Content uploaded by Abhijit Das
Author content
All content in this area was uploaded by Abhijit Das on Apr 23, 2023
Content may be subject to copyright.
ZOOTAXA
ISSN 1175-5326 (print edition)
ISSN 1175-5334 (online edition)
Accepted by K. Tamar: 9 Mar. 2023; published: 20 Apr. 2023 151
Zootaxa 5270 (2): 151–193
https://www.mapress.com/zt/
Copyright © 2023 Magnolia Press Article
https://doi.org/10.11646/zootaxa.5270.2.1
http://zoobank.org/urn:lsid:zoobank.org:pub:3F2D3497-9B12-48DE-9A15-6B09F6C37334
A taxonomic revision of Boiga multomaculata (Boie, 1827) and
B. ochracea (Theobald, 1868), with the description of a new subspecies
(Squamata, Serpentes, Colubridae)
GUNTHER KÖHLER1*, PANUPONG THAMMACHOTI CHARUNROCHANA2, LINDA MOGK1,9, NI LAR
THAN3, NIA KURNIAWAN4, AHMAD MUAMMAR KADAFI5, ABHIJIT DAS6, FRANK TILLACK7# &
MARK O’SHEA8#
1Senckenberg Forschungsinstitut und Naturmuseum, Senckenberganlage 25, 60325 Frankfurt a.M., Germany.
2Department of Biology, Faculty of Science, Chulalongkorn University, Bangkok, Thailand 10330.
�
panupong.th@chula.ac.th; https://orcid.org/0000-0003-3477-8964
3Pathein University, Pathein, Myanmar.
�
nilarthan65@gmail.com; https://orcid.org/0000-0002-1098-7406
4Department of Biology, Universitas Brawijaya, Malang, Indonesia.
�
wawan@ub.ac.id; https://orcid.org/0000-0001-7383-8742
5Department of Biology, Faculty of Mathematics and Science, University of Palangka Raya, Indonesia.
�
amuammarkadafi@mipa.upr.ac.id; https://orcid.org/0000-0003-4646-687X
6Wildlife Institute of India, Chandrabani, Dehradun 248001 Uttarakhand, India.
�
protobothrops80@gmail.com; https://orcid.org/0000-0002-5851-8457
7
�
frank.tillack@mfn.berlin; https://orcid.org/0000-0003-1418-6531
8
�
m.oshea@wlv.ac.uk; https://orcid.org/0000-0002-1566-7460
9
�
lmogk@senckenberg.de; https://orcid.org/0000-0003-2700-6675
#these authors contributed equally
*Corresponding author.
�
gkoehler@senckenberg.de; https://orcid.org/0000-0002-2563-5331
Abstract
The analyses of molecular genetic data (mtDNA markers 16S, ND4, CYTB, and the nuclear marker c-mos) provided
evidence that the Asian cat snake taxa Boiga multomaculata and B. ochracea actually represent a single species. They
form mixed clades of low intraclade genetic differentiation. This evidence for conspecificy is supported by the lack of
differentiation in all examined pholidotic and morphometric characters. Therefore, we formally place Dipsas ochracea
Theobald, 1868 in the synonymy of Dipsas multomaculata Boie, 1827. We provide a summary of the tangled taxonomic
history of the taxa involved in this study. Also, we resurrect Dipsadomorphus Wall, 1909 from synonymy
of B. ochracea, for specimens exhibiting 21 midbody dorsal scale rows. is found in the Himalayas
north and west of the Brahmaputra valley. Finally, based on the detection of historical genetic lineages within the newly
defined species Boiga multomaculata we recognize three subspecies: Boiga multomaculata multomaculata (Boie, 1827),
Boiga multomaculata ochracea (Theobald, 1868), and Boiga multomaculata septentrionalis n. ssp. which is distributed in
northern Myanmar and Assam and Nagaland, India. We designate BMNH 1946.1.2.60 (1) as neotype of Dipsas ochracea
Theobald, (2) as lectotype of D. ochraceus Günther, and (3) as lectotype of Boiga ochracea walli Smith, thereby making
these names objective synonyms. Finally, we designate BMNH 94.12.31.55 as lectotype of
Wall.
Key words: Asian cat snakes, Boiga , Boiga ochracea walli, color morphs, mimicry, Himalayas, Southeast
Asia
Introduction
Coloration and pattern are considered reliable characters that aid in the differentiation and identification of snake
species of many genera (i.e.,; Wilson 1999; Köhler 2008). In the Asian
cat snakes of the genus Boiga Fitzinger 1826, characters of coloration and patterning are also utilized in the available
KÖHLER
152 · Zootaxa 5270 (2) © 2023 Magnolia Press
dichotomous keys to the genus (e.g., Taylor 1965; Schleich & Kästle 2002; Giri et al. 2019; Ganesh et al. 2020).
During several field trips in Myanmar (2017–2019) we collected six specimens of Boiga, which we identified
as B. ochracea or B. multomaculata, based on their color pattern. However, when we generated and analyzed
mtDNA barcode sequences (16S rRNA), we were surprised to detect virtually no genetic differentiation among
specimens referred to these two taxa. However, before we could publish these findings, other authors (Weinell et al.
2021; Ganesh et al. 2021) already reported their observation that B. ochracea and B. multomaculata are very close
genetically and questioned the heterospecificy of these two nominal taxa.
Based on our initial findings we initiated an integrative taxonomic study to clarify the taxonomy of the
populations currently referred to as B. ochracea and B. multomaculata. See Fig. 1 for the geographic distribution of
the phenotypes associated with these two taxa.
FIGURE 1. Map showing collecting localities of Boiga specimens identified as B. multomaculata (brown circles with central
black dot) and B. ochracea (orange circles). Each symbol can represent one or more adjacent localities. Source: Specimens
examined by authors and data downloaded from GBIF as well as literature records. Insert: Boiga specimens in life. A. Boiga
multomaculata phenotype (SMF 104138); B. B. ochracea phenotype (SMF 103827). Photographs by G.K.
To set the stage, it seems appropriate to investigate the taxonomic history and geographic distribution of the
taxa involved in this study. This is not a simple process and does involve some sleuthing to determine collection
and publication dates and collector’s and collection localities, factors affecting priority, authorship and synonymy,
a process termed “forensic historical herpetology” (O’Shea & Kaiser 2018).
Boiga multomaculata
Dipsas multomaculata was described by Heinrich Boie’s elder brother Friedrich (1789–1870), in Latin and
German (Boie 1827), and published in the year of Heinrich’s death. It has been suggested that Friedrich Boie
attributed his description to H. Boie’s (1823–1825) “Erpétologie de Java” (Wallach et al. 2014). The latter work
was never published and names proposed therein are considered unavailable for the purposes of nomenclature,
according to the International Code of Zoological Nomenclature (ICZN 1999; ICZN 2012), hereafter referred to
REVISION OF Zootaxa 5270 (2) © 2023 Magnolia Press · 153
as “the Code”. However, F. Boie does not actually cite his brother’s unpublished work in his D. multomaculata
species account. Rather he cites the Prussian-born Dutch pharmacist and botanist Caspar Georg Carl Reinwardt
(1773–1854), yet no Reinwardt 1825 paper describing this taxon exists and it must be assumed that F. Boie was
the person who introduced this binomen. Since Boie does attribute the taxon name to Reinwardt the degree of his
involvement must therefore be determined. If Reinwardt just contributed the name with the specimen the citation
would be Dipsas multomaculata F. Boie, 1827, but if he contributed both the name and a description of sorts, then
the citation should be Dipsas multomaculata Reinwardt in F. Boie, 1827 (Aaron Bauer, pers. comm.). It would
appear that the first scenario is correct (see also David & Vogel 1996:21). Thus, the author citation is F. Boie, 1827
not Reinwardt in F. Boie, 1827 because F. Boie attributes the name to Reinwardt but not the description. Schlegel
(1826:238) also attributes the description of Dipsas multomaculata to Reinwardt when he writes „Gen. Laur.
Cuo, Esp. ……Col. multimaculatus (sic) Reinw. N. esp. …”
There is nothing in F. Boie’s account to suggest he referred to his brother’s unpublished manuscript for his
description of D. multomaculata. However, the comparison of H. Boie´s manuscript part for “Dipsas multimaculata”
and Friedrich Boie’s (1827) text on “[Dipsas] multomaculata”, which we regard as the original description, shows,
that the latter is a verbatim copy of H. Boie´s manuscript with the exception of the different spelling of the species
name and the reference to images which depict this species in earlier classical works.
The primary types of this taxon have been stated to be unlocated (Nguyen et al. 2009; Uetz et al. 2019),
as deposited in “RMNH” (Iskandar & Colijn 2002) or listed with incorrect quantity, syntype composition, and
collectors (Wallach et al. 2014). They are actually present in the collection of the Naturalis Biodiversity Center
(formerly Rijksmuseum van Natuurlijke Histoire, Leiden, Netherlands) and have been examined by one of the
authors (FT).
The enquiries in Leiden by FT and MOS revealed that H. Boie wrote his manuscript between 1823 and 1825,
i.e., before his departure for Java. However, this also means that the material he and Macklot collected on Java
between June 1826 and September 1827 (= RMNH 978a+b) was not available to him when he wrote his manuscript.
Thus, material used for the description must have already been in the Leiden collection. Therefore, only material
that was previously collected by Kuhl and van Hasselt or Reinwardt would have been available to him and are very
likely the specimens listed under RMNH 979. The material collected by H. Boie and Macklot (RMNH 978a+b)
could never have been part of the type series of D. multomaculata because F. Boie (1827) added nothing new to his
brother’s text. It has to be noted that the order of the inventory numbers does not relate to the order of accession into
the Leiden collection. A specimen (i.e., ZMB 2642) in the collection of the Museum für Naturkunde Berlin very
likely also belonged to the original type series of D. multomaculata. According to a letter dated “Leyden, 2nd April
1825” (preserved in the Dept. of Historical Research of Berlin Museum, Acta Sign. ZM, Dr. Temminck, Leyden,
1818), Heinrich Boie wrote to Martin Hinrich Carl Lichtenstein (1780–1857, Director of the ZMB at that time) and
offered him beside many other specimens from Java under list number “38” a specimen of “Dipsas multimaculata”
for the price of 1 [Reichsthaler]. The same specimen appeared with the same number and same price in a list written
by Lichtenstein documenting the arrival of the objects with the following title [translation by us]: „List of the objects
sent by Mr. Temminck from Leyden and arrived at the Museum [Berlin] on 9 March 1826“. These hitherto unnoticed
documents suggest that the specimen of D. multomaculata offered by H. Boie to the Berlin Museum in April 1825
must have belonged to the original type series and was probably collected by Kuhl and Van Hasselt and available to
H. Boie when he worked on his manuscript. In addition, the scalation values of ZMB 2642 are within the variation
given by H. Boie in his manuscript. The main reason why this specimen has not been considered as a type specimen
so far is probably the fact that it is linked only to Coenraad Jacob Temminck (director of the Rijksmuseum van
Natuurlijke Historie, Leiden and treasurer of the Dutch East India Company) who is cited as the donor in the Berlin
Museum inventory catalogue and no one had previously evaluated the associated correspondence.
Only RMNH 979 (a jar which contains six specimens) and the specimen later sent to the Zoologisches Museum
Berlin were available for H. Boie’s manuscript. Of the six specimens under RMNH 979 only specimen b, d, e and
f (all females) fit the scalation data of H. Boie (manuscript) and F. Boie (1827). Thus, in our opinion, the extant
syntype series of D. multomaculata F. Boie 1827 consists of ZMB 2642 and four out of the six specimens listed
under RMNH 979.
