Fig 2 - uploaded by Caryne Braga
Content may be subject to copyright.
—Detail of the rostral region of the skull of 4 specimens of Abrawayaomys from São Paulo and Minas Gerais states, showing variation in the shape and extent of posterior margins of nasals and the lateral expansion of the anterior portion of nasals. From left to right: nasofrontal suture blunt and squared, not surpassing the lacrimal level (MZUFV 3590); nasofrontal suture V-shaped, with posterior margin of nasal bones moderately narrow and acute, surpassing the lacrimal level (MZUSP 34720); nasofrontal suture blunt and squared, aligned to the lacrimal (UFGM 2492); nasofrontal suture V-shaped, with posterior margin narrow and acute, largely surpassing the lacrimal level (LZV-UFOP 206 R). Also note the anterior portion of nasals expanded laterally (UFGM 2492 and LZV-UFOP 206 R).
Source publication
Abrawayaomys is a genus endemic to the Atlantic Forest with unique craniodental attributes within the radiation of sigmodontine rodents. Recent data hypothesized the existence of 2 species of Abrawayaomys, namely A. ruschii (from the Brazilian states of Espírito Santo, Rio de Janeiro, and São Paulo) and A. chebezi (from the Argentinean province of...
Contexts in source publication
Context 1
... an anteromedian flexus and flexid. Other traits were also variable, as the mesopterygoid fossa and the development of the mesoloph and the mesolophid, which we dis- cuss later due to its usage as diagnostic by Pardiñas et al. (2009Pardiñas et al. ( , 2016. The nasal bones tapered gradually toward their caudal extremities in all examined specimens (Fig. 2). Nevertheless, the caudal end of nasal bones can vary in shape, ranging from narrow and acute (defining a nasofrontal suture V-shaped, in specimens from Espírito Santo Gerais (n = 3), and São Paulo (n = 5), or largely expanded in specimens from Minas Gerais (n = 1 [see also Pardiñas et al. 2009: figure 9]) and São Paulo (n = 1). ...
Context 2
... (Fig. 11) with very narrow and short rostrum in dorsal view (Table 2 ; Fig. 2); nasals with squared terminal extremities, very short and abrupt, exposing the dorso-rostral component of premaxillaries, the short gnathic process and the incisors; nasals tapering posteriorly; apical one-third of nasals expanded laterally (slightly 45%, or largely expanded 10%) or not (45%; n = 20); nasofrontal suture aligned with premaxilar-frontal suture (11%) or surpassing the level of lacrimals in some specimens (89%; n = 18); lacrimal bones long and narrow, contacted both to premaxilar and frontal bones; rostrum with discrete to inflated nasolacrimal capsules, flanked by shallow to moderately deep and narrow to moderately wide zygomatic notches. Interorbital region variable, hourglass shaped, slightly divergent posteriorly, slightly convergent posteriorly, or even strongly convergent posteriorly (Fig. 3), with rounded, slightly squared, or squared supraorbital margins. ...
Similar publications
One of the largest members of Sigmodontinae, the extinct Megaoryzomys curioi from Santa Cruz Island in the Galápagos Archipelago (Ecuador), is traditionally treated as a representative of Thomasomyini. We contrasted this hypothesis based on a direct study of craniodental material of M. curioi, including a well-preserved skull assessed through CT-sc...
As currently understood, the subgenus Abrothrix (Angelomys) Teta et al. (33:153–182, 2017) includes four species of small (< 25 g), short-tailed mice (< 65% of the length of the head plus body), widely distributed from southern Peru to southernmost Argentina and Chile. At least four nominal forms of this subgenus (i.e., canescens Waterhouse 2:109–2...
We document the first occurrence of Sigmodontinae (Mammalia, Rodentia, Cricetidae) from the Pliocene of northern South America, from the San Gregorio Formation of northwestern Venezuela. The recovered isolated molars are identified as Oligoryzomys sp. and Zygodontomys sp., two currently widespread sigmodontines in South America. These records const...
