Dopamine receptor is required for TPB. The photographs of TPB shown in each panel are representatives from repeated experiments. ( A ) TPB of DopR mutant dumb 3 / dumb 3 . ( B ) TPB of 

Contexts in source publication

Context 1

... UAS- DopR transgenic flies with standard microinjection methods. TPB was performed as described previously [1]. Files were incubated under 12 hr:12 hr dark:light cycle for 4 days before TPB assays. A linear temperature gradient from 15 to 45 u C was established along the aluminium block. All TPB assays were done in a room with 35 6 5% relative humidity. The AI Low and AI High were calculated as shown in Figure 1B. A mixed population of both sexes was tested for TPB. The number of flies was recorded and processed using Microsoft Excel. The AI Low or AI High of each tested fly line was compared with the AI Low or AI High of the control fly lines and then t-tests were performed. *, p , 0.05; **, p , 0.01. Two to three days old flies were raised on drug-containing food for 4 additional days and tested. Melted pre-made standard dextrose media were blended with drugs or the same amount of distilled water, their solvent. As the final drug concentrations, 20 mM a -methyl-p-tyrosine methyl ester (AMPT) (Sigma) and 20 mM 3-hydroxy benzyl hydrazine (HBH) (Sigma) were used. The standard dextrose media contain dextrose 70 g, yeast flake 50 g, cornmeal 35.3 g, agar 5 g, tegosept 7.3 ml and propionic acid 4.7 ml in 1 L total volume. To induce TNT and Kir2.1 expression conditionally in dopaminergic neurons, we crossed UAS-TNT ; tub - Gal80 ts or UAS-Kir2.1/CyO ; tub-Gal80 ts flies with TH-Gal4 and DAT-Gal4 flies. These flies were incubated and transferred to new culture bottles periodically at 18 u C. Eclosed F1 progenies of TH- Gal4 . TNT ; tub - Gal80 ts / + , TH-Gal4 . Kir2.1 ; tub - Gal80 ts / + , or DAT-Gal4 . Kir2.1 ; tub - Gal80 ts / + were collected and aged for 3 days at 18 6 C before the TPB assay. For TNT or Kir2.1 induction, the flies were transferred from 18 u C to 32 u C and incubated for 16 hr before the TPB assays. Heterozygous Gal4 flies and UAS- TNT/ + ; tub - Gal80 ts / + or UAS-Kir2.1/ + ; tub-Gal80 ts / + files were used as controls. To confirm various brain-specific Gal4 fly lines ( c309, MB247 , c739 , 1471 , c161 and OK348 ), they were combined with UAS- LacZ . Adult brains were removed from the head capsules and fixed in 4% paraformaldehyde in phosphate buffered saline (PBS) for 30 min, and rinsed in PBST (PBS containing 0.5% triton X-100). Brains were incubated with anti- b -galactosidase (1:1000; Promega) and then incubated with the appropriate red fluorescent labelled secondary antibody (Jackson Laboratories). To verify the DopR expression in w and dumb /dumb fly brains, rabbit anti-DopR antibody (1:1250, From Wolf FW [36]) was used. Confocal analysis was performed on a Zeiss LSM5 microscope. Figure S1 Additional TPB graph data of c309 . DopR;dumb / dumb 3 , MB247 . DopR;dumb 3 /dumb 3 , c309 . DopR;Df(3R)red-P52/ + , and MB247 . DopR;Df(3R)red-P52/ + flies. (A) TPB of c309/ + ;dumb 3 /dumb 3 , UAS-DopR/ + ;dumb 3 /dumb 3 , and c309 . DopR; dumb 3 /dumb 3 . (B) TPB of MB247/ + ;dumb 3 /dumb 3 , UAS-DopR; dumb 3 /dumb 3 , and MB247 . DopR;dumb 3 /dumb 3 . (C) TPB of c309/ + ;Df(3R)red-P52/ + , UAS-DopR;Df(3R)red-P52/ + , and c309 . DopR; Df(3R)red-P52/ + . (D) TPB of MB247/ + ;Df(3R)red-P52/ + , UAS- DopR;Df(3R)red-P52/ + , and MB247 . DopR;Df(3R)red-P52/ + . The AI Low or AI High of each tested fly line was compared with the AI Low or AI High of w 1118 and then t-tests were performed. **, p , 0.01. Found at: doi:10.1371/journal.pgen.1001346.s001 (1.12 MB TIF) Figure S2 Expression patterns of Gal4 lines. (A) Gal4 expression pattern of line c309 in adult brain. Distinct expression is detected in widespread regions including the ab and c lobes. (B) MB247 showed expression in the ab and c lobes. (C) c739 showed expression in the ab lobes. (D) 1471 expressed GAL4 in the c lobe. (E) c161 expressed GAL4 in the ellipsoid body. (F) OK348 showed expression in the fan-shaped body. Found at: doi:10.1371/journal.pgen.1001346.s002 (1.24 MB TIF) Table S1 Statistical analysis of the results shown in Figure 2. Student’s t-tests were performed. N, Number of tests. n, number of flies tested. s.d., standard deviation. s.e.m., standard error. Found at: doi:10.1371/journal.pgen.1001346.s003 (0.34 MB TIF) Table S2 Statistical analysis of the results shown in Figure 3. Student’s t-tests were performed. N, Number of tests. n, number of flies tested. s.d., standard deviation. s.e.m., standard error. Found at: doi:10.1371/journal.pgen.1001346.s004 (0.30 MB TIF) Table S3 Statistical analysis of the results shown in Figure 4. Student’s t-tests were performed. N, Number of tests. n, number of flies tested. s.d., standard deviation. s.e.m., standard error. Found at: doi:10.1371/journal.pgen.1001346.s005 (0.26 MB TIF) Table S4 Statistical analysis of the results shown in Figure 5. Student’s t-tests were performed. N, Number of tests. n, number of flies tested. s.d, standard deviation. s.e.m., standard error. Found at: doi:10.1371/journal.pgen.1001346.s006 (0.93 MB TIF) Tabls S5 Statistical analysis of the results shown in Figure 6. Student’s t-tests were performed. N, Number of tests. n, number of flies tested. s.d., standard deviation. s.e.m., standard error. Found at: doi:10.1371/journal.pgen.1001346.s007 (0.26 MB TIF) Table S6 Statistical analysis of the results shown in Figure 7. Student’s t-tests were performed. N, Number of tests. n, number of flies tested. s.d., standard deviation. s.e.m., standard error. Found at: doi:10.1371/journal.pgen.1001346.s008 (0.27 MB TIF) Table S7 Statistical analysis of the results shown in Figure 8. Student’s t-tests were performed. N, Number of tests. n, number of flies tested. s.d., standard deviation. s.e.m., standard error. Found at: doi:10.1371/journal.pgen.1001346.s009 (0.27 MB TIF) Table S8 Statistical analysis of the results shown in Figure 9. Student’s t-tests were performed. N, Number of tests. n, number of flies tested. s.d., standard deviation. s.e.m., standard error. Found at: doi:10.1371/journal.pgen.1001346.s010 (0.27 MB TIF) Table S9 Statistical analysis of the results shown in Figure 10. Student’s t-tests were performed. N, Number of tests. n, number of flies tested. s.d., standard deviation. s.e.m., standard error. Found at: doi:10.1371/journal.pgen.1001346.s011 (0.27 MB ...