The German naturalists Heinrich Boie (1794–1827) and Heinrich Christian Macklot (1799–1832) visited Java
between December 1825 and September 1827. Esther Dondorp (Senior Collection Manager) and Karien Lahaise
(Naturalis archivist) informed MOS that according to an unpublished manuscript by Marinus Hoogmoed “H. Boie
and Macklot arrived in Java on 6 June 1826. On December 28, 1826 they travelled to Krawang (Tjikao) [now
KÖHLER
154 · Zootaxa 5270 (2) © 2023 Magnolia Press
Karawang, a town in West Java regency, Tjikao, now Ci Kao, is a watercourse south of Karawang]. H. Boie died
on 4 September 1827”. Thus, the dates that both were working in Java together and collected these specimens
may therefore be defined more accurately as 6 June 1826 to 4 September 1827. The two were in the employ of the
Rijksmuseum voor Natuurlijke Historie (RMNH), as part of the Natuurkundige Commissie voor Nederlandsche
Indie (Commission for Natural Sciences of the East Indies).
In all documents (letters and manuscript) from H. Boie’s hand and publications based on H. Boie’s manuscript
or written notifications by him (e.g., Schlegel 1826 and 1827) the spelling “multimaculata” is used exclusively. This
also applies to the Leiden catalogue entries. Although this is to be taken as a clear expression of his will, we have to
accept Friedrich Boie´s (1827) “multomaculata”, since the latter is responsible for the valid introduction of the name
in the sense of the Code, Art. 50.1. This is also in line with the statements of David & Vogel (1996:21).
Numerous authors erroneously referred to this species as Dipsas multimaculatus or D. multimaculata (e.g.,
Duméril et al. 1854b; Duméril et al. 1854a; Theobald 1868b; Boulenger 1890), and this misspelling of multomaculata
as multimaculatus would continue when Boulenger (1896) placed the rear-fanged Asian cat snakes into the resurrected
Dipsadomorphus, and even when they were transferred to Boiga by Smith (1923). In recent years most authors have
been careful to use F. Boie’s correct spelling Boiga multomaculata.
A number of obscure names have been proposed as synonyms of B. multomaculata. Wallach et al. (2014)
suggested Coluber aldrovandi Merrem, 1820, to be a synonym of this taxon. However, reading Merrem´s description
(1820:125) it becomes obvious that it is not even a Boiga because some of the main characters noted by Merrem,
e.g., keeled scales, head pointedly rounded, and the absence of a loreal scale are not characteristic for this genus.
Also the values for ventrals (121) and subcaudals (49) of Merrem´s aldrovandi are far outside the range of B.
multomaculata (see Table 1). Their action to declare Dipsas multomaculata a nomen protectum with priority over
“Coluber aldrovandi” is therefore obsolete. Furthermore, Merrem´s taxon was not described in the combination with
the genus name Coluber but with „Natrix“. The name “Natrix sturmii” is based on an unpublished manuscript dated
around 1825 by Johann Georg Wagler (1800–1832) (pers. comm. Van Wallach 17 March 2022) and is considered
nomen ineditum because it was not been properly published according to the Code.
Rudolf Emil Mell (1878–1970) was a German school-teacher and amateur naturalist collector working
in China in the early 20th Century. He returned to Germany in May 1921 and later proposed several subspecies
of B. multomaculatus (Mell 1931), i.e., B. m. hainanensis, B. m. indica, and B. m. sikiangensis but these taxa
have been considered synonyms of B. multomaculata since their inception (e.g., Pope 1935; Bourret 1936; Smith
1943). Whereas the syntypes of B. m. sikiangensis are known (i.e. ZMB 49427, 50879, 52642), no type material is
known to exist for B. m. hainanensis or B. m. indica. The type localities of B. m. hainanensis (“Hainan”) and B. m.
sikiangensis (“Kwangtung (Hongkong)”) are more precise than the one given for B. m. indica (“continental India”),
especially since continental India at that time included Sikkim, Assam, Bengal (including today’s Bangladesh),
Burma (Myanmar), and Pakistan.
The various author’s copies of this publication that Mell distributed, including the one in the departmental
herpetological library at Senckenberg Forschungsinstitut, contain a handwritten correction of B. m. hainanensis
to “sikiangensis Mell”. Presumably, the author had a change of mind regarding his taxon name, but this has no
nomenclatorial relevance. As far as we know, Mell never corrected it formally in a subsequent publication and the
introduction of the name hainanensis must be regarded as valid published in the sense of the Code. At the time of
writing Mell’s subspecies were not listed in the Reptile Database (Uetz et al. 2022).
Boiga ochracea
In 1868 the description of Dipsas ochraceus was published by the German zoologist Albert Karl Ludwig Gotthilf
Günther (1830–1914), then an assistant at the British Museum (Natural History) tasked with identifying 2,000 snake
specimens in the collection. In his brief description of this species Günther (1868: 425), wrote: “We have received
this new snake from Mr. Theobald, who named it “, thereby attributing the authorship to William Theobald (1829–
1908), a naturalist attached to the British Geological Survey of India. To complicate matters, Theobald (1868:53)
also published a description of Dipsas ochracea, in Latin and English, in the same year.
The Reptile Database (Uetz et al. 2022) suggested that Theobald’s paper was published prior to Günther’s paper,
pointing out that Günther referred to Theobald in his paper, but without providing a published source. The editors
may have assumed that Günther had access to Theobald’s already published paper, thereby attributing authorship
to Theobald, 1868. Wallach et al. (2014) were of the contrary opinion and proposed that the first description of D.
ochraceus appeared in the Günther paper, and the authorship should therefore read “Theobald in Günther, 1868”.
REVISION OF Zootaxa 5270 (2) © 2023 Magnolia Press · 155
TABLE 1. Selected measurements and proportions of the taxa of Boiga related to B. multomaculata. Range is followed by mean value and standard deviation in parentheses.
Abbreviations: m. = multomaculata; multom. = multomaculata; ochr. = ochracea; sept. = septentrionalis.
m. multom. m. multom. m. ochr. m. ochr. m. sept. m. sept.
n 13 26 13 27 7 4 14 28
SVL 351–689
(495.2±99.85)
346–695
(558.4±91.81)
376–700
(544.7±94.17)
402–958
(664.6±126.80)
439–665
(585.8±80.87)
661–785
(727.8±64.01)
486–840
(695.2±98.63)
379–940
(719.5±158.30)
TL/SVL 0.243–0.291
(0.263±0.0142)
0.232–0.269
(0.249±0.0010)
0.222–0.288
(0.267±0.0169)
0.214–0.282
(0.2446±0.0156)
0.235–0.280
(0.260±0.0152)
0.246–0.256
(0.252±0.0049)
0.247–0.305
(0.276±0.0158)
0.236–0.302
(0.264±0.0165)
ventrals 209–239
(214.4±8.06)
198–237
(217.1±9.50)
225–242
(231.3±5.15)
228–258
(238.9±6.30)
220–235
(227.7±5.18)
227–231
(228.8±1.71)
222–238
(229.2±5.49)
224–247
(236.2±5.81)
subcaudals 87–104
(94.5±5.33)
81–101
(89.8±4.13)
93–108
(102.8±4.72)
87–112
(99.6±5.05)
90–105
(99.1±5.82
95–100
(97.3±2.06)
102–120
(111.2±5.62)
93–116
(106.0±5.82)
SPL 8–9
(8.1±0.30)
8–8.5
(8.1±0.18)
8–8
(8.0±0)
8–9
(8.04±0.13)
8–8
(8.0±0)
8–8
(8.0±0)
8–8
(8.0±0.00)
8–9
(8.1±0.18)
IFL 10–13
(10.7±0.81)
10–12
(10.9±0.39)
10–12
(11.1±0.34)
9–12
(11.1±0.61)
10–11
(10.9±0.19)
10–11
(10.7±0.58)
11–13
(11.4±0.59)
10–14
(11.7±0.91)
postocs 2–3
(2.0±0.14)
2–3
(2.1±0.25)
2–2
(2.0±0)
1–3
(2.0±0.14)
1–2
(1.9±0.38)
2–2
(2.0±0)
2–2
(2.0±0)
2–2
(2.0±0)
TempAnt 1–2
(1.8±0.38)
1–2
(1.8±0.38)
1–3
(2.0±0.20)
1–2
(1.8±0.34)
2–2
(2.0±0)
1–2
(1.9±0.25)
1–2
(1.8±0.32)
1–3
(2.0±0.18)
TempPos 2–3
(2.3±0.33)
1–3
(2.1±0.36)
1–3
(2.1±0.55)
2–4
(2.3±0.42)
2–3
(2.4±0.48)
2–3
(2.13±0.25)
2–4
(2.5±0.54)
2–4
(2.5±0.48)
MBS 19
(19±0.0)
19
(19±0.0)
19
(19±0.0)
19
(19±0.0)
19
(19±0.0)
19
(19±0.0)
21
(2±0.0)
21
(21±0.0)
PSR 13–15
(13.9±1.04)
13–15
(14.5±0.90)
13–15
(13.9±1.04)
13–15
(14.5±0.89)
13–15
(14.7±0.76)
15–15
(15.0±0)
15–17
(15.1±0.53)
15–17
(15.2±0.54)
KÖHLER
156 · Zootaxa 5270 (2) © 2023 Magnolia Press
This question over the priority of authorship can only be resolved by determining which of these two papers was
published first. Günther published his description in the Annals and Magazine of Natural History, series 4, volume 1,
number 6, which was published on 1st June 1868 (Evenhuis 2003; F. Tillack unpubl. obs.). Theobald published his
account in the Journal of the Linnean Society of London (Zoology), volume 10, number 41. The year of publication
is often given as 1868 (Smith 1943; Wallach et al. 2014; Uetz et al. 2022) but the situation is somewhat unclear.
Following its title, Theobald’s paper reads “By W. Theobald. Jun., Geological Survey of India. Communicated
by G. Busk, Esq., Sec. L.S. [Read November 7, 1867.]”. The paper was therefore presented orally at a meeting
of the Linnean Society of London in late 1867, but that does not constitute “published” according to the Code.
According to the title page of the journal, volume 10 was not published until 1870 (Theobald 1868b) which would
seem to give priority to Günther’s 1868 paper, but this was not the actual date of publication of Theobald’s paper.
According to the archives of the Linnean Society of London “pages 4–67 of Volume 10 of the Journal of the Linnean
Society of London (Zoology) were issued on 30 May 1868. The reason the front page is dated 1870 (May 20th) is
because that is when the title and contents page were finished, ready for the rest of the journal to be bound” (Vida
Milovanovic, Linnean Society of London, pers. comm.; F. Tillack unpubl. obs.). Therefore, Theobald’s description
takes precedence over Günther’s paper, by two days, and the correct citation should be Theobald (1868).
Amongst the distinguishing characteristics of D. ochraceus, Günther documented 19 dorsal scale rows, 239–242
ventral scales, and 100 subcaudal scales. His description was based on the two specimens obtained from Theobald,
the largest of which he measured at 44 inches (1.12 m), and both of which, he reports, were collected at Pegu (now
that his second specimen was collected by Colonel David Browne, at Maulmain (=Moulmein, now Mawlamyine,
the first specimen at fully nine inches (229 mm) shorter than the measurement provided by Günther, and finally,
Theobald reports that both specimens exhibited dorsal scale counts of 19 on the neck, 17 on the body, and 15
near the tail, in contrast to the dorsal count of 19 provided by Günther, presumably taken at midbody, and a count
supported by Boulenger (1896) and Stimson (see later). Given the reported differences in localities, collectors and
description, there is no doubt that the two authors described their species using different specimens. However,
regarding the reported differences in the number of dorsal scale rows at midbody, it has to be noted that many Boiga
have a rather chaotic dorsal scale row reduction which can go up and down more than three times within a range of
only 10 corresponding ventral scales “at midbody”. Furthermore, the measured midbody can be different from the
midbody position determined by counting half the number of ventrals.
Both Günther’s syntypes, an adult female with an SVL 889 + 212 TL = 1101 mm total length and an adult male
with an SVL 611 + TL 149 = 760 mm total length, are housed in the collection of the Natural History Museum,
London (BMNH 1946.1.2.60–61).