A total of 53 specimens of the montane grass mouse, Akodon montensis Thomas, 1913 were collected in the Serra dos Órgãos National Park (SONP) in November 2014 and July 2015. The fecal material was analyzed, and a prevalence of 7.5% was recorded for a new coccidian species of the genus Eimeria Schneider, 1875, with part of its endogenous development...
Citations
... For morphometric analyses, we used seven craniodental measurements, taken with digital calipers to the nearest 0.01 mm following the definitions of Myers (1990), Percequillo et al. (2017), Boroni et al. (2020): Least interorbital breadth (LIB), representing the least distance across the frontal bones; Length of upper molars (LM), from the anterior surface of M1 to posterior margin of M3; Breadth of zygomatic plate (BZP), measured across the central area of zygomatic plate; Breadth of first upper molar (BM1), greatest crown breadth of the M1 across the paracone-protocone; Length of lower molars (lm), from the anterior surface of m1 to posterior margin of m3; Breadth of first lower molar (bm1), greatest crown breadth of the m1 across the paracone-metacone; Greatest mandible length (GML), from the most anterior point of the mandible to the posterior point of the mandible (at the condyloid process in Akodon). ...
Rodents of the genus Akodon comprise 41 extant species, and are considered the most diverse genus of the tribe Akodontini. The most recently described extant species is Akodon kadiweu, known exclusively from Serra da Bodoquena, a karstic region located in Mato Grosso do Sul state, Brazil. Some sub-fossil and fossil specimens of Akodon have been reported in recent years for Brazil, but most remain unidentified at the species level. Here we examine the identity of Quaternary specimens of Akodon sp. from the limestone cave Nossa Senhora Aparecida, located in Serra da Bodoquena. Quantitative characters allowed the distinction of Akodon sp. specimens from smaller and larger congeners, and skull qualitative characters of nasal, interorbital region, supraorbital margins, zygomatic notches, zygomatic plate, incisive foramina, mesopterygoid fossa, mandible and molars allowed to identify these individuals as A. kadiweu. Our results revealed the first known past representatives of Akodon to be recorded in Mato Grosso do Sul, as well as western Brazil.
... Para a identificação taxonômica dos gêneros e espécies foram utilizadas as seguintes referências: Artiodactyla (Wilson & Reeder, 2005), exceto para Dicotyles tajacu (Acosta et al., 2020); Carnivora (Wilson & Reeder, 2005), exceto para Leopardus tigrinus (Nascimento & Feijó, 2017;Trigo et al., 2013), Herpailurus e Puma (Kitchener et al., 2017;Segura et al., 2013); Cingulata (Gardner, 2008), exceto para Cabassous (Feijó & Anacleto, 2021) e Dasypus (Feijó et al., 2018); Chiroptera (Gardner, 2008;Garbino et al., 2020); Didelphimorphia (Rossi et al., 2012), exceto para Metachirus (Voss et al., 2019), Monodelphis (Pavan & Voss, 2016) e Philander (Voss et al., 2018); Lagomorpha (Ruedas et al., 2017;Silva et al., 2019); Perissodactyla (Wilson & Reeder, 2005); Pilosa (Gardner, 2008); Primates ; e Rodentia , exceto para Abrawayaomys (Percequillo et al., 2017), Calomys mattevii (Gurgel-Filho et al., 2015), Castoria (Pardinãs et al., 2016), Hylaeamys (Brennand et al., 2013) e Oecomys (Suarez--Villota et al., 2018). Para famílias e ordens foi utilizado Burgin et al. (2018), com exceção de Artiodactyla (Prothero et al., 2021). ...
