Fig 3 - available via license: Creative Commons Attribution-NonCommercial 4.0 International
Content may be subject to copyright.
![Compilation of shells representing most of the currently recognized genera of Ariantinae. 1. Arianta arbustorum (Linnaeus, 1758) B 24.1 mm [RMNH G2131] Austria, Steiermark, near Gstatterboden; E. Gittenberger leg., 10-IX-1964. 2. Ari-](publication/334445391/figure/fig2/AS:780187486662658@1563022600717/Compilation-of-shells-representing-most-of-the-currently-recognized-genera-of-Ariantinae.png)
Compilation of shells representing most of the currently recognized genera of Ariantinae. 1. Arianta arbustorum (Linnaeus, 1758) B 24.1 mm [RMNH G2131] Austria, Steiermark, near Gstatterboden; E. Gittenberger leg., 10-IX-1964. 2. Ari-
Source publication
A new starting-point in Ariantinae systematics is presented by combining data on traditional shell morphology and genital anatomy, with phylogeny reconstructions based on DNA sequence data. For nearly all genera and subgenera one or more shells are depicted and drawings of the proximal part of the genital organs are shown to illustrate the morpholo...
Contexts in source publication
Context 1
... aside some exceptions, Ariantinae shells are rather monomorphic (Fig. 3, Appendix). Because of the limited number of conchological characters, many authors studied the genital tract for morphological characters that could discriminate species and especially higher taxa. However, the genital morphology within this subfamily is also very homogeneous, what is uncommon among pulmonates. The form of the accessory glands, ...
Context 2
... ( Fig. 3.3) was shown by Groenenberg et al. (2012) and has recently been confirmed by Cadahia et al. ...
Context 3
... Arianta arbustorum (Fig. 3.1) has the largest distribution range of all the species within the subfamily Ariantinae. It occurs in north and central Europe, from Iceland, Norway, Sweden, N.-Ireland, Great Britain, and central France eastwards to the Baltic countries, Poland, Ukraine and Romania (Carpathians). The southern border ranges from the N.-Italian Alps ...
Context 4
... The taxonomic position of Cattania (Ariantopsis) pelia (Fig. 3.30) has long been uncertain. Conchologically it somewhat resembles Arianta aethyops. It has been assigned to various genera, viz. Arianta by Kroupa (1994) and Dedov (1998), Helicigona by Hesse (1912), Chilostoma by Bank et al. (2001) and Faustina by Damjanov and Likharev (1975). See also Campylaea (Ariantopsis) and Ariantopsis in Schileyko ...
Context 5
... data. Campylaea (C.) planospira (Fig. 3.13) is the sister-group of a clade with three species, referred to below as Campylaea (Oricampylaea) (PP > 0.92; Figs S1, S2). Together, the subgenera Campylaea and Oricampylaea, form a monophyletic group (PP = 1.0; Figs 2, S1, S2, S4, S6), viz. the genus Campylaea. The genetic distances between C. (Campylaea) and C. (Oricampylaea) are ...
Context 6
... Campylaeopsis moellendorffii (Fig. 3.18) has a characteristic shell with regularly arranged, widely spaced hairs. It has been assigned to Helicigona by Knipper (1939) and to Chilostoma by Bank ...
Context 7
... Conchologically, Causa holosericea ( Fig. 3.5) and Isognomostoma isognomostomos (Fig. 3.4) are both aberrant among the Ariantinae by the dentate aperture. These species were considered congeneric until Schileyko (1971), primarily based on differences in genital anatomy, introduced Causa as a new genus. See also Causa in Schileyko (2006Schileyko ( , 2013 for details regarding the ...
Context 8
... Conchologically, Causa holosericea ( Fig. 3.5) and Isognomostoma isognomostomos (Fig. 3.4) are both aberrant among the Ariantinae by the dentate aperture. These species were considered congeneric until Schileyko (1971), primarily based on differences in genital anatomy, introduced Causa as a new genus. See also Causa in Schileyko (2006Schileyko ( , 2013 for details regarding the shell and genital morphology. The accessory ...