As far as we are aware, the two types of D. ochracea Theobald are unlocated. They were not listed by Theobald
(1868a), nor in Sclater (1891) or in Das et al. (1998). Some time ago one of us (AD) checked the collection in ZSI,
Kolkata, but found no specimens marked as type for Theobald´s ochracea and none of the specimens examined by
him agreed with Theobald’s description or locality.
During the late 19th Century the British Museum (Natural History) received five further specimens of D.
ochracea from Myanmar, i.e., two specimens (BMNH 74.4.29.1193–1194) from Myanmar, reportedly collected
by the British army officer and naturalist Richard Henry Beddome (1830–1911), and three specimens (BMNH
89.2.25.37–39) from Bhamo, in Kachin State, northern Myanmar, collected by the Italian naturalist Leonardo Fea
(1852–1903).
Ferdinand Stoliczka (1838–1874) was a Austrian paleontologist and naturalist who worked in India during the
mid 19th Century, but died of altitude sickness during a Himalayan expedition. He exhibited a considerable interest
in snakes and in 1870 he reported on five specimens from the Andaman Islands which he attributed to the taxon
Dipsas hexagonotus Blyth, 1855 (Stoliczka 1870).
In the late 19th Century the Anglo-Belgian zoologist George Albert Boulenger (1858–1937), was Günther’s
assistant at the British Museum (Natural History) and the person now tasked with the continued cataloguing of the
herpetological collection. In 1890 he resurrected the genus Dipsadomorphus Fitzinger, 1843, for the African, Asian,
and Australasian cat snakes previously included in the genus Dipsas (Boulenger 1890; Boulenger 1896) and he
synonymised Günther’s Dipsas ochraceus with Blyth’s older Dipsadomorphus hexagonatus.
REVISION OF Zootaxa 5270 (2) © 2023 Magnolia Press · 157
Adopting this new classification, the British physician and herpetologist Major Frank Wall (1868–1950)
examined Blyth’s Dipsas hexagonotus type specimen (ZSIK 8048), from “Cherrapunji, Khasi Hills, Assam” [=
Sohra, East Khasi Hills district, Meghalaya state, India] and reidentified it as a juvenile Dipsadomorphus cyaneus,
now Boiga cyanea (Duméril, Bibron and Duméril, 1854) (Wall 1909). He also examined the four adult specimens
in Stoliczka’s Andaman Dipsas hexagonotus, which exhibited a dorsal scale count of 21, and included them in
the syntype series of his new species Dispadomorphus andamanensis, now Boiga andamanensis. The remaining
specimen from Stoliczka’s Andaman series reportedly possessed 19 dorsal scale rows, but Wall commented that its
description was imperfect and the specimen itself appeared to be lost.
Further, Wall (1909) recognized that the mainland D. hexagonotus material he had available appeared to
represent two different taxa. Five of the BMNH specimens (BMNH 1946.1.2.60–61, 89.2.25.37–39) from Myanmar,
and a further nine specimens he had personally collected, all possessed 19 dorsal scale rows, 221–245 ventrals and
89–107 subcaudals which complied with the description of D. hexagonotus, and to which he applied that name,
citing Stoliczka’s missing Andaman specimen as the holotype. It is curious that he sought to conserve the name
“hexagonotus”, as Dipsadomorphus hexagonotus, by transferring it from Blyth’s holotype, now known to be a
juvenile D. cyaneus, to Stoliczka’s missing and incompletely described juvenile. Fortunately, this move is illegal
according to the Code (Smith 1943), meaning the name is unavailable and D. hexagonotus remains synonymized
with D. cyaneus. The Myanmar population with 19 dorsal scale rows should therefore be known as D. ochracea.
Two further Myanmar specimens available to Wall (BMNH 74.4.19.1193–94) exhibited a dorsal count of 21,
which was more akin to that obtained from Himalayan specimens. These two specimens were reportedly collected
in Myanmar, well within the range of those specimens attributed by Wall to D. hexagonotus. However, they were
collected by Beddome, and Wall had already voiced criticism regarding the accuracy of Beddome’s record keeping.
In the case of these two specimens he suggested that they could have easily come from “the hills to the west or north
of Burma, the fauna of which closely agrees with that of the Eastern Himalayas”. Furthermore, Smith (1943) stated
that Beddome never visited Burma, and therefore the long-accepted collection locality for these two specimens must
be treated as extremely suspect. Similarly, a specimen of “Boiga ochracea” donated by Beddome to the Museum of
Comparative Zoology (i.e., MCZ R-3886) is said to come from “Madras” [Chennai] at the southeast coast on India.
However, the given locality is far outside the distribution limits of this group and our reexamination revealed that
this specimen is a which very likely originated from the eastern Himalayas.
Wall (1909) also examined 39 specimens from the Darjeeling area of West Bengal, India, which exhibited 21
dorsal scale rows, 218–252 ventrals, and 100–119 subcaudals. To this series he added a further three Darjeeling
specimens in the British Museum (Natural History). Two of these (BMNH 72.4.17.119, 72.4.17.386) were collected
by the British naturalist and physician Thomas Caverhill Jerdon (1811–1872), while the third specimen (BMNH
94.12.31.55) was collected by the British geologist and naturalist William Thomas Blanford (1832–1905). Finding
this Eastern Himalayan taxon without a name, Wall (1909) proposed , “the first reference
of it having been made by Stoliczka”.
Annandale (1909) discussed Wall’s (1909) paper on the forms of Dipsadomorphus, and criticizes the, in his
opinion, difficult delimitation of the species introduced by Wall, particular with regard to Boiga ceylonensis, but
also to other species of this genus, and considered Wall’s new species merely as forms of one species, i.e., of B.
ceylonensis.
Cope (1860) resurrected the name Boiga Fitzinger, 1826 and designated Coluber irregularis as type species.
In 1902 the Norwegian-American zoologist Leonard Hess Stejneger (1851–1943) described a new species of rear-
fanged snake from Taiwan (then Formosa), and in so doing also resurrected the genus Boiga Fitzinger, 1826 from
obscurity as a senior synonym for Dipsadomorphus, the generic name it would replace for the remainder of the
20th Century. The two taxa under discussion here would therefore become Boiga ochracea (Theobald, 1868), with
19 dorsal scale rows, from NE India south and east of the Brahmaputra valley across Bangladesh to Myanmar, and
(Wall, 1909), with 21 dorsal scale rows, from the Eastern Himalayas, but including Beddome’s two
“Burmese” specimens.
From all that we now know and have examined, B. ochracea does not occur on the Andaman or Nicobar Islands,
that material being referred to Boiga andamanensis (Wall, 1909). This assumption is also confirmed by the recent
studies of Chandramouli (2022: 321), who removes B. ochracea from the list of snake species occurring on the
Andaman Islands. It has to be noted that B. andamanensis usually has 21 midbody DSR, rarely 19, but in preservation
the coloration looks like “ochracea”, particular in the red color morph, a possible reason for the confusion.
KÖHLER
158 · Zootaxa 5270 (2) © 2023 Magnolia Press
The next author to take a look at this group of snakes was the British physician and herpetologist Malcolm
Arthur Smith (1875–1958). In 1941 he used for the first time the combination Boiga ochracea walli (as a nomen
nudum) and applied this name to populations from the Andaman and Nicobar islands, and Burma. A few years
later Smith (1943) synonymized with B. ochracea, stating: “The name hexagonatus must become a
synonym of cyanea, and the next one available is Günther’s ochracea. The type has 21 scale rows and is therefore
the Himalayan form, and the locality (Pegu) from which it is said to have come is in no doubt an error. Beddome,
from whom the specimen came, was never in Burma, and his localities have been shown to be incorrect on many
occasions.” Smith (1943) defined his eastern Himalayan B. ochracea ochracea as exhibiting 21-21-17 dorsal
rows, 223–252 ventrals, and 100–119 subcaudals, and described the populations of B. ochracea from “Burma,
south of lat. 25°; Tenasserim; the Andaman and Nicobar Islands.”, with 19-19-15 dorsal rows, 221–246 ventrals,
and 89–107 subcaudals, as a new subspecies, formally named B. ochracea walli. On the BMNH ledger and on the
jar labels, the BMNH specimens collected by Leonardo Fea at Bhamo, Myanmar, (i.e., BMNH 89.3.25.37–39)
are declared as syntypes. However, this does not constitute a type selection according to the Code and is therefore
not a valid syntype designation because it is not following the principles of typification. Smith (1943) did not
cite any type material from his B. ochracea walli in its original description. Therefore, all specimens available
to Smith at the time of the description of B. ochracea walli constitute the syntypes, not just the three specimens
subsequently labeled as “syntypes” in the BMNH collection. The list of potential syntypes of Smith’s B. ochracea
walli obviously includes specimens present at BMNH at the time but it is known that Smith travelled in South
and Southeast Asia and visited all the main collections there in the preparation of his “Fauna of British India”
series, the third, Serpentes, volume of which was ready to go to print in 1938 (delayed until 1943 due to WWII).
He examined material from the collections in Bombay, Calcutta, Paris (Smith 1943:v–vi) , Vienna (Smith 1928)
and Berlin (pers. data FT, he was in contact with Mell and arranged specimen loans with ZMB), and also loans
from different US museums and from Leiden and Colombo (Smith 1943). So it cannot be ruled out that specimens
from these collections are also putative syntypes of Smith´s B. o. walli. Wallach et al. (2014) treated walli as full
species and mentioned that this taxon is based on a single name-bearing type specimen, but they provided no
inventory number for that specimen. According to Art. 72.4.1 of the Code (“The type series of a nominal species-
group taxon consists of all the specimens included by the author in the new nominal taxon (whether directly or
by bibliographic reference) …”, we suggest that in the case of B. ochracea walli at least the following specimens
belong to the original syntype series: BMNH 1946.1.2.60–61 from Pegu (at the same time syntypes of Dipsas
ochraceus Günther), BMNH 89.3.25.37–39 from Bhamo, and specimens from the Andamans and Nicobars, at
least from the BMNH collection which were available to Smith.
Smith appears to have made a number of errors that had a considerably impact on the nomenclature and
proposed distributions of these taxa. 1) It was Theobald, not Günther, who first described ochracea in 1868. 2) The
ochracea type specimens (plural not singular) were recorded by Günther, as having come from Pegu (=Bago), but
Theobald’s syntypes were collected from Rangoon (=Yangon) and Maulmain (=Mawlamyine). Regardless of any
confusion over precise localities, the two syntypes described by Theobald and the two other described by Günther
were collected in southern Myanmar, not the eastern Himalayas or northern Myanmar. 3) Günther recorded the
dorsal scale rows of these two specimens as 19, while Theobald reports 19-17-15 rows, but neither author reported
a count of 21 for these specimens. 4) Beddome was responsible for collecting the two specimens reported as from
“Burma”, not the two specimens from Pegu, and it is this locality that is now doubted by most authors, and it was
these two specimens that exhibited 21 dorsal scale rows at midbody.
Not all authors accepted Smith’s synonymy of with B. ochracea, i.e., Kramer (1977) who reported
that Andrew Stimson (BMNH) had checked the syntypes of Günther´s D ochraceus (BMNH 1946.1.2.60–61) and
confirmed their dorsal scale counts as 19, and that they were collected in southern Myanmar and therefore he did
not synonymise with ochracea, but rather recognized it as the eastern Himalayan-northern Burmese
subspecies . It has to be noted here that all material examined by Kramer and determined by
himself as was misidentified. Our re-examination (by FT) revealed that FMNH 131957 is Boiga
multifasciata and FMNH 152584 is Boiga trigonata. Gruber in Schleich & Kästle (2002) recognized all three
subspecies: B. o. ochracea from Darjeeling, Sikkim, Assam, Bhutan and Bangladesh; from Nepal,
and B. o. walli as characterized by Smith (1943) from southern Myanmar and the Andaman and Nicobar Islands, but
they did not provide any characteristics to distinguish between the three taxa.
Therefore, there appears to be a great deal of confusion over the nomenclature and distribution of the various
REVISION OF Zootaxa 5270 (2) © 2023 Magnolia Press · 159
populations of B. ochracea, largely caused by Smith’s misinterpretation of the data and some recent authors (e.g.,
Das 2010; Wallach et al. 2014) largely followed Smith’s (1943) erroneous concept of this group.
