [12,13]. Mipu1 is expressed abundantly and predominantly in brain and heart and localizes in the nucleus within cell [14,15]. ...
... After adding appropriate 6×SDS loading buffer, equal amounts of protein (20-30 μg) were loaded and separated on 10% SDS-PAGE and then transferred electrophoretically onto nitrocellulose membranes. Blots were blocked with 2% albumin in TBST (20 mM Tris-HCl, pH 8.0, 150 mM NaCl, 0.1% Tween-20) overnight at 4 °C and then probed with rabbit-anti-HIF-1α (Santa Cruz), mouse-anti-β-actin (Sigma) or rabbit-anti-Mipu1 antiserum (produced in our lab as described previously [13][14][15]), respectively. The immune complexes were visualized with an HRP-conjugated secondary antibody and DAB staining kit (Boster Biological Technology, China). ...
... Our previous reports evidenced that Mipu1 was up-regulated in rat heart following a transient myocardial ischemiareperfusion procedure and exhibited cytoprotection against oxidative stress and serum deprival [12,13,15]. However, its biological functions and regulatory expression are still not well documented. ...
Mipu1 (myocardial ischemic preconditioning up-regulated protein 1), recently identified in our lab, is a novel zinc-finger transcription factor which is up-regulated during ischemic preconditioning. However, it is not clear what transcription factor contributes to its inducible expression. In the present study, we reported that HIF-1 regulates the inducible expression of Mipu1 which is involved in the cytoprotection of HIF-1α against oxidative stress by inhibiting Bax expression. Our results showed that the inducible expression of Mipu1 was associated with the expression and activation of transcription factor HIF-1 as indicated by cobalt chloride (CoCl2) treatment, HIF-1α overexpression and knockdown assays. EMSA and luciferase reporter gene assays showed that HIF-1α bound to the hypoxia response element (HRE) within Mipu1 promoter region and promoted its transcription. Moreover, our results revealed that Mipu1 inhibited the expression of Bax, an important pro-apoptosis protein associated with the intrinsic pathway of apoptosis, elevating the cytoprotection of HIF-1 against hydrogen peroxide (H2O2)-mediated injury in H9C2 cells. Our findings implied that Bax may be a potential target gene of transcription factor Mipu1, and provided a novel insight for understanding the cytoprotection of HIF-1 and new clues for further elucidating the mechanisms by which Mipu1 protects cell against pathological stress.
... Consequently, PDIA3 seems to be an essential element in pathogenesis of hyperoxia-induced lung injury by regulating apoptosis in lung endothelial cells. Zinc finger protein 667 (ZNF667, MIPU1) is a protein of 608 amino acids with 14 C-terminal C 2 H 2 zinc fingers[47]. The expression of ZNF667 was up-regulated after oxidative stress to rat myocytes, suggesting an involvement in regulating oxidant-mediated apoptosis[47,48]. ...
... Zinc finger protein 667 (ZNF667, MIPU1) is a protein of 608 amino acids with 14 C-terminal C 2 H 2 zinc fingers[47]. The expression of ZNF667 was up-regulated after oxidative stress to rat myocytes, suggesting an involvement in regulating oxidant-mediated apoptosis[47,48]. In sharp contrast to these data, we could prove down-regulation after NH in the lung (IF =-3.96;Table 2). ...
An inspiratory oxygen fraction of 1.0 is often required to avoid hypoxia both in many pre- and in-hospital situations. On the other hand, hyperoxia may lead to deleterious consequences (cell growth inhibition, inflammation, and apoptosis) for numerous tissues including the lung. Whereas clinical effects of hyperoxic lung injury are well known, its impact on the expression of lung proteins has not yet been evaluated sufficiently. The aim of this study was to analyze time-dependent alterations of protein expression in rat lung tissue after short-term normobaric hyperoxia (NH). After approval of the local ethics committee for animal research, N = 36 Wistar rats were randomized into six different groups: three groups with NH with exposure to 100 % oxygen for 3 h and three groups with normobaric normoxia (NN) with exposure to room air (21 % oxygen). After the end of the experiments, lungs were removed immediately (NH0 and NN0), after 3 days (NH3 and NN3) and after 7 days (NH7 and NN7). Lung lysates were analyzed by two-dimensional gel electrophoresis (2D-GE) followed by peptide mass fingerprinting using mass spectrometry. Statistical analysis was performed with Delta 2D (DECODON GmbH, Greifswald, Germany; ANOVA, Bonferroni correction, p < 0.01). Biological functions of differential regulated proteins were studied using functional network analysis (Ingenuity Pathways Analysis, IPA). pO2 was significantly higher in NH-groups compared to NN-groups (581 ± 28 vs. 98 ± 12 mmHg; p < 0.01), all other physiological parameters did not differ. Expression of 14 proteins were significantly altered: two proteins were up-regulated and 12 proteins were down-regulated. Even though NH was comparatively short termed, significant alterations in lung protein expression could be demonstrated up to 7 days after hyperoxia. The identified proteins indicate an association with cell growth inhibition, regulation of apoptosis, and approval of structural cell integrity.