... Desde muito tempo, autores indicam a importância dos dados contidos em uma coleção científica na elaboração de estudos no contexto das questões ambientais, como a perda de biodiversidade e a função associada ao ecossistema, e de questões epidemiológicas e climáticas globais, influênciadas por fatores de origem antropogênica (Cotterill, 1995;Daily & Ehrlich, 1996;Drinkrow et al., 1994;Dunnum et al., 2017;Ehrlich, 2005;Krishtalka & Humphrey, 2000;Meineke et al., 2018;Monfils et al., 2020). Na coleção do MZUFV, foram desenvolvidos nos últimos anos inúmeros projetos e publicações de cunho ecológico, morfológico, biogeográfico e taxonômico, não só de autoria dos pesquisadores locais como também de outras instituições nacionais e estrangeiras (e.g., Bevilacqua et al., 2004;Boroni et al., 2015Boroni et al., , 2017Duarte & Lessa, 2015;Feio et al., 2007;Lessa et al., 1999Lessa et al., , 2013Lessa et al., , 2014Lima et al., 2014Lima et al., , 2017Menezes et al., 2017;Moreira et al., 2008Moreira et al., , 2009Nascimento et al., 2013a, b;Nascimento-Costa et al., 2016;Nunes et al., 2012Nunes et al., , 2013Paglia et al., 1995;Pardiñas et al., 2014aPardiñas et al., , b, 2016Percequillo et al., 2017;Prado et al., 2008;Prado-Cacau et al., 2013;Rosa et al., 2020;Santana et al., 2008;Silva et al., 2012;Siman et al., 2017;Stumpp et al., 2016;Zappes et al., 2014). ...
O professor João Moojen iniciou uma importante coleção de vertebrados na Escola Superior de Agricultura e Veterinária do estado de Minas Gerais, em Viçosa em 1933. Essa coleção foi o embrião do Museu de Zoologia João Moojen da Universidade Federal de Viçosa (MZUFV), inaugurado oficialmente em 1993. Atualmente, o MZUFV possui coleções científicas, didática e de exposição, com dados digitalizados de aproximadamente 36 mil exemplares, incluindo fósseis e viventes de peixes, anfíbios, répteis, aves e mamíferos. O objetivo deste estudo foi descrever o histórico da Coleção de Mamíferos do MZUFV, evidenciar sua diversidade taxonômica e abrangência geográfica. Com essa finalidade, a identidade taxonômica dos espécimes foi examinada e atualizada, e um mapa de procedência foi produzido. Foram contabilizados 4878 espécimes tombados pertencentes a 218 espécies distribuídas em 11 ordens, 35 famílias e 142 gêneros. As espécies do acervo representam 25,5 % da diversidade de mamíferos no Brasil. A maioria dos exemplares é oriundo da Mata Atlântica de Minas Gerais, havendo também representantes dos biomas Cerrado, Pantanal e Amazônia. As ordens mais representadas tanto em espécimes quanto espécies são Rodentia, Chiroptera, Didelphimorphia, Carnivora e Primates. Na coleção estão depositados parátipos dos roedores Calassomys apicalis e Rhipidomys tribei. A contratação de mastozoólogos desde a década de 1990 aumentou o número de exemplares na coleção através de projetos e parcerias nacionais e internacionais. Desde sua criação, o acervo tem sido utilizado em inúmeras publicações científicas, enfatizando sua relevância regional e nacional.
... The genus Abrawayaomys includes small spiny sigmodontine rodents endemic to the Atlantic Forest (Pardiñas et al. 2015, Percequillo et al. 2017). The genus was described from a single specimen from Espírito Santo, Brazil, and considered monotypic with Abrawayaomys ruschii as type species (Cunha and Cruz 1979). ...
... Since then, several populations have been reported, expanding the known distribution of the genus throughout the Atlantic Forest biome (e.g. Passamani et al. 2011, Ventura et al. 2013, Cerboncini et al. 2014, Pardiñas et al. 2015, 2016a, Percequillo et al. 2017, Cruz et al. 2019). In addition, the validity of A. chebezi was questioned and considered as junior synonym of A. ruschii (Pardiñas et al. 2015, 2016a, Percequillo et al. 2017), a plausible hypothesis pending a revision of a more ample set of traits (e.g. ...
... Passamani et al. 2011, Ventura et al. 2013, Cerboncini et al. 2014, Pardiñas et al. 2015, 2016a, Percequillo et al. 2017, Cruz et al. 2019). In addition, the validity of A. chebezi was questioned and considered as junior synonym of A. ruschii (Pardiñas et al. 2015, 2016a, Percequillo et al. 2017), a plausible hypothesis pending a revision of a more ample set of traits (e.g. molecular data; see Lessa 2015, Pardiñas 2017). ...