As a consequence of what is stated above, we consider Boiga walli to be a synonym of B. ochracea, and we
elevate again to species level, distinct from B. ochracea. To summarize the current situation, Boiga
ochracea should be the taxon with 19-19-15 or 13 dorsal scale rows, cream to beige color without any pattern, from
NE India south and east of the Brahmaputra valley across Bangladesh to Myanmar. Boiga multomaculata should
be the taxon with 19-19-15 or 13 dorsal scale rows and a bold pattern of ocellated dark blotches, definitely known
from Myanmar and southern China across Thailand, Laos, Vietnam, and the Sunda Archipelago. Boiga
should be the taxon with 19 or 21-21-15 or 17 dorsal rows that has been reported from Nepal, northeast India north
and west of the Brahmaputra valley, and Bhutan.
In this work, we evaluate the genetic variation in the populations related to Boiga multomaculata, B. ochracea,
and , respectively, based on the mtDNA markers 16S, ND4, and CYTB as well as the nuclear marker
c-mos. We also analyze the variation in external morphology of these three taxa. Finally, we designate lectotypes
for Boiga multomaculata, B. ochracea walli, and , and a neotype for Boiga ochracea respectively, and
provide redescriptions of the primary types from these taxa.
Materials and methods
Specimens examined for this study include all available type material of relevant taxa and were either personally
collected or received on loan from various museums (see Appendix 1 for specimens examined). Specimens labeled
with GK numbers were deposited in the collections of the Senckenberg Forschungsinstitut und Naturmuseum,
Frankfurt am Main, Germany (SMF) or at East Yangon University Thanlyin, Myanmar (EYU), those with PaPa
field numbers deposited at EYU, those with PT field numbers are in the collection of the Chulalongkorn University
Museum of Natural History, Bangkok (CUMZ), and those with NK field numbers are in the collection of the
Universitas Brawijaya, Indonesia. Other institutional abbreviations used mainly following Sabaj (2020): BMNH
(Natural History Museum, London, U.K.), BNHS (Bombay Natural History Society, Mumbai, India), CAS (California
Academy of Sciences, San Francisco, USA), CUZ (University of Chittagong, Chittagong, Bangladesh), FMNH
(Field Museum of Natural History, Chicago, USA), MCZ (Museum of Comparative Zoology, Harvard University,
Cambridge, USA), MNHN (Muséum national d’Histoire naturelle, Paris, France), NHMK (Natural History Museum,
Kathmandu, Nepal), NMBA (Naturhistorisches Museum Basel, Switzerland), NME (Naturkundemuseum, Erfurt,
Germany), RMNH (Naturalis Biodiversity Center, Leiden, The Netherlands), ZMB (Museum für Naturkunde,
Leibniz-Institut für Evolutions- und Biodiversitätsforschung, Berlin, Germany), ZMH (Centrum für Naturkunde
(CeNak), Zoologisches Museum, Universität Hamburg, Germany), and ZSIK (National Zoological Collections
(NZC) of the Zoological Survey of India (ZSI), Kolkata, India); WIIADR is the acronym for the Wildlife Institute
of India, Abhijit Das Reptile Collection.
In evaluating species boundaries within populations, we follow the unified species concept (de Queiroz 2007).
For the usage of the subspecies category we apply the Frost & Hillis (1990) concept as modified and discussed by
Hillis (2020) and Köhler (2021). As lines of evidence for species and subspecies delimitation, we apply a phenotypic
criterion (external morphology) and a criterion for genetic divergence (genetic distinctness of the gene fragments
16S rRNA (16S), NADH dehydrogenase subunit 4 (ND4), and Cytochrome b (CYTB).
Prior to preservation of collected specimens in the field, we took color photographs of each individual in life.
We euthanized the snakes with a pericardial injection of T61. We cut tissue samples from the tongue and preserved
these in 98% non-denatured ethanol for DNA extraction. The tissue samples were deposited in the collection of
SMF. Whenever possible, we everted the hemipenes of male specimens by injecting 70% ethanol into the hemipenial
pockets after manually pre-everting the hemipenes. Specimens were then preserved by injecting a solution of 5 mL
absolute (i.e., 36%) formalin in 1 L of 96% ethanol into the body cavity, and stored in 70% ethanol. Coordinates and
elevation were recorded using a Garmin GPSMAP 64s. All coordinates are in decimal degrees, WGS 1984 datum.
The capitalized colors and color codes (the latter in parentheses) are those of Köhler (2012) in the color descriptions.
Abbreviations used are ASR (number of dorsal scale rows one head length behind head); IFL (infralabial scales);
MBS (number of dorsal scale rows at midbody); PSR (number of dorsal scale rows one head length before cloaca);
SPL (supralabial scales); SVL (snout–vent length); TL (tail length). The number of ventral scales was counted
according to Dowling (1951a). Dorsal scale row reduction formulae were based on Dowling (1951b). The terminal
KÖHLER
160 · Zootaxa 5270 (2) © 2023 Magnolia Press
scale was not included in the subcaudal count. Values for symmetric characters are provided in left/right order.
Dentition data were analyzed from 49 individuals of the larger B. multomaculata/ochracea clade and B.
and taken either directly from the specimen or were obtained through X-ray computed tomography and visualised.
DNA extraction, PCR, and sequencing were done at SMF for the samples from Myanmar, at Chulalongkorn
University for the samples from Thailand, at the Universitas Brawijaya for the sample from Indonesia, and at the
Forensic Science Lab of Wildlife Institute of India, Dehradun, India, for the samples from India. See Appendix 2 for the
sequences used in this study. We extracted DNA following the protocol of Ivanova et al. (2006). To eliminate potential
PCR-inhibiting contaminants, the tissue samples were incubated overnight at 4°C in 100 µL 1x PBS buffer before
overnight digestion with the vertebrate lysis buffer at 56°C. After extraction, the DNA was eluted in 50 µL TE buffer. We
amplified the mitochondrial gene fragments 16S rRNA (16S), NADH dehydrogenase subunit 4 (ND4), Cytochrome
b (CYTB), as well as the nuclear marker Oocyte maturation factor Mos (c-mos) in an Eppendorf Mastercycler® pro
using the following protocol: initial denaturation for 1 min at 94°C; followed by 5 cycles with denaturation for 15 s
at 94°C, hybridization for 45 s at 45°C and elongation for 1:30 min at 72°C; followed by 30 cycles 15 s at 94°C, 45 s
at 48°C and 1 min at 72°C; final elongation for 7 min at 72°C. The reaction mix for each sample contained 1 µL DNA
template, 14 µL water, 4 µL 2.5 mM dNTPs (Invitrogen), 2.5 µL PCR-buffer, 1 µL 25 mM MgCl2, 0.5 µL (containing
5 units) Taq Polymerase (PeqLab), and 1 µL of each primer. We used the following primers: 16S: forward: L2510, 5’–
CGCCTGTTTATCAAAAACAT–3’; reverse: H3056, 5’–CCGGTCTGAACTCAGATCACGT–3’; ND4: forward:
12931L, 5’–CTACCAAAAGCTCATGTAGAAGC–3’; reverse: Leu, 5’–CATTACTTTTACTTGGATTTGCACCA–
3’; CYTB: forward: H14910 5’– GACCTGTGATMTGAAAAACCAYC–3’; reverse: THRSV2 5’–
CTTTGGTTTACAAGAACAATGCT–3’; c-mos: forward: 5’–TTTGGTTCKGTCTACAAGGCTAC–
3’; reverse: 5’–AGGGAACATCCAAAGTCTCCAAT–3’; all from Eurofins MWG Operon.
We analyzed the mtDNA dataset separate from the c-mos one. In all analyses, we used Telescopus tripolitanus
(BEV 9377) as outgroup (Ganesh et al. 2021). For the newly generated sequences in this study and those downloaded
from Genbank see Appendix 2. We aligned the sequences with MUSCLE (Edgar 2004) using the default settings
in Geneious 6.1.2. (Kearse et al. 2012). For software applications, sequence data formatting was converted using
the online server Alter (Glez-Peña et al. 2010). The best substitution model for each gene was identified using
PartitionFinder2 (Lanfear et al. 2017), with linked branch lengths via PhyML 3.0 (Guindon et al. 2010). Model
selection used the corrected (for finite sample size) Akaike Information Criterion (AICc) (Burnham & Anderson
2002). We estimated evolutionary genetic divergence, computing uncorrected pairwise distances with MEGA 7.0.26
(Kumar et al. 2016) to assess the degree of intra- and interspecific differences, using a Bootstrap estimation method
of 10,000 replications.
We used the IQTree webserver (Trifinopoulos et al. 2016) to run a Maximum Likelihood (ML) analysis using
10,000 ultrafast Bootstrap approximation (UFBoot) replicates with 10,000 maximum iterations and minimum
correlation coefficient of 0.99 (Minh et al. 2013).
Bayesian Inference analyses (BI) used MrBayes 3.2 (Huelsenbeck & Ronquist 2001; Ronquist & Huelsenbeck
2003; Ronquist et al. 2012) with five runs and eight chains. The first 25% of trees were discarded as burn-in.
MCMC runs used an initial set of 1,000,000 generations with sampling every 500 generations, and adding 500,000
generations until chains reached convergence. Convergence was considered achieved when the standard deviation
of split frequencies was 0.015 or less. Additionally, convergence was diagnosed by PRSF (Potential Scale Reduction
Factor), which should approach 1.0 as runs converge (Gelman & Rubin 1992). We used FigTree 1.3.1 for tree
viewing (http://tree.bio.ed.ac.uk/software/figtree/). We designed a species tree based on the three mtDNA gene
sequences concatenated, using *BEAST (Drummond et al. 2012) in BEAST 2.4.7 (Ogilvie et al. 2017) under
1,000,000 generations for the mcmc model, visualized in DensiTree 2.2.6 (Bouckaert & Heled 2014). We generated
the xml file needed for BEAST in the BEAUti application of BEAST 2.4.7. with the following set of parameters:
template StarBeast, site model GTR, and clock model strict clock with a clock rate of 1.0. We performed a species
delimitation analysis by visualizing barcode gaps in the pairwise distribution of each mtDNA gene separately
(excluding the outgroup), using the automatic barcode gap discovery (ABGD) approach (Puillandre et al. 2012)
through its webserver (http://wwwabi.snv.jussieu.fr/public/ abgd/abgdweb.html), setting the use of Simple Distance,
default values for Prior Intraspecific divergence, except for relative gap width (1.5) which does not work for some
Genes, as also noted by Kekkonen et al. (2015). Because high values in relative gap width tend to overly split
species (Yang et al. 2016), we used an intermediate value of 1.0.
REVISION OF Zootaxa 5270 (2) © 2023 Magnolia Press · 161
FIGURE 2. Scatter plots illustrating morphological variation in specimens identified as B. multomaculata, B. ochracea and B.
. Abbreviations: multomac = multomaculata; m = males; f = females. For abbreviations of morphological characters
see text.