Context 2

... + flies showed almost normal TPB (Figure 8A). The shifted axis of their distribution profile returned to 24 u C, and their AI Low and AI High showed no difference with the avoidance indices of wild type control w 1118 (Figure 8A and Table S7). Consistently, c309 . DopR; Df(3R)red-P52/ + flies also showed rescued TPB compared with c309 / + ;Df(3R)red-P52/ + and UAS - DopR/ + ;Df(3R)red-P52/ + flies (Figure S1C). Similarly, MB247 . DopR;Df(3R)red-P52/ + flies also displayed normal TPB (Figure 8B, Figure S1D, and Table S7). These data suggested that the TPB phenotype of Df(3R)red-P52/ + flies is caused by reduced expression of DopR in MB. These results demonstrated again that DopR regulates TPB in MB. As described above, both c309 and MB247 could restore the TPB of dumb 3 /dumb 3 with UAS-DopR (Figure 7C and 7D). c309 induces gene expression strongly in the ab and c lobes, but weakly in the a 9 b 9 lobes (Figure S2A and [49]). MB247 induces gene expression in the ab and c lobes but not in the a 9 b 9 lobes (Figure S2B and [49]). To investigate which lobe of MB is relevant to the DopR-mediated regulation of TPB, we used two more MB-specific Gal4 lines. c739 . DopR;dumb 3 /dumb 3 showed restored TPB and avoidance index (Figure 9A and Table S8). c739 is expressed in the ab lobes (Figure S2C and [50]). However, 1471 . DopR did not rescue the phenotype of dumb 3 /dumb 3 . The flies spread widely over the low and intermediate regions like dumb 3 /dumb 3 and AI Low was not restored to the level of wild type control (Figure 9B and Table S8). This 1471 induces gene expression in the c lobe (Figure S2D and [51]). Taken together, the results suggested that the ab lobes are relevant to DopR-mediated regulation of TPB and the c lobe is dispensable. Finally, we examined whether the dopamine signalling in the central complex is required for normal TPB using two more Gal4 lines. c161 is expressed in the ellipsoid body of the central complex (Figure S2E and [18]). The ectopic expression of UAS-DopR by c161 in dumb 3 /dumb 3 did not rescue the defective TPB. c161 . DopR;dumb /dumb flies spread over the areas colder than 25 u C like dumb 3 /dumb 3 and the lowered AI Low of dumb 3 /dumb 3 was not restored (Figure 10A and Table S9). OK348 is expressed in the fan-shaped body (Figure S2F and [52]). OK348 . DopR;dumb 3 / dumb 3 flies also showed loss of cold avoidance in the TPB assay and AI Low was low like dumb 3 /dumb 3 (Figure 10B and Table S9). These implicated that the ellipsoid body and the fan-shaped body are not relevant to DopR-mediated regulation of TPB. Monoamine neurotransmitters such as dopamine, norepinephrine, and serotonin have been identified as important factors in thermoregulation in mammals [53–56]. However, the exact functions of these monoamines in body temperature control are not clearly understood due to limited experimental methods in mammalian systems. Fortunately, our current study clearly revealed that dopamine plays a critical role in regulating TPB of Drosophila . Dopamine-deficient mutants and dopaminergic neuron- inactivated flies lost cold avoidance significantly (Figure 2, Figure 4, and Figure 5). However, the flies overexpressing TH and DDC together in dopaminergic neurons became thermophilic or hypersensitive to cold temperature (Figure 3). This suggests that dopamine levels are critical to regulate TPB; high dopamine levels lead to warm temperature preference and low dopamine levels lead to cool temperature preference. In this study, we have shown evidence to support that the dopamine signaling in MB regulates TPB. We also demonstrated previously that cAMP signaling in MB modulates TPB; flies with low levels of cAMP prefer cold and the flies with high levels of cAMP prefer warm temperature [1]. In addition, there have been reports that dopamine regulates cAMP levels [39] and that dopamine stimulation of Drosophila brain leads to activation of PKA specifically in the a lobe [40]. Therefore, we propose that when a distinctive subset of dopaminergic neurons which innervate the TPB center in MB is activated, cAMP levels and PKA activity can be increased in the center. Activated PKA may phosphorylate and regulate various targets including ion channels and also induce gene expression of unidentified TPB regulatory genes with CREB binding sites. These PKA-dependent gene expression and posttranslational regulation would change the activities of the TPB center in MB, and fly can determine specific temperature preference or avoidance behaviours. Consistently, our unpublished data strongly suggest that a specific gene group induced by PKA-CREB signalling in the brain is critical for Drosophila TPB. Previously, it was reported that MB is important for both cold and warm temperature avoidance and preference [1]. Interestingly, all the flies with defective dopamine signalling showed a significant loss in cold avoidance, but some of them also showed loss of warm avoidance (Figure 2, Figure 4, Figure 