The mammals of Paraguay are still poorly known. We report a new genus for the country, Abrawayaomys, a spiny cricetid rodent endemic for the Interior Atlantic Forest. This record extends the distribution of the genus approximately 100 km, and west of the Paraná River. This addition increases the number of mammals in Paraguay to 184 and verifies that rodents are the most diverse group of mammals in the country. We outline identifying morphological characters of Abrawayaomys and elaborate on the significance of this finding for conservation and biogeography in the region.
... We amplified the CYTB gene by PCR using the external primers MVZ05 (Smith & Patton, 1993) and UMMZ04 (Jansa et al., 1999). For Brucepattersonius samples we also used internal primers: BRUCE793R (5' ATTCTGGTTTAATGTGTGCTGG) and BRUCE664F (5' CTGATAAAATTCCATTCCACC). PCR reactions and cycle conditions were similar to described in Percequillo et al. (2017). PCR products were purified using ExoSap-IT (Affymetrix) and sequenced using amplification primers and BigDye Terminator (Life Technologies Corp.), on ABI3130 sequencer (Applied Biosystems). ...
... The genus Abrawayaomys was recently reviewed by Percequillo et al. (2017). These authors, showed that most of the morphologic features used to distinguish the two previously valid species are highly polymorphic and also reported a low genetic divergence between them, suggesting that A. chebezi Pardiñas, Teta, and D'Elía, 2009 is a junior synonym of A. ruschii Cunha and Cruz, 1979. ...
... These authors, showed that most of the morphologic features used to distinguish the two previously valid species are highly polymorphic and also reported a low genetic divergence between them, suggesting that A. chebezi Pardiñas, Teta, and D'Elía, 2009 is a junior synonym of A. ruschii Cunha and Cruz, 1979. The specimens collected at EEB were included in the analyses of Percequillo et al. (2017). ...
The Atlantic Forest harbors an impressive diversity of nonvolant small mammals. Despite having been the target of many ecological and taxonomical studies in the last decades, this group is still poorly known in several aspects-basic information on intrapopulational morphologic variation and proper diagnoses are lacking for many species, even for common taxa. This is related to the fact that large series of specimens from a single locality are extremely rare in scientific collections. A consistent sampling effort was conducted at Estação Ecológica de Bananal, northeastern São Paulo State, throughout seven field expeditions between 2003 and 2011, under the coordination of the Museu de Zoologia da Universidade de São Paulo, resulting in extensive series of nonvolant small mammals. We studied in detail the external and cranio-dental morphology of this sample (575 specimens), that we assigned to 31 known species besides one new species to science. Most species belong to order Rodentia (26 species) from the families Cricetidae (22 species) and Echimyidae (four species); the remaining (six species) are marsupials from the order Didelphimorphia, family Didelphidae. This is one of the most diverse assemblages ever recorded in this biome, and includes some of the rarest endemic rodents of the Atlantic Forest, such as Abrawayaomys ruschii, Blarinomys breviceps, Drymoreomys albimaculatus, Phaenomys ferrugineus, Phyllomys kerri and Rhagomys rufescens. This outstanding richness can be explained by the extensive sampling effort performed for a long period of time. Also, the capture success of the third expedition (8.25%) is among the highest rates obtained in the Atlantic Forest and the extensive use of pitfall traps was fundamental for trapping this high number of species. Herein, we provide an annotated list of nonvolant small mammals occurring at Estação Ecológica de Bananal, with comprehensive analyses of morphological variation and detailed diagnoses that will allow their proper identification, and will provide a sound basis for a better comprehension of the geographic variation of these taxa across the biome. We also present a formal description for a new species of Brucepattersonius from the mountain ranges along the Paraíba do Sul valley. For five species of sigmodontine rodents, we investigate the levels of ontogenetic and sexual variation, and while the first is accentuate in all analyzed species the second does not