Table 1 - uploaded by Stuart C Clarke
Content may be subject to copyright.
Source publication
A serotype 1 disease-causing pneumococcus possessing a truncated xanthine phosphoribosyltransferase (xpt) housekeeping gene is described. The deletion is within the gene region used for multi-locus sequence typing (MLST) and may have occurred through genetic transformation or capsule switch between clones. The identification of this deletion in a c...
Contexts in source publication
Context 1
... pneumococcal strain 04-1837 was characterized as being serotype 1 (Table 1). During nucleotide sequence analysis a 39 codon deletion was found in the xpt gene (Fig. 1) and this allele correponded to allele 113 in the pneumococcal MLST database. ...
Context 2
... presence of the allele in this strain, however, led to the description of a new combination of alleles and therefore a new ST (ST 1346). The xpt allele 113 matched with that found previously in other strains from the USA (Table 1). However, these strains were all serotype 4 and ST 695. ...
Context 3
... presence of xpt 113 in serotype 1 could be due to genetic transfer of the xpt allele in question but could also be due to serotype switch, although this is less likely since the STs associated with each serotype are different (STs 695 and 1346). Although the xpt gene region associated with the deletion has a relatively high polymorphism rate compared to other MLST genes within the pneumococcal MLST scheme, xpt is a housekeeping gene that is required for the G TG CACAGTCCAA ATCGGTA G GATT C 301 310 320 330 340 350 CCAGAGGACAAGGTTTTGATTATCGACGATTTCCTTGCTAATGGCCAAGC GAGA ATC TTCCAAGATGG CGT TTTGC TGAAAAAGCA T CC 351 360 370 380 390 400 TGCTAAAGGCTTGATTCAAATCATCGAACAGGCCGGTGCCACAGTCCAAG TCCT TCAC TGC G-------------------------------- -- 401 410 420 430 440 450 CTATCGGTATCGTGATTGAGAAATCCTTCCAAGATGGTCGTGATTTGCTT -------------------------------------------------- ...
Context 4
... presence of xpt 113 in serotype 1 could be due to genetic transfer of the xpt allele in question but could also be due to serotype switch, although this is less likely since the STs associated with each serotype are different (STs 695 and 1346). Although the xpt gene region associated with the deletion has a relatively high polymorphism rate compared to other MLST genes within the pneumococcal MLST scheme, xpt is a housekeeping gene that is required for the G TG CACAGTCCAA ATCGGTA G GATT C 301 310 320 330 340 350 CCAGAGGACAAGGTTTTGATTATCGACGATTTCCTTGCTAATGGCCAAGC GAGA ATC TTCCAAGATGG CGT TTTGC TGAAAAAGCA T CC 351 360 370 380 390 400 TGCTAAAGGCTTGATTCAAATCATCGAACAGGCCGGTGCCACAGTCCAAG TCCT TCAC TGC G-------------------------------- -- 401 410 420 430 440 450 CTATCGGTATCGTGATTGAGAAATCCTTCCAAGATGGTCGTGATTTGCTT -------------------------------------------------- ...
Citations
... Those genes were chosen based on Streptococcus spp. housekeeping genes (Diggle and Clarke 2005, Ip et al. 2006, Finn et al. 2021, as no conserved gene has been identified for S. didelphis yet. Sequence data of the dnaN , gki , pros , and xpt genes from 16 Streptococcus spp. ...
... We analyzed dnaN , gki , pros , and xpt genes, which are conserved in Streptococcus spp. ( dnaN , gki , pros , and xpt ) (Diggle and Clarke 2005, Ip et al. 2006, Finn et al. 2021, revealing that S. didelphis LBVP100/21, LBVP101/21, and the reference strain were grouped in the same branch, suggesting that they share the same sequence type (Fig. 3 b). Our findings indicate that the selected genes are also conserved in S. didelphis genomes being suitable targets for multilocus typing. ...
Streptococcus didelphis was reported once as related to severe infections in opossums. Thus, we present the first comprehensive whole-genome characterization of clinical S. didelphis strains isolated from white-eared opossums (Didelphis albiventris). Long-read whole-genome sequencing was performed using the MinION platform, which allowed the prediction of several genomic features. We observed that S. didelphis genomes harbor a cluster for streptolysin biosynthesis, and a conserved genomic island with genes involved in transcriptional regulation (arlR) and transmembrane transport (bcrA). Antimicrobial resistance genes for several drug classes were found including beta-lactam, which is the main antimicrobial class used in Streptococcus spp. infections; however no phenotypical resistance was observed. In addition, we predicted the presence of 33 virulence factors in the analyzed genomes. High phylogenetic similarity was observed between clinical and reference strains, yet no clonality was suggested. We also proposed dnaN, gki, pros, and xpt as housekeeping candidates to be used in S. didelphis sequence typing. This is the first whole-genome characterization of S. didelphis, whose data provides important insights on its pathogenicity.
... Strain B1900 was nontypeable by MLST due to the absence of the xpt gene, one of seven housekeeping genes used in sequence typing. The xpt gene is required for the synthesis of xanthine phosphoribosyltransferase, to convert xanthine to xanthosine 59-monophosphate (8). The B1900 genome predicted two other purine phosphoribosyltransferases (hypoxanthineand guanine-xanthine phosphoribosyltransferases), as reported in the Escherichia coli purine salvage pathway (9). ...