KÖHLER
162 · Zootaxa 5270 (2) © 2023 Magnolia Press
TABLE 2. Mean genetic distances (in %) of the taxa of Boiga based on the 16S dataset. Abbreviations: ceylon. = ceylonensis; multo = multomaculata; quincun. = quincunciata;
siam. = siamensis. Outgroup: Telescopus tripolitanus.
ceylon. nuchalis whitakeri barnesii beddomei multo2cyanea
ceylon.
nuchalis 1.4
whitakeri 0.8 1.0
barnesii 5.0 4.2 3.9
beddomei 5.2 3.4 3.7 5.4
multo3 4.4 2.8 2.4 4.0 5.4
cyanea 7.2 4.3 4.0 6.6 8.7 6.3
6.4 4.1 4.2 7.0 6.8 6.2 5.9
multo2 4.3 2.7 2.3 3.8 5.4 0.6 6.2 6.1
multo1 5.2 3.7 3.8 4.1 5.8 1.8 6.8 6.3
Telescopus 9.1 7.1 6.6 8.6 9.7 8.8 8.1 7.2
nigriceps 6.6 4.7 4.5 7.7 8.9 6.8 5.2 4.5
4.4 1.9 1.5 5.0 4.8 3.6 7.1 6.6
quincun. 4.3 2.5 1.8 4.5 5.9 1.5 6.8 6.5
siam. 7.0 5.1 4.5 6.5 7.9 6.8 5.5 5.0
trigonata 5.6 3.3 3.2 4.7 6.3 1.1 6.6 6.2
......continued on the next page
REVISION OF Zootaxa 5270 (2) © 2023 Magnolia Press · 163
TABLE 2. (Continued)
multo1multo3Telescopus nigriceps quincun. siam.
ceylon.
nuchalis
whitakeri
barnesii
beddomei
multo3
cyanea
multo2
multo1 1.7
Telescopus 8.6 9.6
nigriceps 6.7 7.3 8.7
3.4 4.9 9.1 7.6
quincun. 2.0 2.9 8.2 7.0 3.6
siam. 6.7 7.1 7.6 6.1 7.3 6.4
trigonata 1.5 2.0 8.9 7.4 4.5 2.5 6.6
KÖHLER
164 · Zootaxa 5270 (2) © 2023 Magnolia Press
TABLE 3. Mean genetic distances (in %) of the taxa of Boiga based on the CYTB dataset. Abbreviations: ceylon. = ceylonensis; multo = multomaculata; quincun. = quincunciata;
siam. = siamensis. Outgroup: Telescopus tripolitanus.
ceylon. barnesii beddomei cyanea multo2multo1multo3nuchalis quincun. siam. Telescopus trigonata
ceylon. 16.7
barnesii 17.2 13.3
beddomei 17.1 8.5 12.9
cyanea 15.0 17.5 16.5 16.6
5.2 17.0 16.2 15.6 14.9
multo3 15.9 11.5 13.4 10.3 16.1 16.1
multo2 16.4 12.0 13.6 10.9 16.1 16.0 3.7
multo1 15.9 12.1 13.6 10.7 15.8 16.7 6.3 6.5
nuchalis 17.1 5.6 12.4 7.2 17.1 16.6 11.1 11.2 11.5
quincun. 15.4 11.5 13.1 11.0 17.3 16.0 10.4 10.9 11.3 10.8
siam. 15.7 16.5 18.5 15.8 15.0 16.5 15.6 16.3 15.6 16.3 17.7
Telescopus 20.9 20.5 20.7 19.5 20.4 19.7 18.6 19.0 19.8 18.8 18.7 23.0
trigonata 17.6 12.4 12.6 11.5 16.6 17.0 11.4 11.4 11.6 10.7 11.7 17.1 19.6
whitakeri 17.7 4.5 12.5 8.3 17.1 17.4 11.4 11.5 12.0 4.7 11.7 16.9 19.1 11.8
REVISION OF Zootaxa 5270 (2) © 2023 Magnolia Press · 165
FIGURE 3. Phylogenetic tree of Boiga species from a maximum-likelihood analysis of three mitochondrial genes (16S, ND4,
and CYTB). A scale bar is indicated. The numbers at nodes are bootstrap values (left) and Bayesian posterior probabilities
(right), but only bootstrap values higher than 70 are noted. The tree is rooted with the species Telescopus tripolitanus.
KÖHLER
166 · Zootaxa 5270 (2) © 2023 Magnolia Press
FIGURE 4. Species tree inferred with *BEAST showing density of trees proportional to frequency of occurrence drawn in
DensiTree.
Results
The two color morphs (i.e., blotched versus immaculate color patterns) show completely overlapping ranges in all
studied morphological characters (Fig. 2). The final concatenated alignment of 16S, ND4, and was of 2,220
nucleotide positions for 43 Boiga samples plus Telescopus tripolitanus as an outgroup whereas the c-mos alignment
was of 544 nucleotide positions for 22 Boiga samples plus the same voucher specimen as outgroup (Appendix 2).
Partition schemes were as follows: ND4 (1st codon position GTR+I+G; 2nd and 3rd TVM+I+G; CYTB (1st codon
position GTR+I+G; 2nd TVM+I+G; and 3rd GTR+G); 16S GTR+I+G. c-mos (1st codon position TRN; 2nd HKY;
and 3rd JCG). All trees, both for single markers and for the final concatenated alignment of the mtDNA markers,
generated through ML, Bayes, BEAST, and ABGD analyses show a high degree of congruence (Figs. 3, 4 and 5).
In all trees, both based on mtDNA and on nuclear DNA markers, the snakes identified as Boiga multomaculata
and B. ochracea form mixed clades. Some of the specimens with a blotched body pattern are virtually identical
with unblotched specimens in the analyzed mtDNA sequences. Furthermore representatives of both color morphs
had been collected at the same locality (e.g., SMF 103792 and SMF 103827), providing convincing evidence that
the blotched versus immaculate color patterns are of no taxonomic or diagnostic value. Rather, these have to be
interpreted as intraspecific variation. Therefore, we formally place Dipsas ochracea Theobald, 1868 in the synonymy
of Dipsas multomaculatus Boie, 1827. We here designate BMNH 1946.1.2.60 as the neotype of Dipsas ochracea
Theobald. Furthermore, we here designate the same specimen, BMNH 1946.1.2.60, as the lectotype of D. ochraceus
Günther, thereby making these names objective synonyms. However, we did find evidence for genetic divergence
REVISION OF Zootaxa 5270 (2) © 2023 Magnolia Press · 167
among the populations formerly referred to as Boiga multomaculata or B. ochracea, with three subclades within the
larger multomaculata/ochracea clade (Figs. 3 and 4), whereas these clades were not recovered in an analysis based
on the nuclear marker c-mos (Fig. 5). However, these three clades do not correlate with the color pattern phenotype
but are highly correlated geographically (i.e., are distributed allopatrically; see Fig. 6). In the ABGD analysis,
these three subclades are recovered as distinct groups (prior maximal distance P= 0.007743; barcode gap distance
= 0.030). However, the mean genetic distances among them is rather low: 16S 0.3–1.0%; ND4 3.3–5.8%; CYTB
3.7–6.5% compared to 2.1–4.3% (16S), 8.5-14.9% (ND4), and 11.3–18.6% (CYTB) among most other species of
Boiga included in our analyses (Tables 2 and 3). Similar low mean genetic distances are found among B. whitakeri,
B. ceylonensis and B. nuchalis (16S 0.8–1.4%; ND4 3.3–3.7%; CYTB 4.5–5.6%).
FIGURE 5. Phylogenetic tree of Boiga species from a maximum-likelihood analysis of the nuclear DNA marker c-mos. A scale
bar is indicated. The numbers at nodes are bootstrap values (left) and Bayesian posterior probabilities (right), but only bootstrap
values higher than 70 are noted. The tree is rooted with the species Telescopus tripolitanus.
In external morphology the ranges of the examined characters mostly broadly overlap among the three
subclades within the larger multomaculata/ochracea clade. The most pronounced differences are evident in the
number of ventral scales (Fig. 7): Clade 1 males 225–242 (231.3±5.42), females 231–258 (240.8±6.63); Clade
2 males 220–234 (228.3±5.06), females 228–239 (231.5±3.74); Clade 3 males 194–236 (214.8±11.39), females
198–242 (216.5±12.13). In the 16S fragment has a genetic distance of 3.4–4.9% from the three
multomaculata/ochracea clades. Furthermore, the former differs from the snakes in the multomaculata/ochracea
clades in several characters of external morphology, most pronounced in the number of dorsal scale rows at midbody
(consistently 21 in versus 19 in the specimens of the multomaculata/ochracea clades). Furthermore, B.
tends to have more subcaudal scales in both sexes than multomaculata/ochracea (see also Fig. 7).
KÖHLER
168 · Zootaxa 5270 (2) © 2023 Magnolia Press
Thus, according to the Frost & Hillis (1990) concept as put into practice by Köhler (2021), we recognize those
taxa with low genetic divergence (i.e., pairwise genetic distances <7% in the mtDNA markers ND4 and CYTB) as
subspecies (versus mostly well above 10% among most other species of Boiga included in our analyses). Thus, we
consider the three subclades within the larger multomaculata/ochracea clade to represent subspecies level units.
Based on the differences in mtDNA data and external morphology, we recognize as a valid
species and formally resurrect it from synonymy with B. ochracea.
In order to evaluate the names to be applied to our subclades within the larger multomaculata/ochracea clade
we need to consider the respective type localities of the available names. Our Clade 1 contains a specimen from
the type locality of B. multomaculata (Boie 1827), and thus this name applies to Clade 1. Our Clade 2 contains a
specimen from the type locality of B. ochracea (Theobald 1868b), and we therefore assign Clade 2 to this name.
The type locality of B. ochracea walli Smith, 1943 (i.e., “Burma, south of lat. 25°; Tenasserim; the Andaman and
Nicobar Islands.”) is—except for the islands—mostly within the geographic range represented by the samples of
our Clade 2. The northernmost syntypes of B. ochracea walli (i.e., BMNH 89.3.25.37–39) originated at Bhamo,
Myanmar, which is still south of the genetically verified southernmost sample of our Clade 3. In agreement with Art.
74.7 of the Code, we here designate BMNH 1946.1.2.60 as the lectotype of Boiga ochracea walli Smith to introduce
a standard of application for the species group name Wall by a single name-bearer, thereby making it an
objective synonym of Dipsas ochracea Theobald and D. ochraceus Günther (see above).
FIGURE 6. Map showing distributional records of Boiga specimens of the three clades recovered in our phylogenetic analyses.
Circles = Clade 1 specimens; squares = Clade 2 specimens; triangles = Clade 3 specimens; stars = ; white symbols
= records, not genetically confirmed, obtained from GBIF and literature; black symbols = specimens examined for external
morphology, not genetically confirmed; red circles = genetically confirmed records of our Clade 1 specimens; green squares
= genetically confirmed records of our Clade 2 specimens; blue triangles = genetically confirmed records of our Clade 3
specimens; red stars = , specimens examined for external morphology, not genetically confirmed; blue stars =
, records, not genetically confirmed, not examined, obtained from GBIF and literature; green star = genetically
confirmed record of ; diamonds = specimens of B. multomaculata that are not assigned to subspecies because no
genetic samples had been analyzed. Each symbol can represent one or more adjacent localities.
REVISION OF Zootaxa 5270 (2) © 2023 Magnolia Press · 169
FIGURE 7. Scatter plots illustrating morphological variation among specimens of the three clades recovered in our phylogenetic
analyses. Abbreviations: m = males; f = females. For abbreviations of morphological characters see text.
KÖHLER
170 · Zootaxa 5270 (2) © 2023 Magnolia Press
Two of Mell’s (1931) B. multomaculata subspecies are within the geographic range represented by the samples
of our Clade 1 (i.e., B. multomaculata hainanensis, type locality “Hainan” and B. m. sikiangensis, type locality
“Kwangtung (Hongkong)”) and thus remain in the synonymy of B. multomaculata. The type locality of Mell’s
(1931) B. m. indica (“continental India”) coincides with the area represented by the samples of our Clade 2 and 3
and thus remain in the synonymy of B. ochracea. Mell´s indica has no type material therefore, the assignment to
either Clade is not justified by any data and would be completely arbitrarily no matter which clade we would chose.
In our opinion, Boiga multimaculata indica Mell, 1931 is a nomen dubium that cannot be applied to any of the taxa
as defined by us. Consequently, there is no name available for our Clade 3 and we describe it as a new subspecies
of Boiga multomaculata below. As stated above, we consider the three subclades within the larger multomaculata/
ochracea clade to represent subspecies level units and provide the following synonymies:
Boiga multomaculata (Boie, 1827)
Polymorphic Asian Cat Snake
1827 Dipsas multomaculata Boie: 549.
Content: Three subspecies: Boiga multomaculata multomaculata, Boiga multomaculata ochracea, and a new
subspecies (our Clade 3) described below.