contribute significantly to intrapopulation variation. Resumo. A Floresta Atlântica abriga uma diversidade impressionante de pequenos mamíferos não voadores que, apesar de terem sido alvo de inúmeros estudos taxonómicos e ecológicos nas últimas décadas, ainda carecem de informações básicas de variação intrapopulacional e diagnoses detalhadas, incluindo para algumas das espécies mais comuns. Isto está relacionado ao fato de que séries numerosas de espécimes de uma mesma localidade são extremamente raras em coleções científicas. Um consistente esforço amostral foi conduzido na Estação Ecológica de Bananal, nordeste do Estado de São Paulo, em sete expedições de campo realizadas entre os anos de 2003 e 2011, sob coordenação do Museu de Zoologia da Universidade de São Paulo, resultando em extensas séries de pequenos mamíferos não voadores. Nos estudamos em detalhe a morfologia externa e crânio-dental destas amostras (575 espécimes) e identificamos 31 espécies conhecidas, além de uma nova espécie para a ciência. A maioria das espécies são roedores (Rodentia; 26 espécies) das famílias Cricetidae (22 espécies) e Echimyidae (quatro espécies); as demais (seis espécies) são marsupiais (Didelphimorphia) da família Didelphidae. A assembleia de pequenos mamíferos da Estação Ecológica de Bananal é uma das mais diversas já registradas no bioma, que inclui algumas das espécies endêmicas mais raras da Floresta Atlântica, como Abrawayaomys ruschii, Blarinomys breviceps, Drymoreomys albimaculatus, Phaenomys ferrugineus, Phyllomys kerri e Rhagomys rufescens. Esta riqueza ímpar pode ser explicada pelo extenso esforço ARTICLE amostral realizado em um longo período de tempo. Além disso, o sucesso de captura registrado para a terceira expedição (8,25%) está entre os mais altos obtidos na Floresta Atlântica e a utilização de armadilhadas de interceptação e queda foi determinantes para a captura de tantas e raras espécies. Neste estudo, apresentamos uma lista comentada dos pequenos mamíferos não-voadores que ocorrem na Estação Ecológica de Bananal, com análises detalhadas de variação morfológica e diagnoses detalhadas, que serão úteis para a identificação destas espécies e ainda fornecerão base para análises de variação geográfica destes táxons ao longo do bioma. Apresentamos também a descrição formal de uma nova espécie de Brucepattersonius que ocorre em áreas montanhosas ao logo do vale do Rio Paraíba do Sul. Para cinco espécies de roedores sigmodontíneos, nos investigamos a influência das variações ontogenética e sexual e concluímos que, enquanto a primeira é muito acentuada em todas as espécies estudadas, a segunda não corresponde a uma fonte significativa de variação.
... The vegetation at EEB is typical of montane (between 1,100 m and 1,500 m of alti- tude) and high-montane (above 1,500 m) formations of the Dense Ombrophilous Forest (Castro, 2001). The forest is present in dif- ferent successional stages, from secondary-disturbed to pristine areas, where the canopy reaches 30 m high ( Percequillo et al., 2017Percequillo et al., , 2011). The specimens of P. kerri were trapped in pitfall traps in a humid second-growth forest with diverse understory, including palm trees (e.g. ...
Arboreal spiny rats of the genus Phyllomys are the most diverse group of echimyid rodents in the Atlantic Forest. Many species of Phyllomys have small geographic ranges and are rare in scientific collections. One of them is Phyllomys kerri known from only three specimens collected in a single locality almost 80 year s ago. The identity and the taxonomic validity of this enigmatic species has been questioned in recent decades. Field surveys at different sites along the southeastern portion of the Atlantic Forest in Brazil recovered specimens of Phyllomys that we hypothesized to be P. kerri based on external similarities to the type specimen and proximity to its type locality. Here we obtained DNA sequences from these recently collected specimens and historic DNA from a topotype of P. kerri collected in 1941. Our results supported the status of P. kerri as a valid species and showed it is phylogenetically positioned among the southern clade of Phyllomys species. We therefore provide an emended diagnosis of P. kerri, comparing it with sympatric congeners, and provide comments on its evolutionary affinities, geographic distribution, and conservation status.