Serotype 3 Streptococcus pneumoniae is associated with major invasive pneumococcal diseases in humans. We report the circularized 2.0-Mbp complete genome sequence of invasive serotype 3 S. pneumoniae strain B1900, untypeable by multilocus sequence typing (MLST). This strain was isolated from the brain of an infant rhesus monkey (Macaca mulatta) that suddenly died of meningitis with no clinical symptoms.
... The PCR for these two isolates was repeated three times after two independent DNA extractions and purifications, and identical band patterns appeared each time. Similar MLST identification problems have been observed in other studies (Brueggemann et al., 2013;Diggle and Clarke, 2005). Hence, it was not possible to establish a ST for these two isolates, and they were therefore not included in the data analysis. ...
Streptococcus pneumoniae is a major cause of morbidity and mortality worldwide. Pneumococcal strains are classified according to their capsular polysaccharide and more than 90 different serotypes are currently known.
In this project, three distinct groups of pneumococcal carriage isolates from Ghana were investigated; isolates from healthy children in Tamale and isolates from both healthy and children attending the outpatient department at a hospital in Accra. The isolates were previously identified and characterized by Gram staining, serotyping and susceptibility to penicillin. In this study, isolates of the common serotype 19F were further investigated by Multi-Locus Sequence Typing (MLST).
Overall, 14 different Sequence Types (STs) were identified by MLST, of which nine were novel based on the international MLST database. Two clones within serotype 19F seem to circulate in Ghana, a known ST (ST 4194) and a novel ST (ST 9090). ST 9090 was only found in healthy children in Accra, whereas ST 4194 was found equally in all children studied. In the MLST database, other isolates of ST 4194 were also associated with serotype 19F, and these isolates came from other West African countries. The majority of isolates were penicillin intermediate resistant.
In conclusion, two clones within serotype 19F were found to be dominating in pneumococcal carriage in Accra and Tamale in Ghana. Furthermore, it seems as though the clonal distribution of serotype 19F may be different from what is currently known in Ghana in that many new clones were identified. This supports the importance of continued monitoring of pneumococcal carriage in Ghana and elsewhere when vaccines, e.g. PCV-13, have been introduced to monitor the possible future spread of antimicrobial resistant clones.
... The importance of examining pnemococcal strains with variations in allelic pattern (i.e. truncation) was previously discussed by Diggle and Clarke (Diggle and Clarke 2005). ...
In the United States, Streptococcus pneumoniae is the leading cause of community-acquired pneumonia and invasive bacterial disease. As antimicrobial resistance increases, it will become critical to determine if strains circulating in a population are likely to cause invasive pneumococcal disease (IPD). This is possible by comparison of an isolate's genotype to strains known to be invasive. In this work, we compared pulse-field gel electrophoresis (PFGE) and multilocus sequence typing (MLST), comparative genomic hybridization (CGH) and multi-invasive-locus sequence typing (MILST) for their ability to distinguish between known IPD causing and carrier strains using phylogenetic analyses. In addition, we assess the ability of these techniques to determine true clones from highly related strains. The resulting trees suggest that despite similar overall topologies, the clearest picture of invasiveness and genetic relatedness can be viewed when typing methods are used collectively.
... In pneumococcus, xpt allele 113 has a large internal in-frame deletion. Our finding confirms that large deletions involving xpt can occur that may lead to difficulties in applying the MLST scheme or analyzing the MLST data (8). ...
A total of 105 multiple-antibiotic-resistant invasive pneumococcal isolates recovered in Italy from 2001 to 2003 were genetically
characterized. Of these, 40 were penicillin-nonsusceptible (PNSSP) and 65 were penicillin-susceptible (PSSP) Streptococcus pneumoniae strains. Among the PNSSP isolates, 8 and 11 different restriction profiles were obtained for the pbp2b and pbp2x genes, respectively. Clonal groups were established on the basis of analysis of both pulsed-field gel electrophoresis (PFGE)
types and multilocus sequence typing (MLST). Several international clones, such as Spain23F-1/ST81, Spain6B-2/ST90, Spain9V-3/ST156, and Sweden15A-25/ST263, were identified among the PNSSP isolates. Other, smaller clones, such as the minor Spanish 19F clone/ST88 and Denmark14-32/ST230, were also found. Among the PSSP isolates, clones related to England14-9/ST9, Greece6B-22/ST273, and Portugal19F-21/ST177 were found. In addition, two large clones comprised nonvaccine serotypes. One, comprising serotype 3 isolates, corresponded
to the clone Netherlands3-31/ST180; the other, comprising serotype 15B/C isolates, ST474, was not related to any previously described clone. Two small
clusters related to the newly described clones Greece21-30/ST193 and Netherlands15B-37/ST199 included isolates with unrelated PFGE profiles. An unusual finding was the inability to obtain the MLST allelic
profile for an isolate of serotype 19A, belonging to the Sweden15A-25/ST263 clone, due to a large deletion of the xpt gene. Capsular switching was observed among both PNSSP and PSSP isolates and involved also serotypes not included in the
7-valent pneumococcal conjugate vaccine (PCV7), such as serotypes 15B/C and 19A. Since antibiotic-resistant nonvaccine serotype
clones are present in Italy, continuous monitoring of pneumococcal epidemiology should be carried out in the PCV7 era.