Context 10
... Unexpectedly, from a conchological perspective, C. (Chilostoma) zonatum (Fig. 3.7) turns out to be more closely related to C. (Chilostoma) frigidum and C. (Chilostoma) tigrinum (Fig. 3.8), than to ...
Context 11
... Unexpectedly, from a conchological perspective, C. (Chilostoma) zonatum (Fig. 3.7) turns out to be more closely related to C. (Chilostoma) frigidum and C. (Chilostoma) tigrinum (Fig. 3.8), than to ...
Context 12
... achates (Fig. 3.6), which shares the chestnut brown colour of the shell. That colour might be the plesiomorphic character state in Chilostoma. Nowa-Contributions to Zoology, 85 (1) -2016 days, Helix foetens is either synonymised with ...
Context 13
... zonatum, as by Turner et al. (1998) or it is considered a subspecies of that species (Bank et al., 2001). In the past many subgenera have been assigned to Chilostoma (Zilch, 1960;Bank et al., 2001). It is unclear which, if any, character states of the genital tract are diagnostic for the subgenera of Chilostoma. The accessory glands are undivided (Fig. 4.3, ...
Context 14
... Chilostoma (Cingulifera) is a generally accepted subgenus of Chilostoma (Zilch, 1960;Bank et al., 2001). Taxonomically it was supposed to encompass only a single species, i.e. Chilostoma (Cingulifera) cingulatum (Studer, 1820) ( Fig. 3.9, 3.10) with a large number of alleged subspecies (Pfeiffer, 1951), some of which are here classified differently, however, viz. Chilostoma (C.). frigidum and Chilostoma (C.) tigrinum (De Cristofori and Jan, 1832; Fig. ...
Context 15
... Taxonomically it was supposed to encompass only a single species, i.e. Chilostoma (Cingulifera) cingulatum (Studer, 1820) ( Fig. 3.9, 3.10) with a large number of alleged subspecies (Pfeiffer, 1951), some of which are here classified differently, however, viz. Chilostoma (C.). frigidum and Chilostoma (C.) tigrinum (De Cristofori and Jan, 1832; Fig. ...
Context 16
... Among the (sub)genera of Ariantinae that can be distinguished by shell-morphology, Cylindrus is the most distinctive because the shell is cylindrical and much higher than broad (Fig. 3.3). Its sister-group, the genus Arianta, is characterized by much larger shells that vary in shape between flattened and globular. This close relationship, which is surprising in view of the morphological data, was reported by Groenen- berg et al. (2012) and later on confirmed by Cadahia et al. (2013). Despite the long geological history ...
Context 17
... by Bank et al. (2001), but has been classified as a subgenus of Campylaea as well (Zilch, 1960). Only two species are generally recognized in Delphinatia, viz. D. fontenillii (Michaud, 1829), and D. glacialis, which are both included in this study. Falkner et al. (2002) distinguished D. f. fontenillii and D. f. alpina ( Fig. 3.11) next to the monotypic D. glacialis. See Campylaea (Delphinatia) and Chilostoma (Delphinatia) in Schileyko (2006Schileyko ( , 2013 for details regarding the shell and genital morphology. The accessory glands (Fig. 4.12) are undivided, or one of them is split for up to 25-50% of its length. (Table ...
Context 18
... Isognomostoma Fitzinger, 1833 (monotypic) Type species: Helix personata Lamarck, 1792 [= Isognomostoma isognomostomos (Schröter, 1784)] Molecular data. Isognomostoma isognomostomos (Fig. 3.4) and Causa holosericea (Fig. 3.5) have long been regarded as congeneric. All phylogeny reconstructions, except the one based on H3 (Fig. S4), explicitly show Causa and Isognomostoma together as a monophyletic group (PP ≥ 0.99; Figs 1, 2, S2-S6). See also the paragraph on ...
Context 19
... Isognomostoma Fitzinger, 1833 (monotypic) Type species: Helix personata Lamarck, 1792 [= Isognomostoma isognomostomos (Schröter, 1784)] Molecular data. Isognomostoma isognomostomos (Fig. 3.4) and Causa holosericea (Fig. 3.5) have long been regarded as congeneric. All phylogeny reconstructions, except the one based on H3 (Fig. S4), explicitly show Causa and Isognomostoma together as a monophyletic group (PP ≥ 0.99; Figs 1, 2, S2-S6). See also the paragraph on ...