Boiga multomaculata multomaculata (Boie, 1827)
Ocellated Asian Cat snake
1931 B. multomaculata hainanensis Mell: 213.
1931 B. multomaculata sikiangensis Mell: 213.
Geographic distribution. As currently known, B. m. multomaculata is distributed across Thailand south of 17° N
latitude, central and southern Laos, Cambodia, Vietnam, southern China (including Hainan) and on the Indonesian
islands of Java, Bali, and probably Sumatra (Zhao & Adler 1993; David & Vogel 1996; Nguyen et al. 2009; Das
2010; Chan-ard et al. 2015).
There are a number of incorrect listings of this taxon. An erroneous Singapore record goes back to Cantor and
led to B. multomaculata being listed for West Malaysia, too. The absence of B. multomaculata on Malayan Peninsula
was already clarified by Smith (1930:63–64). For Sulawesi, Borneo, Singapore (West Malaysia) no reliable records
are available or no vouchers are preserved in any collection. However, various authors still listed some of these
implausible localities in very recent literature and in databases. David & Vogel (1996) report the presence of B.
multomaculata on Sumatra but there are no references that provide a reliable record for the taxon from this island.
Most probably the inclusion of Sumatra is based on a misinterpretation of a paper from Franz Werner (1900) about a
collection from Sumatra purchased by Schneider. This paper includes a table with species that occur on Sumatra set
against adjacent regions/islands. In this table B. multomaculata is listed, but not for Sumatra! It is possible someone
reading the title of Werner’s paper and seeing B. multomaculata listed, came to the incorrect conclusion that it was
present.
Type material. The description of Dipsas multomaculata is based on an unknown number of specimens. Our
research has revealed that specimens from the collections in Leiden and Berlin can be attributed to the original
syntype series (see Introduction). In agreement with Art. 74.7 of the Code, we here designate RMNH.RENA 979b
(Figs. 8 and 9) as lectotype of Dipsas multomaculata Boie, 1827 to introduce a standard of application for the
species group name multomaculata Boie with a single name-bearer.
Lectotype. RMNH.RENA 979b, an adult female from Java, collector and date of collection not stated in RMNH
inventory catalogue.
Paralectotypes. RMNH.RENA 979d an adult female, RMNH.RENA 979e a subadult female, RMNH 979f a
juvenile female, and ZMB 50879 an adult female, same collecting data as for the lectotype.
Description of the lectotype. Adult female, indicated by the absence of hemipenes; 1/1 loreal, wider than high;
nasal scale completely divided; 1/1 preocular; 1/1 supraocular; 2/2 postoculars, upper not reaching onto top of head;
REVISION OF Zootaxa 5270 (2) © 2023 Magnolia Press · 171
2 prefrontals; 2/1 anterior and 2/2 posterior temporals; supralabials 8/8, 3rd–5th supralabials entering eye; 11/11
infralabials, first four in contact with anterior chin shields; dorsal scales in 19-19-15 rows, smooth with single tiny
apical pits on body and single or paired apical pits on dorsocaudal scales; vertebral scale row significantly enlarged;
no preventral; 214 ventrals; cloacal plate entire; 89 paired subcaudal scales. Body slender; tail long (TL/SVL 0.243);
SVL 592 mm; TL 144 mm, head length measured from tip of snout to posterior border of parietals 14.2 mm, head
length measured from tip of snout to posterior edge of mandible 18.8 mm, head width 11.1 mm; diameter eye 3.3
mm; distance anterior border eye to tip of snout 5.2 mm.
FIGURE 8. Lectotype of Dipsas multomaculata Boie (RMNH.RENA 979b). A. dorsal view; B. ventral view. See text for
details. Scale bar = 10 cm. Photo by FT.
Dentition. Maxillary bone with 11/11 prediastemal teeth, followed by a distinct diastema which is 65% longer
than the socket of the last prediastemal tooth and followed by two distinctly enlarged, grooved and posteriorly bent
postdiastemal teeth. Prediastemal teeth slightly decrease in size posteriorly, the anterior two distinctly posteriorly
hooked, the following with less pronounced curvature. On the left side, prediastemal teeth number five, seven, nine,
11, and second postdiastemal loose. On the right side, prediastemal teeth two, four, five, and second postdiastemal
tooth loose. Medial to each maxillary tooth is a single replacement tooth at different growth stages.
Palatine bone with 6/6 posteriorly curved teeth, shorter that the prediastemal teeth and slightly decreasing in
size posteriorly. Tooth one broken, teeth two, four and six loose on left side. Tooth three broken, teeth two, four and
KÖHLER
172 · Zootaxa 5270 (2) © 2023 Magnolia Press
six loose on the right side. Lateral to each palatine tooth is a single replacement tooth at different growth stages.
Pterygoid bone with 12/12 posteriorly curved teeth, shorter than the palatine tooth, gradually decreasing in size
posteriorly. Teeth one, three, four, five and 12 loose on left side. Teeth three, four, five and nine loose on right side.
The posterior 60% of the pterygoid bone are without teeth.
Mandibular bone with 17/17 posteriorly curved teeth, shorter than maxillary teeth, gradually decreasing in size
posteriorly. Medial to each mandibular tooth is a single replacement tooth in different growth stages. Teeth two, four
and six loose on left side. Teeth two, four, six, eight and 10 loose on right side.
FIGURE 9. Lectotype of Dipsas multomaculata Boie (RMNH.RENA 979b). A. dorsal view of head; B. right lateral view of
head; C. left lateral view of head; D. ventral view of head. Scale bar = 1 cm. Photos by FT, line drawings by MOS.
Coloration after approximately 200 years preservation in ca. 70% ethanol was recorded as follows: Dorsal
ground color Tawny Olive (Color 17) with Natal Brown (49) mottling on scales and with 62 dorsolateral pairs of
Sepia (279) colored blotches on body that have a paler (Amber 51 suffused with Smoke Gray 266) center and a
white to Pale Buff (1) border; dorsolateral body blotches separated by a Pale Buff (1) vertebral interspace; below
the dorsolateral row of blotches an alternating row of smaller, irregularly shaped blotches with the same coloration;
dorsal head with same ground color as dorsal body and a V-shaped Sepia (279) marking open towards the neck,
starting from the inner posterior edges of the internasals and ending at the level of the last third of the last supralabial;
an oval marking on the neck partly inside the bifurcation of the V-shaped element and with the same coloration as
REVISION OF Zootaxa 5270 (2) © 2023 Magnolia Press · 173
described for the body blotches; a Sepia (279) colored postocular stripe ending at the angle of the mouth; edges
of posterior upper labials and edges of infralabials Sepia (279). Venter Cream Color (12) with Tawny Olive (17)
colored alternating irregular shaped spots; ventral head Cream Color (12) without prominent markings.
Dorsal scale reduction formula.
5+6(6) 4+5(8) 8+9(142) 2+3(154)
(5)23 ---------- 21 --------- 19 ------------ 17 ------------ 15(214).
4+5(7) 4+5(11) 8+9(145) 2+3(151)
Variation. Paralectotypes and additional examined material agree well with the lectotype in general appearance,
morphometrics and scalation (Table 1).
Variation in dentition. Nine to 13 prediastemal teeth followed by a distinct diastema and two enlarged grooved
postdiastemal teeth; six to seven palatine, eight to 12 pterygoid, and 17 to 19 dental teeth.
Variation in live coloration and pattern. Only a blotched morph is known (Fig. 10). The dorsal ground color can
vary from Pale Neutral Gray (color 296) to True Cinnamon (260), blotches on body Dark Grayish Brown (284) to
Sepia (286), edged Smoky White (261) or Cream White (52). Iris may vary, in accordance with the dorsal ground
color, from Pale Neutral Gray (color 296) to Medium Neutral Grey (299) or from Orange-Rufous (56) to True
Cinnamon (260), with black Sepia (286) pupil. Ventral head and throat Smoky White (261), rest of venter can vary
from Pale Neutral Gray (296) to Cream White (52) with small Pale Neutral Grey (296) or Cinnamon (255) spots.
FIGURE 10. Boiga m. multomaculata from Java in life (NK 2078). Photo by Luhur Septiadi.
Natural History. Boiga m. multomaculata is arboreal and nocturnal and known to inhabit different forest types,
agricultural land and gardens from near sea level up to 1600 m above sea level (a.s.l.), where it is found in bushes,
bamboo groves and trees. It is reported to feed on birds and lizards. The reproduction is oviparous with clutch sizes
of four to eight eggs. The total length of hatchlings vary from 195 to 200 mm (Mell 1922; Pope 1935; Manthey &
Grossmann 1997; McKay 2006; Das 2010; Chan-ard et al. 2015). Kopstein (1938) reported amphigonia retardata
for populations from Java with additional ovipositions of uniquely fertilized females after two and eight months,
respectively.
KÖHLER
174 · Zootaxa 5270 (2) © 2023 Magnolia Press
Boiga multomaculata ochracea (Theobald, 1868), comb. nov.
Tawny Asian Cat Snake
1868 Dipsas ochracea Theobald: 53.
1868 Dipsas ochraceus Günther: 425.
1931 Boiga multomaculata indica Mell: 213 [partim].
1943 Boiga ochracea walli Smith: 349 [partim].
Geographic distribution: Most of Myanmar (except for the northern portion of the country), northeastern India
(Mizoram), Bangladesh, Thailand north of 18° N latitude, and northern Laos (own observation; Smith 1943;
Whitaker & Captain 2004; Ahmed et al. 2009; Das 2010; Hasan et al. 2014; Wallach et al. 2014; Chan-ard et al.
2015; Lalremsanga & Lalronunga 2017; Lalremsanga et al. 2018; Hmar et al. 2020).
Type material. The description of Dipsas ochracea is based on two specimens from “Rangoon” and “Maulmain”,
but the two syntypes are not located and must be regarded as lost (see Introduction). In agreement with Art. 72.2
and Art. 75 of the Code, we here designate BMNH 1946.1.2.60 (formerly BMNH 68.4.3.16) (Figs. 11 and 12) as
neotype of Dipsas ochracea Theobald, 1868 to ensure stability and universality by specifying a single name-bearer
for this nominal taxon. With the selected specimen, which at the same time represents one of the syntypes of Dipsas
ochraceus Günther, 1868, we preserve the original connection and exchange between Günther and Theobald with
respect to the nearly simultaneous description and naming of an ochraceous colored Asian cat snake taxon from
southern Burma. By selection of the neotype and in accordance with Art. 76.3 of the Code, the type locality is
“Pegu”, replacing the ‘corrected’ type locality by Wallach et al. (2014:106), which includes two different divisions
in southern Myanmar.
FIGURE 11. Neotype of Dipsas ochracea Theobald (BMNH 1946.1.2.60); also, this specimen is the lectotype of Dipsas ochraceus
Günther and the lectotype of Boiga ochracea walli Smith. Dorsal view. See text for details. Scale bar = 10 cm. Photo by FT.
Neotype. BMNH 1946.1.2.60 (formerly BMNH 68.4.3.16), an adult female from “Pegu” [Bago, Bago Region,
Myanmar, approx. 17.32°N, 96.47°E], collected by William Theobald and donated to the BMNH collection in
spring 1868.
REVISION OF Zootaxa 5270 (2) © 2023 Magnolia Press · 175
FIGURE 12. Neotype of Dipsas ochracea Theobald (BMNH 1946.1.2.60). A. dorsal view of head; B. right lateral view of head;
C. left lateral view of head; D. ventral view of head. Scale bar = 1 cm. Photos by FT, line drawings by MOS.
Description of the neotype. Adult female, indicated by the absence of hemipenes; 1/1 loreal, wider than high;
nasal scale completely divided; 1/1 preocular; 1/1 supraocular; 2/2 postoculars, upper not reaching onto top of head;
2 prefrontals; 2/2 anterior and 4/3 posterior temporals; supralabials 8/8, 3rd–5th supralabials entering eye; 12/11
infralabials, first five in contact with anterior chin shields; dorsal scales in 19-19-15 rows, smooth with paired tiny
apical pits on body and paired or triple apical pits on dorsocaudal scales; vertebral scale row significantly enlarged;
one preventral and 237 ventrals; cloacal plate entire; 98 paired subcaudal scales. Body slender; tail long (TL/SVL
0.239); SVL 889 mm; TL 212 mm; head length measured from tip of snout to posterior border of parietals 18.3 mm,
head length measured from tip of snout to posterior edge of mandible 23.8 mm, head width 15.5 mm; diameter eye
4.2 mm; distance anterior border eye to tip of snout 7.3 mm.