... No obstante, estos avances no han sido igualmente acompañados por estudios morfológicos de variación geográfica o de revisión de series extensas de especímenes de museos. En otros casos, estudios morfológicos detallados de unos pocos ejemplares, para géneros pobremente conocidos como Abrawayaomys o Juliomys (e.g., Pardiñas et al., 2008Pardiñas et al., , 2009aPercequillo et al., 2017), aportaron información valiosa para su mejor conocimiento. ...
... Pardiñas et al., 2009a). Más recientemente, este último taxón fue nuevamente incluido en la sinonimia de A. ruschii, sobre la base de evidencias morfológicas y moleculares (Percequillo et al., 2017). Taxones como Blarinomys breviceps o Thaptomys nigrita, dos Akodontini de hábitos semifosoriales, constituyen probablemente complejos de especies crípticas, al menos a juzgar por las evidencias moleculares (e.g., Silva Gomez, 2008;Ventura et al., 2012). ...
... Una problemática transversal a muchas de estas situaciones es el parcial desacople entre los estudios taxonómicos realizados en países vecinos -especialmente en Brasil-y aquellos efectuados en la Argentina, con las consecuentes limitaciones que esta situación impone. Afortunadamente esta tendencia ha comenzado a revertirse, poniendo de manifiesto la importancia de realizar estudios sistemáticos sin restricciones geográficas (e.g., De Almeida Chiquito et al., 2014;Percequillo et al., 2017). ...
We present a synthesis of the current knowledge of the rodents from the province of Misiones, Argentina, with emphasis on taxonomic, chromosomal, biogeographic and conservation issues. In this province, the order is represented by 7 families: Sciuridae (1 genus, 1 species), Cricetidae (17, 24), Caviidae (2, 2), Cuniculidae (1, 1), Dasyproctidae (1, 1), Echymyidae (3, 3) and Erethizontidae (1, 1). From 1 to 5 species -depending on taxonomic authorities- are endemic to Misiones. We briefly discuss some taxonomic problems, highlighting those questions that still persist (e.g., the complex situation of the genus Brucepattersonius). For several species, we provide novel chromosome data and compare it with the information available for Brazil. An analysis of the species richness at the provincial level indicates that the highest values for this parameter occur towards the south-central portion of the territory, in an area of interdigitation between the Interior Atlantic Forest and the ecoregion of Campos y Malezales. We discuss the role of large rivers in the region as barriers to the dispersal of this fauna (e.g., the Paraná between Argentina and eastern Paraguay). At least 9 species of rodents with distribution in the province of Misiones have been classified under some category of threat or near to the threat. In all cases, the survival of these taxa depends on maintaining the integrity and connectivity between forest remnants. © 2018 Museo Argentino de Ciencias Naturales Bernardino Rivadavia.
Brazil experienced the largest socioenvironmental catastrophe of its history, caused by a tailings dam failure, known as “Mariana disaster”. The wave of iron-mining waste buried villages, contaminated the Doce River, and left an immense ocean plume. The Doce River watershed is the largest in southeast Brazil, and located in the Atlantic Forest domain, presenting an outstanding economic, social, and biological relevance. Although the effects of such tragic events are usually assessed through fish assemblage changes, mammals have important effects on environment structure and regeneration. Inventories are of prime importance for adequate conservation efforts as well as for evaluating impacts of any disaster. Therefore, the aim of this paper was to present an updated assessment of mammalian list collected in the affected portion of Doce River before the dam failure therefore contributing to future conservation efforts. Data collection comprised specimens deposited in Museu Nacional/UFRJ, the oldest mammal collection of Brazil, and literature review. The two surveys together retrieved 157 species from 31 families and 11 orders, representing around 60% of the known mammalian diversity in the Atlantic Forest, including some in critical conservation condition, such as the Franciscana dolphin, the northern muriqui and the giant otter. Mining is a byproduct of present society, with dam breaches as a recurring problem. Facing the importance of Doce River to both Brazilian biodiversity and society, the chain of events must be taken into account in environmental rehabilitation strategies, and taxa less commonly assessed, like mammals, should be included.