Context 20
... Josephinella Haas, 1936 Type species: Helix hemonica Thiesse, 1884 (Fig. 3.34) Molecular data. Based on 11 included species (2 undescribed; Table S7), Josephinella is considered a monophyletic group (PP = 1.0; Figs 1, 2, S2-S6). The phylogeny reconstructions for the combined datasets show Thiessea as the sister-group of Josephinella (PP = 1.0; Figs 1, 2, S5, S6). Josephinella reischuetzi (Su bai, 1990) and J. ...
Context 21
... Helix kollari Pfeiffer, 1856 (Fig. 3.19) has been classified in Campylaea (by Tomić, ...
Context 22
... data. Kosicia is usually regarded as a subgenus of Chilostoma (Zilch, 1960;Bank et al., 2001), but should be given generic status based on our phylogeny reconstructions. Its three species, viz. Kosicia ambrosi (Strobel, 1852) ( Fig. 3.15), K. intermedia ( Fig. 3.16) and K. ziegleri (Rossmässler, 1836) (Fig. 3.17) form a monophyletic group (PP ≥ 0.94; Figs 1, 2, S1-S6). Kosicia ambrosi, which is much smaller than the other two species, is the sister-group of K. intermedia and K. ziegleri together (Figs 1, 2, S2, S3, S5, S6). The phylogeny reconstructions for the ...
Context 23
... data. Kosicia is usually regarded as a subgenus of Chilostoma (Zilch, 1960;Bank et al., 2001), but should be given generic status based on our phylogeny reconstructions. Its three species, viz. Kosicia ambrosi (Strobel, 1852) ( Fig. 3.15), K. intermedia ( Fig. 3.16) and K. ziegleri (Rossmässler, 1836) (Fig. 3.17) form a monophyletic group (PP ≥ 0.94; Figs 1, 2, S1-S6). Kosicia ambrosi, which is much smaller than the other two species, is the sister-group of K. intermedia and K. ziegleri together (Figs 1, 2, S2, S3, S5, S6). The phylogeny reconstructions for the concatenated datasets show Faustina ...
Context 24
... data. Kosicia is usually regarded as a subgenus of Chilostoma (Zilch, 1960;Bank et al., 2001), but should be given generic status based on our phylogeny reconstructions. Its three species, viz. Kosicia ambrosi (Strobel, 1852) ( Fig. 3.15), K. intermedia ( Fig. 3.16) and K. ziegleri (Rossmässler, 1836) (Fig. 3.17) form a monophyletic group (PP ≥ 0.94; Figs 1, 2, S1-S6). Kosicia ambrosi, which is much smaller than the other two species, is the sister-group of K. intermedia and K. ziegleri together (Figs 1, 2, S2, S3, S5, S6). The phylogeny reconstructions for the concatenated datasets show Faustina as the sister-group of Kosicia (PP = 1.0; Figs ...
Context 25
... All three known Kosicia species were included in this study. See Helicigona (Kosicia) and Kosicia in Schileyko (2006Schileyko ( , 2013 for details regarding the shell and genital morphology. The accessory glands are always undivided (Fig. ...
Context 26
... Only two Cattania (Wladislawia) species are known, viz. C. (W.) polinskii (Fig. 3.31) and Wagner, 1928 (Fig. 3.32). The latter species, thus not the type species, is included in this study. Wladislawia has been considered a subgenus of Campylaea by Zilch (1960), of Faustina by Damjanov and Likharev (1975) ...
Citations
... 1-2). C. planospira is assigned to the genus and subgenus Campylaea based on molecular data (Groenenberg et al., 2016). fig. 2 [Tiberi, 1878], con il nome di H. discrepans.". ...
The taxa established by Marianna Panciatichi Ximenes d’Aragona Paulucci are preserved at the Natural
History Museum of the University Museum System of the University of Florence. The examination of the
analytic revision of the types follows the first two papers already published (Cianfanelli et al., 2021, 2023).