5, Figure 6). However, the loss of warm avoidance was not severe as MB- defective flies and dTRPA1-deficient flies [1,16]. We do not think that only dopamine regulates TPB in MB sufficiently. It is possible that other neuromodulators and/or multiple innervated neurons may be involved in modulation of the MB process to regulate TPB. The additive or synergistic effect of dopamine and these modulators may regulate cAMP levels in MB and TPB with broader temperature ranges as shown in MB-defective mutants or cAMP signaling-disrupted flies [1]. It is also possible that dopaminergic neurons are involved in transmitting temperature information to MB. It was reported that TRP and TRPL are required for avoidance of cold temperature in larvae [57], and their cold avoidance phenotypes resemble the TPB of dopamine signalling-deficient flies. Understanding whether the neuronal pathway for the cold avoidance of TRP and TRPL is connected to the dopaminergic pathway of MB will be helpful to understand the regulatory mechanism of TPB. In another report, the flies with surgically removed third antennal segment and aristae showed loss in cold avoidance [16]. Therefore, it is also possible that dopaminergic neurons are involved in transmitting the sensory signals to MB from sensory tissues like the third antennal segment and aristae. Although three subtypes of dopamine receptors are known in Drosophila , we found that DopR in MB is involved in TPB regulation while DopR in the ellipsoid body and the fan-shaped body is not essential for TPB control. This is consistent with the previous study that these substructures of the central complex are not involved in TPB control [1]. According to the previous results from others and our current data, DopR regulates multiple Drosophila behaviours via distinct neural circuits. DopR in the ellipsoid body is required to promote ethanol-stimulated locomotion and to regulate exogenous arousal negatively, while DopR in PDF-expressing circadian pacemaker cells is needed to regulate endogenous arousal positively [35,36]. Moreover, DopR in MB is required in learning and memory [32]. In addition, all parts of MB may not work for TPB regulation; DopR in the ab lobes of MB is relevant but this in the c lobe is dispensable, which is also consistent with the previous report [1]. In conclusion, our results strongly suggest that dopamine controls TPB and body temperature in Drosophila . We believe that our findings provide important clues to understand the molecular mechanism of Drosophila TPB. Although further studies are required, we cautiously suggest that our fruit fly system can provide a highly useful model to further understand the physiological roles of dopamine in animal body temperature regulation. Fly stocks were raised on standard cornmeal food at 25 C and 40%–50% relative humidity. Canton-S and w 1118 flies all showed a strong temperature preference for 24–25 u C regardless of the temperatures at which they were reared in every TPB tests [1,4]. w 1118 was shown as the wild type Drosophila strain in the figures. Fly lines were provided as follows: pale 4 (Bloomington, 3279), Ddc DE1 (Bloomington, 3168), TH-Gal4 (Serge Birman), UAS-TH, UAS- DDC (Sean B. Carroll), UAS-TNT (Cahir J. O’Kane), UAS-Kir2.1 (Amita Sehgal), UAS-Kir2.1 / CyO ; tub-Gal80 ts (Hiromu Tanimoto), dumb3 (Bloomington, 19491), Df(3R)red-P52 (Bloomington, 3484), ELAV-Gal4 (Bloomington, 458), MB247 (Troy Zars), UAS-DopR2 RNAi (VDRC, 3392), UAS-D2R RNAi (VDRC, 11471), c309, c739, OK348 (Leslie C. Griffith), 1471 (Bloomington, 9465), c161 (Bloomington, 27893). Genomic rescue transgenic fly of pale locus ( P { ple + 8 }) was obtained from Kalpana White [41]. DAT-Gal4 was generated as reported previously [58]. The UAS-DopR construct was generated as follows: a 1.8 Kb fragment including DopR coding sequences was obtained from RT-PCR of fly adult head mRNA with the primers tcgctgaaaagagggaagcaa and cagtaggta- gagggctggg; the fragment was cloned into pGEM-T Easy vector (Promega) and sequenced, and the fragment was transferred into NotI and XbaI sites of pUAST vector. We produced the UAS- DopR transgenic flies with standard microinjection methods. TPB was performed as described previously [1]. Files were incubated under 12 hr:12 hr dark:light cycle for 4 days before TPB assays. A linear temperature gradient from 15 to 45 u C was established along the aluminium block. All TPB assays were done in a room with 35 6 5% relative humidity. The AI Low and AI High were calculated as shown in Figure 1B. A mixed population of both sexes was tested for TPB. The number of flies was recorded and processed using Microsoft Excel. The AI Low or AI High of each tested fly line was compared with the AI Low or AI High of the control fly lines and then t-tests were performed. *, p , 0.05; **, p , 0.01. Two to three days old flies were raised on drug-containing food for 4 additional days and tested. Melted pre-made standard dextrose media were blended with ...