Dentition. Maxillary bone with 11/10 prediastemal teeth, followed by a distinct diastema which is 68% longer
than the socket of the last prediastemal tooth and followed by two distinctly enlarged, grooved and posteriorly bent
KÖHLER
176 · Zootaxa 5270 (2) © 2023 Magnolia Press
postdiastemal teeth. Prediastemal teeth slightly decrease in size posteriorly, the anterior three distinctly posteriorly
hooked, the following with less pronounced curvature. On the left side, prediastemal teeth number one, three, five,
seven, nine, 11, and second postdiastemal loose. On the right side, prediastemal tooth six broken, teeth one, three,
five, and seven and second postdiastemal tooth loose. Medial to each maxillary tooth is a single replacement tooth
at different growth stages.
Palatine bone with 6/6 posteriorly curved teeth, shorter that the prediastemal teeth and slightly decreasing in
size posteriorly. Second tooth on left side broken. Teeth one, three and five loose on right side. Lateral to each
palatine tooth is a single replacement tooth at different growth stages. Pterygoid bone with 10/9 posteriorly curved
teeth, shorter than the palatine tooth, gradually decreasing in size posteriorly. Teeth one, three, five, seven and nine
loose on left side. Teeth one, three, five, seven and eight loose on right side. The posterior 58% of the pterygoid
bone are without teeth.
Mandibular bone with 18/17 posteriorly curved teeth, shorter than maxillary teeth, gradually decreasing in size
posteriorly. Medial to each mandibular tooth is a single replacement tooth in different growth stages. Tooth two
broken, teeth one, three, four, 15 and 17 loose on left side. Teeth one, three, nine, 12 and 14 loose on right side.
The neotype of B. m. ochracea coloration after approximately 150 years preservation in ca. 70% ethanol was
recorded as follows: Dorsal ground color of head body and tail with intact “Oberhäutchen” uniform Drab (Color
19), body parts without “Oberhäutchen” uniform Light Lavender (201); interstitial skin Fawn Color (258); venter of
head, body and tail same color as described for dorsal body.
Dorsal scale reduction formula.
– 8+9(157) 2+3(160) – – 6+V(218)
(10)19 ----------- 18 ----------- 17 ----------- 16 ----------- 15 ------------ 14 ------------ 13(237).
2+3(156) – – 2+3(163) 7+V(212) –
Variation. Individuals of this subspecies are either blotched or immaculate whereas specimens with an intermediate
color pattern have not been reported yet (Fig. 13). For variation in morphometrics and scalation see Table 1.
FIGURE 13. Boiga multomaculata ochracea in life. A. SMF 104138; B. SMF 103792; C. SMF 103826; D. WIIADR 1156.
Photos by GK (A–C), AD (D).
REVISION OF Zootaxa 5270 (2) © 2023 Magnolia Press · 177
Variation in dentition. Ten to 13 prediastemal teeth followed by a distinct diastema and two enlarged grooved
postdiastemal teeth; six palatine, eight to 13 pterygoid, and 15 to 18 dental teeth.
Variation in live coloration and pattern. Two color morphs, blotched and unicolored are known. The blotched
morph resembles the color and pattern of brownish individuals of the nominate subspecies. Dorsal ground color
of the unicolored morph Pale Cinnamon (Color 55) to Dark Salmon Color (59), interstitial skin Pale Neutral Grey
(296), posterior supralabials and infralabials Chamois (84) with Dark Salmon Color (59) edges. Venter of head,
body and tail Pale Buff (1). Iris Light Chrome Orange (76) or Dark Salmon Color (59), pupil Sepia (286).
Natural History. Boiga m. ochracea is mostly arboreal, crepuscular and nocturnal. It is known to inhabit
different forest types, parks and gardens and agricultural land like banana plantations in lowlands, mid hills and
submontane regions, from around 10 m up to 1884 m a.s.l. It is reported to feed on birds and their eggs, and lizards
(our observations; Whitaker & Captain 2004; Mahony et al. 2009; Das 2010; Hasan et al. 2014).
Boiga multomaculata septentrionalis ssp. nov.
Northern Polymorphic Asian Cat Snake
urn:lsid:zoobank.org: act:439A42EE-0B42-4063-B04A-E18B14FA6023
1931 Boiga multomaculata indica Mell: 213 [partim].
1943 Boiga ochracea walli Smith: 349 [partim].
Geographic Distribution. As currently known, B. m. septentrionalis is distributed in northern Myanmar (Kachin
state and Sagaing Region) and NE India (Assam and Nagaland), but is probably more widespread and based on the
documented pattern of geographic distribution we have referred an adult male specimen from southern China (CAS
242550 from Yunnan Province) tentatively to this subspecies, pending genetic confirmation.
Holotype. CAS 241272, an adult male from Indawgyi Lake Wildlife Sanctuary (25.30347, 96.35417; 235 m
a.s.l.), vicinity Kyang Kyar village, Moenyin Township, Myitkyina District, Kachin State, Myanmar, collected on
20 July 2008 by J.A. Wilkinson, J.V. Vindum, S.L. Oo, K.T. Kyaw, and M. Win. Original field tag MHS 25921.
Paratypes (3). CAS 241150, an adult female from Indawgyi Lake Wildlife Sanctuary (25.30347, 96.35417; 235
m a.s.l.), E of Nat Mouk Kan village, Moenyin Township, Myitkyina District, Kachin State, Myanmar, collected
on 14 July 2008 by G.O.U. Wogan, J.A. Wilkinson, J.V. Vindum, A.K. Shein. CAS 241550, an adult female from
Indawgyi Lake Wildlife Sanctuary (25.17869, 96.29156; 270 m a.s.l.), vicinity of Lwe Mon village, Moenyin
Township, Myitkyina District, Kachin State, Myanmar, collected on 26 July 2008 by J.A. Wilkinson, K.T. Kyaw,
and J.V. Vindum. SMF 106288 (formerly CAS 239222), an adult male from Linpha village (25,80489, 95,52667;
140 m a.s.l.), Hkanti Township, Hkanti District, Sagaing Region, Myanmar, collected on 10 September 2006 by
K.S. Lwin, S.L. Oo, and A.K. Shein.
Diagnosis. A subspecies of Boiga multomaculata that differs from the other two subspecies (i.e., B. m.
multomaculata and B. m. ochracea) by mean pairwise genetic distances of 3.3–5.8% (ND4) and 3.7–6.5% (CYTB),
respectively. It further differs from B. m. multomaculata by having on average more ventral scales in both sexes
(males 227.7±5.19, females 228.8±1.71 in B. m. septentrionalis versus males 214.4±8.06, females 217.1±9.50 in B.
m. multomaculata), by having on average more subcaudal scales in both sexes (males 99.1±5.82, females 97.3±2.06
in B. m. septentrionalis versus males 94.5±5.33, females 89.8±4.13 in B. m. multomaculata), and by having both
blotched and patternless individuals (versus only blotched specimens in Boiga m. multomaculata). It further differs
from B. m. ochracea by having on average fewer ventral scales in females (228.8±1.71 in B. m. septentrionalis
versus 238.9±6.30 in B. m. ochracea).
Description of the holotype (Figs. 14 and 15). Adult male, indicated by fully developed everted hemipenes; 1/1
loreal, wider than high; nasal scale partly divided below the naris; 1/1 preocular; 1/1 supraocular; 2/2 postoculars;
2 prefrontals; 2/2 anterior and 3/2 posterior temporals; supralabials 8/8, 3rd–5th supralabials entering eye; 11/11
infralabials, first five in contact with anterior chin shields; dorsal scales in 19-19-15 rows, smooth with single
or paired apical pits on body and single to triple apical pits on dorsocaudal scales; vertebral scale row distinctly
enlarged; two preventrals and 226 ventrals; cloacal plate entire; subcaudal scales 92, paired. Body slender; tail long
(TL/SVL 0.235); SVL 578 mm; TL 136 mm; head length measured from tip of snout to posterior edge of mandible
18.1 mm, head width 10.5 mm; diameter eye 3.4 mm; distance anterior border eye to tip of snout 4.9 mm.
KÖHLER
178 · Zootaxa 5270 (2) © 2023 Magnolia Press
FIGURE 14. Holotype of Boiga multomaculata septentrionalis ssp. nov. (CAS 241272). A. dorsal view; B. ventral view. See
text for details. Scale bar = 10 cm. Photos by FT.
Dentition. Maxillary bone with 11/11 prediastemal teeth, followed by a distinct diastema which is 40% longer
than the socket of the last prediastemal tooth and followed by two distinctly enlarged, grooved and posteriorly bent
postdiastemal teeth. Prediastemal teeth slightly decrease in size posteriorly, the anterior three distinctly posteriorly
hooked, the following with less pronounced curvature. On the left side, prediastemal teeth number two, four, six,
eight and ten, and first postdiastemal loose. On the right side, prediastemal teeth one, three, five, seven and nine,
and first postdiastemal tooth loose. Medial to each maxillary tooth is a single replacement tooth at different growth
stages.
Palatine bone with 6/6 posteriorly strongly curved teeth, shorter that the prediastemal teeth and slightly
decreasing in size posteriorly. Tooth three six loose on left side. Teeth two, four and six loose on the right side.
Lateral to each palatine tooth is a single replacement tooth at different growth stages.
Pterygoid bone with 11/12 posteriorly curved teeth, shorter than the palatine tooth, gradually decreasing in size
posteriorly. Teeth two, five, seven and 10 loose on left side. Teeth one, three, five, 10 and 12 loose on right side. The
posterior 63% of the pterygoid bone are without teeth.
Mandibular bone with 18/17 posteriorly curved teeth, shorter than maxillary teeth, gradually decreasing in size
posteriorly. Medial to each mandibular tooth is a single replacement tooth in different growth stages. Teeth one,
three, five, seven, nine, 11, 13 and 15 loose on left and right side. Tooth 17 missing on right side.
Coloration after about 13 years preservation in 70% ethanol was recorded as follows: Dorsal ground color
Smoke Gray (Color 266) with Natal Brown (49) mottling on scales and with 62 Sepia (286) blotches that have a
paler (Grayish Olive 274 suffused with Smoke Gray 266) center and a white to Pale Buff (1) border.
Dorsal scale reduction formula.
4+5(10) –9(150) 2+3(158)
(5)21 ------------ 19 ----------- 17 ------------- 115(226).
4+5(10) –9(152) 3+4(159)
Variation. Paratypes agree well with the holotype in general appearance, morphometrics and scalation (Table
1). Most paratypes are blotched as is the holotype. An exception is SMF 106288 (formerly CAS 239222) that has no
blotches but exhibits 58 indistinct transverse dark bars composed of dark edges of adjacent dorsal scales.
REVISION OF Zootaxa 5270 (2) © 2023 Magnolia Press · 179
FIGURE 15. Holotype of Boiga multomaculata septentrionalis ssp. nov. (CAS 241272). A. dorsal view of head; B. right lateral
view of head; C. left lateral view of head; D. ventral view of head. Scale bar = 1 cm. Photos by FT, line drawings by MOS.
Variation in dentition. Ten to 12 prediastemal teeth followed by a distinct diastema and two enlarged grooved
postdiastemal teeth; five to six palatine, seven to 12 pterygoid, and 16 to 19 dental teeth.
Variation in live coloration and pattern. Two color morphs, blotched and unicolored are known. The blotched
morph resembles the color and pattern of brownish individuals of the nominate subspecies. The unicolored morph
(Fig. 16) resembles the unpatterned morph of B. m. ochracea.