In this third part, 49 taxa are examined and, following the criterion of dealing them in chronological order
of publication as defined in the first part, the subsequent four publications by Paulucci are taken into
account (Paulucci, 1880a, 1880c, 1881a, 1881b). The taxa analysis follows the same outline of the first
part (Cianfanelli et al., 2021) with an analytic sheet for each taxon, divided into paragraphs (Original
publication, Original description, Type locality, Type material, Current status, Remarks) and with the
reproduction, for each taxon, of the high resolution photos of a sample of the typical series in the different
main views. Other taxa mentioned in literature, erroneously attributed to Paulucci, other ones established
by Paulucci considered as non-valid and others established by Paulucci, considered as nomina nuda, are
also reported
... Gargominy and Ripken (2006) suggested to separate the taxa C. cingulatum liguricum (Kobelt, 1876), C. cingulatum frigidum (De Cristofori and Jan 1832) and C. cingulatum hermesianum (Pini, 1874) from high altitudes from C. cingulatum because of their tighter coiling, the more oval shape of the aperture, and a columellar callus, and to combine them in a distinct species, Chilostoma (Cingulifera) frigidum. The molecular phylogenetic analyses of Groenenberg et al. (2016) showed that C. frigidum and C. tigrinum (De Cristofori and Jan 1832) are distinct from C. cingulatum and even do not belong to Chilostoma (Cingulifera), but to Chilostoma (Chilostoma). C. cingulatum liguricum and C. cingulatum hermesianum were not considered in these analyses. ...
... 1995; Schileyko, 2013) are more closely related to the Chilostoma (Chilostoma) species and have to be transferred to this subgenus. For C. frigidum and C. tigrinum this was already shown by Groenenberg et al. (2016). Gargominy and Ripken (2006) suggested to separate C. cingulatum liguricum, C. cingulatum frigidum and C. cingulatum hermesianum from high altitudes from C. cingulatum because of their tighter coiling, the more oval shape of the aperture, and a columellar callus, and to combine them in a distinct species, Chilostoma (Cingulifera) frigidum. ...
... In contrast, C. achates is sister to all other studied Chilostoma species in the tree based on partial 16S rDNA sequences, albeit without statistical support (Fig. 3B). The analyses of Groenenberg et al. (2016), which were also mainly based on mitochondrial sequences, produced contradictory Fig. 6. Relationships between genetic and logarithmized geographical distances in pairs of individuals of two primary species hypotheses. ...
To better understand the origin of the high diversity and endemism in the Southern Alps of Europe, we investigated the phylogeny and population structure of the rock-dwelling snail group Chilostoma (Cingulifera) in the Southern Alps. We generated genomic ddRAD data and mitochondrial sequences of 104 Cingulifera specimens from 28 populations and 14 other Ariantinae. Until recently, about 30 Cingulifera taxa were classified as subspecies of a single polytypic species. The phylogenetic and population genetic analyses of the ddRAD data and mitochondrial sequences revealed that Cingulifera in the Southern Alps is differentiated into three species. Each of the three Chilostoma (Cingulifera) species occupies disjunct sub-areas, which are separated by areas occupied by other Chilostoma taxa. Neighbouring populations of different species show little or no admixture. Tests indicating that the genetic differentiation of the three Cingulifera taxa cannot be explained by isolation by distance confirmed their species status. The disjunct range patterns demonstrate the importance of stochastic events such as passive long-distance dispersal for the evolution of population structure and speciation in these snails, and of priority effects and ecological competition as important factors influencing species distributions.
... By now, the mitochondrial sequences still represent the bulk of existing genetic data for the Helicidae family (including Helicini). Nuclear sequence markers used to date consist mostly of the internal transcribed spacers 1 and 2 of the ribosomal rRNA cluster [20,27] and a gene for histone H3 (e.g., [24,28,29]). Genomic data are currently starting to be used [30] and the first draft genome of a helicid species has been published recently [31]. ...