Background:
Macrophages participate in all stages of the inflammatory response, and the excessive release of inflammatory mediators and other cytokines synthesized and secreted by macrophages is fundamentally linked to an uncontrolled inflammatory response. The zinc finger 667 (ZNF667) protein, a novel DNAbinding protein, has been shown to play a vital role in oxidative stress. However, none of the target genes in macrophages or the potential roles of ZNF667 have been elucidated to date.
Objectives:
The present study was designed to investigate the effects of ZNF667 on LPS-induced inflammation in macrophages.
Methods:
The RAW264.7 macrophage cell line was selected as a model system. Inflammatory response-related gene expression levels and phosphorylation levels of PI3K, AKT, and mTOR were detected in LPS-treated macrophages via RT-PCR and western blotting, respectively.
Results:
We found that LPS resulted in the up-regulation of ZNF667 in macrophages and a peak response in ZNF667 protein expression levels when used at a concentration of 100 ng/mL. ZNF667 overexpression significantly inhibited the LPS-induced up-regulation of iNOS, and IL-1β mRNA and protein expression levels, together with the secretion of IL-1β, IL-6, and TNF-α. ZNF667 overexpression also inhibited PI3K, AKT, and mTOR hyperphosphorylation and had no effect on the phosphorylation of NF-κB p65, ERK1/2, MAPK p38, and the transcriptional activity of NF-κB in macrophages. The up-regulation of ZNF667 inhibited the levels of expression of HK2 and PFKFB3, glucose consumption, and lactate production in LPS-stimulated macrophages. The up-regulation of mRNA levels of LPS-induced glycolytic genes HK2 and PFKFB3 and the increased mRNA expression of pro-inflammatory cytokines (IL-1β and iNOS) were abolished by hexokinase inhibitor 2-DG in ZNF667-deficient macrophages. Meanwhile, glucose consumption and lactate production were abrogated in macrophages when cells were treated with the specific mTOR inhibitor RPM.
Conclusion:
Our results demonstrate that ZNF667 suppressed LPS-stimulated RAW264.7 macrophage inflammation by regulating mTOR-dependent aerobic glycolysis.
The cyclic AMP (cAMP)/protein kinase A (PKA) cascade plays a central role in cardiomyocyte proliferation and apoptosis. Here, we show that H(2)O(2) stimulates expression of the antiapoptotic myocardial ischemic preconditioning up-regulated protein 1 (Mipu1) gene in H9c2 cardiomyocytes through a pathway involving the cAMP-response element binding protein (CREB). Stimulation of H9c2 cardiomyocytes with H(2)O(2) resulted in increased Mipu1 promoter activity. Analysis of the rat Mipu1 promoter revealed two potential cAMP-response elements, one of which (CRE-II, TGTGGATGTTGACGAGCTTGT) was shown, using mutagenesis and deletion analysis, to be functional. Subsequent studies established that H(2)O(2) increased phosphorylation of CREB serine 133 through a pathway involving PKA activation. Phospho-CREB was demonstrated to bind to CRE-II of the Mipu1 promoter, and H(2)O(2) treatment resulted in increases in their interaction as assessed by ChIP. Furthermore, H(2)O(2)-mediated up-regulation of Mipu1 protein expression was abrogated by the suppression of CREB expression with small interfering RNA of CREB. It was demonstrated that the H(2)O(2)-induced up-regulation of Mipu1 in H9c2 cardiomyocytes was mediated by cAMP/PKA-dependent CREB activation.
The aim was to identify maternal risk factors in women giving birth to girls with Turner syndrome (TS) and to describe the characteristics of newborns with TS.
The Swedish Genetic Turner Register was cross-linked with the Swedish Medical Birth Register. Between 1973 and 2005, 494 children with TS were born. Maternal age, parity, height, smoking habits and neonatal characteristics; mode of delivery, gestational age, size at birth and Apgar score, were compared with women in the general population who gave birth to girls during the same period.
More women with advanced maternal age (40+) delivered girls with TS, 3.2% when compared with 1.8% in the general population [OR 1.83, 95% confidence interval (CI) 1.09-3.08, after adjustment for year of birth]. Maternal height was inversely associated with TS pregnancies (P = 0.005). Late preterm birth occurred in newborns with TS in 10.5% when compared with 4.8% in the general population (OR 2.23; 95% CI: 1.67-2.97, after adjustment for year of birth and maternal age). Newborns with TS had birthweight less than -2SD in 17.8% and birth length less than -2SD in 21.0% when compared with 3.5 and 3.4%, in the general population (OR 6.55; 95% CI: 5.12-8.38 and OR 8.69; 95% CI: 6.89-10.97, after adjustment for year of birth and maternal age).
Advanced maternal age and short stature were risk factors for giving birth to a girl with TS. More TS girls were born late preterm and were smaller for gestational age than non-TS girls in the general population.