The genus Brucepattersonius currently includes eight valid species from the Atlantic Forest of south-eastern Brazil and north-eastern Argentina. Most of those species were described in the past 20 years, based on very small sample sizes: four species are known only from their type localities. Concerns on the taxonomic validity of some Brucepattersonius species have been raised in the recent literature. In this study, we present a phylogenetic hypothesis including samples throughout the distribution of the genus (among them the holotypes of two species) and employed single-locus molecular species delimitation analyses to provide a new hypothesis for species limits within Brucepattersonius. We also analysed intra- and interpopulation morphological and morphometric variation to apply an integrative taxonomic approach to species delimitation. Our phylogenetic inference of molecular data recovered four strongly supported clades within Brucepattersonius, which were recognized as distinct operational taxonomic units in all species delimitation analyses. The first two clades represent the Caparaó mountain range endemic B. griserufescens and its sister-group, the recently described species B. nebulosus. The third clade comprises several specimens assigned to B. soricinus but also includes the holotype of B. igniventris; we revise these species limits accordingly. The last clade is composed of samples from southern Brazil assigned to B. iheringi. Based on morphological and morphometric analyses, we find no clear structure among the three described species from Misiones Province, Argentina (B. guarani, B. misionensis and B. paradisus) and B. inheringi from southern Brazil, suggesting that those samples represent a single species. Therefore, in the present study we propose that the genus Brucepattersonius comprises only four diagnosable species: B. griserufescens (including B. albinasus), B. nebulosus, B. soricinus (including B. igniventris) and B. iheringi (including B. guarani, B. misionensis and B. paradisus).
The lack of information on biological aspects of small mammals in Brazil fits into two of the main gaps in knowledge of biodiversity-the Linnean and Wallacean shortfall. We performed a broad compilation of studies developed in the Paraná state to consolidate the first list of non-volant small mammal species. Furthermore, we indicate which regions lack information and greater sampling efforts to understand the biological aspects of small mammals. We listed 50 species belonging to 30 genera, five families, and two orders, which represent 37% of marsupials and small rodent species occurring in the Brazilian Atlantic Forest. Our results indicate that are regions in the Paraná state, such as the southwest, without a single record of small mammals, reveling a Wallacean shortfall of approximately 138.584 km 2. Studies on the small-bodied mammal fauna in the state of Paraná are influenced by accessibility bias, concentrated at sites less than 50 kilometers distant from cities, roads, or airports. New research will not only have the challenge of knowing the species richness in regions that are still poorly or hitherto no studied, but also evaluate the state and the population dynamics of the species that persist in densely anthropized areas. ARTICLE HISTORY
With almost 2,600 species, Rodentia is the most diverse order of mammals. Here, we provide an overview of changes in our understanding of the systematics of living rodents, including species recognition and delimitation, phylogenetics, and classi cation, with emphasis on the last three decades. Roughly, this corresponds to the DNA sequencing era of rodent systematics, but the eld is undergoing a transition into the genomic era. At least 248 species were newly described in the period 2000–2017, including novelties such as the rst living member of Diatomyidae and a murid species without molars (Paucidentomys vermidax), thus highlighting the fact that our understanding of rodent diversity is going through an age of discovery. Mito-nuclear discordance (including that resulting from mitochondrial introgression) has been detected in some of the few taxonomic studies that have assessed variation of two or more unlinked loci. As studies incorporate more loci, incomplete lineage sorting and introgression are likely to gain recognition as widespread phenomena in the near future. Molecular phylogenetics has had a major impact in rodent phylogeny and allowed the identi cation of three major rodent clades, here recognized as suborders: 1) the Hystricomorpha (sometimes referred as the Ctenohystrica) and including two infraorders, Hystricognathi and Ctenodactylomorphi; 2) the Sciuromorpha; and 3) the Supramyomorpha, a new suborder that comprises the infraorders Castorimorphi, Anomalurimorphi, and Myomorphi. In spite of the greater understanding and ensuing stability of rodent phylogeny gained during the last three decades, several major areas of the rodent tree remain unresolved or poorly supported. We expect that the analysis of genomic-scale data will help resolve those areas of the radiation of Rodentia that still remain poorly understood.