... Kotsakiozi et al. [21] also included a part of the cytochrome c oxidase subunit II (cox2; 505 bp) and partial sequences of the 12S rRNA (12S) were used in some studies attempting to reconstruct relationships between species or genera [24,35,37]. Here, we also successfully tested the amplification and sequencing of the 361 bp part of cytochrome b (cytb), used by [28] in a study of the helicid subfamily Ariantinae, on several samples across the diversity of Helicini. We also sequenced the 3 half of the cox1 gene and the span between the cox1 and 16S genes, including the tRNA-Val gene, in representatives of major lineages within Helicini (as in [41]). ...
Sequences of mitochondrial genes revolutionized the understanding of animal diversity and continue to be an important tool in biodiversity research. In the tribe Helicini, a prominent group of the western Palaearctic land snail fauna, mitochondrial data accumulating since the 2000s helped to newly delimit genera, inform species-level taxonomy and reconstruct past range dynamics. We combined the published data with own unpublished sequences and provide a detailed overview of what they revealed about the diversity of the group. The delimitation of Helix is revised by placing Helix godetiana back in the genus and new synonymies are suggested within the genera Codringtonia and Helix. The spatial distribution of intraspecific mitochondrial lineages of several species is shown for the first time. Comparisons between species reveal considerable variation in distribution patterns of intraspecific lineages, from broad postglacial distributions to regions with a fine-scale pattern of allopatric lineage replacement. To provide a baseline for further research and information for anyone re-using the data, we thoroughly discuss the gaps in the current dataset, focusing on both taxonomic and geographic coverage. Thanks to the wealth of data already amassed and the relative ease with which they can be obtained, mitochondrial sequences remain an important source of information on intraspecific diversity over large areas and taxa.
... As it is unlikely that Paulucci could have confused two such different forms, it is assumed that this sample is not the original one. (Gittenberger, 1991(Gittenberger, , 2004Haase et al., 2003;Schileyko, 2013, Groenenberg et al., 2016 (Fiorentino et al., 2008a(Fiorentino et al., , 2008b(Fiorentino et al., , 2009(Fiorentino et al., , 2012, show how the populations of north-western and south-eastern Sicily must be considered in the Murella muralis group (or better as Murella sp., clade 1 and 5 in Fiorentino et al., 2008b), but the taxonomy at the genetic level does not agree with the morphological data. He lix muralis Var. ...
After the publication of the first part (Cianfanelli et al., 2021), the catalogue of taxa established by Marianna Paulucci Ximenes d’Aragona Panciatichi continues. In this second part, 35 taxa are examined. Following the chronological order of publication, two manuscripts from 1879 (Paulucci, 1879a, 1879b) and the subsequent ones published in two years (Paulucci, 1879–1880) are taken into account. The taxa analysis follows the same outline of the first part (Cianfanelli et al., 2021) with an analytic sheet for each taxon, divided into paragraphs (Original publication, Original description, Type locality, Type material, Current status, Remarks) and with the reproduction, for each taxon, of the high resolution photos of a sample of the typical series in the different main views. Other taxa mentioned in literature, erroneously attributed to Paulucci, other ones established by Paulucci considered as non-valid and others established by Paulucci, considered as nomina nuda, are also reported.
... Helicoidea, due to their peculiar natural history and historical biogeography, are interesting models for studies on evolutionary dynamics, and recent molecular works have started to provide more accurate representations of their evolutionary relationships (e.g., [10][11][12][13]). This is particularly true for several families and subfamilies, whose phylogenetic relationships have been described in several focused works (e.g., [10,13,14]), and more in general for the Helicoidea of the Western Palearctic, whose classification and phylogeny have been recently revised [9]. In particular, Razkin et al. [9] proposed an updated classification and phylogenetic relationships of the western Palearctic Helicoidea, confirming the taxonomic validity of many morphologically defined families and re-defining the systematic boundaries of many different groups respecting the monophyly of families, subfamilies, and tribes [9]. ...
... In this study, we performed a molecular and a comparative karyological analysis with standard, Quinacrine (Q-) staining, DAPI-and CMA3 banding, sequential C banding + fluorochromes, and NOR-FISH on land snail species belonging to three different Helicoidea families (Hygromiidae, Geomitridae, and Helicidae). To provide a molecular taxonomic attribution of the studied specimens, we also performed a molecular analysis using a segment of the mitochondrial 16S rRNA, which has been largely used in previous molecular studies on Helicoidea [9,13,14,[32][33][34]. Furthermore, to provide an updated assessment of the chromosomal diversity of the superfamily, we reviewed all the available literature from 1946 to 2021 using an updated taxonomy and nomenclature following World Register of Marine Species (WoRMS) [1] and Mollusca Base [2]. ...
... DNA was extracted from foot tissue samples following Sokolov [42]. For molecular analysis, we choose the mitochondrial 16S rRNA as the selected genetic marker considering its wide use in previous molecular studies on Helicoidea (e.g., [9,13,14,[32][33][34]) and its adequate taxon sampling available on GenBank. A mitochondrial segment of 16S rRNA of about 600 bp was amplified using the primer pair 16Sa (CGCCTGTTTATCAAAAACAT) and 16Sb (CCGGTCTGAAACTCAGATCAGT) [43]. ...
We performed a molecular and a comparative cytogenetic analysis on different Helicoidea species and a review of all the available chromosome data on the superfamily to provide an updated assessment of its karyological diversity. Standard karyotyping, banding techniques, and Fluorescence in situ hybridization of Nucleolus Organizer Region loci (NOR-FISH) were performed on fifteen species of three families: two Geomitridae, four Hygromiidae and nine Helicidae. The karyotypes of the studied species varied from 2n = 44 to 2n = 60, highlighting a high karyological diversity. NORs were on a single chromosome pair in Cernuella virgata and on multiple pairs in four Helicidae, representing ancestral and derived conditions, respectively. Heterochromatic C-bands were found on pericentromeric regions of few chromosomes, being Q- and 4′,6-diamidino-2-phenylindole (DAPI) negative. NOR-associated heterochromatin was C-banding and chromomycin A3 (CMA3) positive. Considering the available karyological evidence on Helicoidea and superimposing the chromosome data gathered from different sources on available phylogenetic inferences, we describe a karyotype of 2n = 60 with all biarmed elements as the ancestral state in the superfamily. From this condition, an accumulation of chromosome translocations led to karyotypes with a lower chromosome number (2n = 50–44). This process occurred independently in different lineages, while an augment of the chromosome number was detectable in Polygyridae. Chromosome inversions were also relevant chromosome rearrangements in Helicoidea, leading to the formation of telocentric elements in karyotypes with a relatively low chromosome count.
... We retrieved COI sequences of A. arbustorum specimens representing all subspecies as well as additional infraspecific forms, of four other Arianta species, including A. hessei for the first time, and of Cylindrus obtusus (Draparnaud, 1805) and Helicigona lapicida (Linnaeus, 1758) as additional outgroups from GenBank (sources of sequence data: Gittenberger et al., 2004;Ansart et al., 2014;Cadahía et al., 2014;Groenenberg, Subai & Gittenberger, 2016) and TreeBase (matrix acc. no. ...
... Haase et al. (2003) have shown that the alpine 'picea' populations do not represent a distinct taxon but share mitochondrial haplotypes with neighbouring A. a. arbustorum and A. a. styriaca populations. The specimens identified as 'picea' from Austria by Haase et al. (2003) and the one identified as 'picea' from Slovenia by Groenenberg et al. (2016) are not related to A. a. doriae; rather, they represent different lineages of the eastern clades (Fig. 1). ...
... The sister group relationship between Arianta and the Eastern Alpine endemic Cylindrus obtusus (Cadahía et al., 2014;Groenenberg et al., 2016) and the occurrence of two endemic Arianta species in the Eastern Alps, A. chamaeleon (Pfeiffer, 1868) and A. schmidtii (the sister species of A. arbustorum; Fig. 1), indicate that the genus originated in the Eastern Alps. Arianta arbustorum split into two sister groups, a western clade including alpine subspecies from the Pyrenees and the Western Alps, and an eastern group (Fig. 1). ...
Alpine Arianta populations from the Biellese Alps in Italy are characterized by imperforate, thin-shelled, dark brown shells without or with sparse light spots that resemble widespread phenotypes of Arianta arbustorum arbustorum found in calcium-deficient areas. Therefore, they were not considered a distinct taxon. However, molecular phylogenetic analyses show that they belong to a group of subspecies of A. arbustorum from the Western Alps and the Pyrenees. We classify them as a distinct subspecies, Arianta a. doriae (Paulucci, 1878), which reduces the geographical gap between the western group of subspecies of A. arbustorum and the Eastern Alps where Arianta originated. This subspecies survived the glacials in a peripheral mountain refuge at the southern margin of the Biellese Alps.
... Puente et al., 2005;Alba et al., 2011;Welter-Schultes, 2012;Razkin et al., 2015;. En canvi, emprant anàlisi filogenètica, Groenenberg et al. (2016), i més recentment Bondareva et al. (2020), consideren que és una subespècie: Arianta arbustorum xatartii (Farines, 1834). Cal destacar que aquesta combinació nomenclatural, que és la que utilitzem en el present treball, ja va ser emprada anys enrere, entre d'altres, per Falkner et al. (2002) i Gittenberger et al. (2004). ...
... Corneola Held, 1838 312 Corneola acrotricha (P. Fischer, 1877) 313 Corneola desmoulinsii atricha Bofill, 1915 314 Corneola desmoulinsii bechi (Altimira, 1959) 315 Corneola desmoulinsii desmoulinsii (Farines, 1834) Pel que fa a les espècies que Alba et al. (2011) incloïen encara dins del gènere Chilostoma Fitzinger, 1833, en el present treball seguim el criteri de Groenenberg et al. (2016), en base a estudis filogenètics, i considerem Corneola Held, 1838, com a gènere i no com a subgènere. Malgrat que i MolluscaBase (2020) usen Corneola squamatina (Rossm.), ...
... Puente et al., 2005;Alba et al., 2011;Welter-Schultes, 2012;Razkin et al., 2015;. In contrast, using phylogenetic analysis, Groenenberg et al. (2016), and more recently Bondareva et al. (2020), considered it a subspecies: Arianta arbustorum xatartii (Farines, 1834). It should be noted that this nomenclatural combination, which is the one we use in the present work, was already used years ago, among others, by Falkner et al. (2002) and Gittenberger et al. (2004). ...
The continental molluscs of Catalonia and Andorra (Iberian Peninsula). Annotated list. - An updated, annotated list of terrestrial and freshwater molluscs (Gastropoda and Bivalvia) from Catalonia and Andorra (Iberian Peninsula) is presented. It includes new taxa (species and subspecies), new citations, and taxonomic and nomenclaturale changes that have taken place in recent years. It also mentions those species that, despite being mentioned in previous lists, are not currently considered present in the study area. All these changes are justified in detail. A total of 357 taxa are computed: 332 gastropod species and subspecies (302 when only species are counted) and 25 bivalve species. The proportion of endemic taxa is 16% (11% considered only at the species level), and the percentage of introduced taxa is 8% (9%).
... The first of these is already known to be the most useful molecular marker for species identification (Fontaneto et al. 2015); however, as we show, cytochrome b is also variable enough to distinguish Deroceras species. Moreover, cytochrome b was successfully used for identifying species and deliminating members of other gastropod families (e.g., Merritt et al. 1998;Groenenberg et al. 2016). Notably, amplification and/or sequencing of these two DNA fragments are often problematic because of their length, so obtaining good quality sequences is challenging but possible in most cases with specific primers designed for short DNA fragments. ...
Some species of slugs belonging to the genus Deroceras are invasive and cause severe agricultural
damage. Despite extensive knowledge about their invasiveness, data on the molecular differentiation of
these morphologically similar species are lacking. Here we present a molecular approach to identifying
three closely related species of the genus Deroceras—D. agreste (L., 1758), D. reticulatum (O. F.
Müller, 1774) and D. turcicum (Simroth, 1894) (Gastropoda: Eupulmonata: Agriolimacidae)—based on
sequences of multiple molecular markers: cytochrome c oxidase subunit I (COI), cytochrome b (cyt-b),
internal transcribed spacer 2 (ITS-2) and 28S ribosomal RNA (28S rRNA). We also provide detailed
photomicrographs of the penis and penial gland of the three species, as it is the latter that holds the
most important phenotypic characters for distinguishing between these taxa. Since identification of the
studied species based solely on morphology is considered challenging, contributing a means of molecular
differentiation will aid further ecological and biodiversity surveys of these important pests.
... This species was previously subsequently classified in different genera such as Helix L., 1758;Campylaea Beck, 1837;Helicigona Férussac, 1821;Chilostoma Fitzinger, 1833, and finally Faustina Kobelt, 1904(Subai and Neubert 2016. Groenenberg et al. (2016) in their systematic study on Ariantinae presented phylogenetic relationships between F. faustina and other closely related species confirming its placement within the genus Faustina. This study was based on combining data of traditional shell morphology, genital anatomy, and DNA sequences (H3, CytB, 16S, COI markers). ...
... This study was based on combining data of traditional shell morphology, genital anatomy, and DNA sequences (H3, CytB, 16S, COI markers). In the constructed phylogenetic tree based on H3-COI-CytB dataset, all individuals of F. faustina formed one, separate clade without any other Chilostoma, Helicigona, or Campylaea species (Groenenberg et al. 2016). According to this study, Faustina is the most closely related to the genus Kosicia Brusina, 1904 with the split between them estimated at 56-51.7 MYA (Groenenberg et al. 2016). ...
... In the constructed phylogenetic tree based on H3-COI-CytB dataset, all individuals of F. faustina formed one, separate clade without any other Chilostoma, Helicigona, or Campylaea species (Groenenberg et al. 2016). According to this study, Faustina is the most closely related to the genus Kosicia Brusina, 1904 with the split between them estimated at 56-51.7 MYA (Groenenberg et al. 2016). ...
Faustina faustina is a conchologically highly diverse forest gastropod with several morphological forms. It is a Carpathian species, but it also occurs in northern isolated localities, where it was probably introduced. We performed the first phylogeographic analysis of 22 populations, based on three molecular markers: COI, ITS-2 and 28S rRNA. Genetic data were complemented by paleo-distribution models of spatial occupancy during the Last Glacial Maximum to strengthen inferences of refugial areas. We discovered high genetic variability of COI sequences with p-distances between haplotypes ranged from 0.2% to 18.1% (6.3-16.6% between clades). For nuclear markers a haplotype distribution pattern was revealed. Species distribution models indicated a few potential refugia in the Carpathians, with the most climatically stable and largest areas in the Southern Carpathians. In some climate scenarios, putative microrefugia were also predicted in the Western and Eastern Carpathians, and in the Apuseni Mts. Our results suggest the glacial in situ survival of F. faustina and its Holocene expansion in the Sudetes. Although our genetic data as well as shell phenotypes showed considerable variation within and between studied populations the molecular species delimitations approaches still imply only one single species. Our study contributes to the understanding of the impact of processes on shaping contemporary population genetic structure and diversity in low-dispersal, forest species.
... The three subgenera formerly belonging to Chilostoma are now considered separate genera. Cattania, Thiessea and Josephinella (Cadahía et al., 2013;Groenenberg, 2012;Groenenberg, Subai, & Gittenberger, 2016) with 5, 14 and 13 species, respectively, in Greece. ...
Overall, 695 land snail and slug species have been recorded from Greece, 59% being endemic, but these figures are expected to be quite higher. Thus, the Greek terrestrial malacofauna is the richest in Europe, with the highest level of endemics at different spatial and taxonomic scales. Greek land snails are represented by six major chorotypes. Apart of endemics, the dominant types are the Balkan and the Mediterranean. A large part of current knowledge on Greek land snails’ biogeography, ecology, phylogeny and phylogeography is attributed to Prof. M. Mylonas and his students.
Mylonas was the first to provide a body of reliable data on the molluscan fauna of numerous Greek islands, to present an ISAR for the land snails of Aegean islands, and he identified early on the effect of humans on biogeographical patterns. The fragmented mainland and archipelagoes of Greece provide an ideal natural scenery for investigating biogeographic and evolutionary patterns, such as speciation. Some land snails distributed in Greece have become models for such research. Many land snails of Greece are under risk, and some are in the brink of extinction, facing threats associated with modification of their habitat. Therefore, more research and concrete conservation measures are needed for their protection.