An intermediate color variation is known from Nagaland, NE India (WII-AD 856), which resembles the ground
coloration of the unicolored morph but shows a Raw Umber (280) postocular stripe, faint dark dorsal had pattern
similar to that of the nominate subspecies and an irregular strippled Raw Umber (280) pattern forming broken bands
along dorsal body and tail.
Etymology. The species epithet is formed from the Latin words septentrio (= “north”) and the suffix -alis (to
form an adjective) and refers to the geographic distribution of this taxon. Boiga m. septentrionalis has the most
northern distribution of the subspecies of B. multomaculata.
Natural History. The holotype of B. m. septentrionalis was collected at 19:30 hrs. in bamboo, about 2 m above
ground. The paratypes were all collected at night when Boiga is active. At the time of capture, the air temperature
was 26.1–28.2°C and the relative air humidity was recorded as 81–96%.
KÖHLER
180 · Zootaxa 5270 (2) © 2023 Magnolia Press
FIGURE 16. Boiga m. septentrionalis from Nagaland, India, in life (WIIADR 856). Photo by AD.
Boiga stoliczkae (Wall, 1909)
Stoliczka´s Asian Cat Snake
1909 [Dipsadomorphus] Wall: 155.
Geographic distribution. In the west from central Nepal (ca. 83°51’E) through Darjeeling, Sikkim and Bhutan to
Arunachal Pradesh and Assam in northeastern India (north and west of the Brahmaputra valley) (own observation;
Wall 1909; Smith 1943; Fleming, JR. & Fleming, SR. 1974; Kramer 1977; Ahmed & Dasgupta 1992; Bauer &
Günther 1992; Gruber 2002; Shah & Tiwari 2004; Whitaker & Captain 2004; Sanyal & Gayen 2006; Agarwal et al.
2010; Purkayastha 2013; Wallach et al. 2014; Das et al. 2016; Wangyal & Das 2021).
Type material. Wall (1909:155) mentioned that he has examined 39 specimens of this new species from the
“neighbourhood of Darjiling” (Darjeeling, West Bengal state, India), which is characterised by having 21 [midbody]
scale rows, 218–252 ventrals and 100–119 subcaudals. He did not specify particular specimens by inventory
number and with the exception of the British Museum (Natural History) he does not mention any other collection
in which the type material could be deposited. However, it is documented through his publications (e.g., Wall 1909;
1921) that he examined for his studies not only his own material but beside specimens from the British Museum
also material from various collections in India (e.g., BNHS Mumbai, ZSI Kolkata, and St. Joseph’s College in
Darjeeling). After his retirement in 1925 he presented parts his own collection, including type specimens, to the
British Museum (Natural History) in London (Smith 1951). Based on information provided by Andrew Stimson,
Curator of Herpetology at the BMNH, Kramer (1977:735) was the first to mention inventory numbers for the type
material of and regarded a series of eight specimens, i.e., BMNH 72.4.17.119, 72.4.17.386, BMNH
74.4.1193–94, BMNH 94.12.31.55, and 1909.3.13–15 as syntypes. The two specimens mentioned by Wall (1909)
and already considered by him as doubtful with respect to the locality “Burma“, refer to BMNH 74.4.1193–1194 and
were presented by R.H. Beddome (see also Introduction, and Wall 1908:714 footnote; Wall 1910:791 footnote). All
aforementioned specimens are also marked as syntypes in the inventory ledger of the herpetological collection of
REVISION OF Zootaxa 5270 (2) © 2023 Magnolia Press · 181
the BMNH, now NHM London. However, some other specimens must also be regarded as part of the original series
of , since they came from “Darjeeling“ and where part of Wall´s donation to the collection in London,
registered in 1930, viz. BMNH 1930.5.8.648–649, 1930.5.8.650, and 1930.5.5.651. Thus, the material in the NHM
London alone represents only a portion of the original specimens examined by Wall. Therefore, we also consider
specimens in Indian collections as potential type material of that could have been available to Wall
if the temporal context, locality, and morphological characters are consistent with those in his original description.
Putative syntypes that fit Wall’s diagnosis, were collected in the “neighbourhood of Darjiling”, and which were
already in the respective collection prior to 1909 include BNHS 1772 from “Tindharia” (~20 km southeast of
Darjeeling), and ZSIK 7869, 7873, 7878, 8476 and 11367 all from “Darjeeling”.
In agreement with Art. 74.7 of the Code, we here designate BMNH 94.12.31.55 (Figs. 17 and 18) as lectotype of
Wall, 1909 to introduce a standard of application for the species group name
Wall by a single name-bearer.
FIGURE 17. Lectotype of Wall (BMNH 94.12.31.55). A. dorsal view; B. ventral view. See text for
details. Scale bar = 10 cm. Photos by FT.
KÖHLER
182 · Zootaxa 5270 (2) © 2023 Magnolia Press
FIGURE 18. Lectotype of Wall (BMNH 94.12.31.55). A. dorsal view of head; B. right lateral view
of head; C. left lateral view of head; D. ventral view of head. Scale bar = 1 cm. Photos by FT, line drawings by MOS.
Lectotype. BMNH 94.12.31.55 (Figs. 17 and 18), an adult male from “Darjeeling” (West Bengal state, India),
presented by William Thomas Blanford.
Paralectotypes. BMNH 72.4.17.119 and 72.4.17.386, both females from „Darjeeling“, presented by T.C.
Jerdon; BMNH 74.4.1193–1194, both females from „Burma“ [in error, most probably from the Eastern Himalayas],
presented by R.H. Beddome; BMNH 1909.3.13–15, halfgrown, one female and two with unknown sex; BMNH
1930.5.8.648–649, two skulls, 1930.5.8.650, genitals, and 1930.5.5.651, three vertebrae, all from „Darjeeling“
collected and presented by F. Wall; BNHS 1772, a female from „Tindharia, Darjeeling“, collector unknown; ZSIK
7869, male, 7873, 7878, 8476 and 11367 all females from „Darjeeling“ collected and presented by British botanist
George Alexander Gammie (1864–1935).
REVISION OF Zootaxa 5270 (2) © 2023 Magnolia Press · 183
Description of the lectotype. Adult male, indicated by the presence of hemipenes; 1/1 loreal, wider than high;
nasal scale completely divided; 1/1 preocular; 1/1 supraocular; 2/2 postoculars, upper not reaching onto top of head;
2 prefrontals; 2/2 anterior and 2/3 posterior temporals; supralabials 8/8, 3rd–5th supralabials entering eye; 11/11
infralabials, first four in contact with anterior chin shields; 21 dorsal scales in 19-19-15 rows, smooth with single
tiny apical pits on body and single or paired apical pits on dorsocaudal scales; vertebral scale row significantly
enlarged; no preventral; 235 ventrals; cloacal plate entire; 111 paired subcaudal scales. Body slender; tail long (TL/
SVL 0.282); SVL 740 mm; TL 209 mm; head length measured from tip of snout to posterior border of parietals 16.5
mm, head length measured from tip of snout to posterior edge of mandible 21.8 mm, head width 13.0 mm; diameter
eye 3.9 mm; distance anterior border eye to tip of snout 5.2 mm.
Maxillary bone with 10/11 prediastemal teeth, followed by a very distinct diastema which is 125% longer than
the socket of the last prediastemal tooth and followed by two distinctly enlarged, grooved and posteriorly bent
postdiastemal teeth. Prediastemal teeth slightly decrease in size posteriorly, the anterior two distinctly posteriorly
hooked, the following with less pronounced curvature. On the left side, prediastemal teeth number one, three, five
and seven missing, teeth six and eight broken, tooth nine and first postdiastemal tooth loose. On the right side,
prediastemal teeth two, four, six, eight, 10 and first postdiastemal tooth loose. Medial to each maxillary tooth is a
single replacement tooth at different growth stages.
Palatine bone with 6/6 posteriorly curved teeth, shorter that the prediastemal teeth and slightly decreasing in
size posteriorly. Anterior two teeth missing on left side. Tooth two missing on the right side. Lateral to each palatine
tooth is a single replacement tooth at different growth stages.
Pterygoid bone with 10/10 posteriorly curved teeth, shorter than the palatine tooth, gradually decreasing in size
posteriorly. Teeth two, four, six and eight loose on left side. Teeth two, four, six, seven and nine loose on right side.
The posterior 49% of the pterygoid bone are without teeth.
Mandibular bone with 17/17 posteriorly curved teeth, shorter than maxillary teeth, gradually decreasing in size
posteriorly. Medial to each mandibular tooth is a single replacement tooth in different growth stages. Teeth one and
two broken, teeth two, four, six, seven, nine, 11, 13 and 15 loose, and tooth 16 missing on left side. Teeth two, four,
six, eight and nine loose, teeth 11, 13, and 15 missing on right side.
Coloration after about 130 years preservation in ca. 70% ethanol was recorded as follows: Dorsal ground color
Cinnamon-Drab (Color 50) with Sepia (286) interstitial skin; dorsal head with same ground color as dorsal body,
upper and lower labials Light Buff (2). Venter of head, body and tail Light Buff (2) without markings.
Dorsal scale reduction formula.
– 10+V(147) 3+4(152) – 8+V(192)
(10)21 ----------- 20 ------------- 19 ----------- 17 ------------ 16 ------------ 15(235).
3+4(142) – 3+4(152) 8+V(187) –
Variation. Paralectotypes and additional examined material agree well with the lectotype in general appearance,
morphometrics and scalation (Table 1).
Variation in dentition. Nine to 14 prediastemal teeth followed by a distinct diastema and two enlarged grooved
postdiastemal teeth; five to eight palatine, nine to 15 pterygoid, and 15 to 21 dental teeth.
Variation in live coloration and pattern. Only a unicolored morph is known (Fig. 19). The dorsal ground color
may vary from Cinnamon (255) or Cinnamon-Rufous (31) to Tawny (60) in adults or Gem Ruby (65) in young
individuals. Rarely a faint Cinnamon Brown (43) streak is running from the posterior border of the eye to the angle
of the mouth. In some individuals a small faint banded dorsal body pattern is visible, which is caused by the Medium
Neutral Grey (298) interstitial skin. Lower half of supralabials, infralabials, throat and first third of ventral body
Pale Buff (1) or Chamois (84), rest of venter and tail Yellow Ocher (14) or Tawny Olive (17). Iris resembling the
dorsal ground color of body and can vary from Cinnamon (255) to Gem Ruby (65); pupil Sepia (286).
Natural Historyis mostly semiarboreal, crepuscular and nocturnal. It is known to inhabit
open forest types, agricultural land, human habitations, and gardens, where it is found on low vegetation, bushes and
walls. The altitudinal distribution ranges from lowlands, mid hills and submontane regions, from around 85 m up
to 2000 m a.s.l. It is reported to feed on birds, their eggs, lizards, snakes (Trachischium fuscum), and small rodents
(our observations; Shaw et al. 1941; Greene 1989; Tillack 1999; Gruber 2002; Jha & Thapa K. 2002; Shah & Tiwari
2004; Nepali & Singh 2020; Pradhan 2021).
KÖHLER
184 · Zootaxa 5270 (2) © 2023 Magnolia Press
FIGURE 19. in life. A. WIIAD 858, unsexed specimen from Royal Manas NP, Bhutan; B. ZMB 73660, a
female from Naudanda, Kaski, Nepal, 1300 m a.s.l. Photo by AD (A) and FT (B).
Discussion
The recognition of subspecies has become an unpopular measure among herpetologists during the past 50 years
or so, with some researchers completely ignoring subspecies (e.g., Burbrink et al. 2000; Manier 2004). This was
mostly due to an over-use and abuse of this category during the first half of the 20th century with recognizing
subspecies based on arbitrary divisions of gradual variation, individual variation, and geographic variation based on
single characters as well as for almost every allopatric population. However, recently the species versus subspecies
issue has received increased attention (e.g., Hawlitschek et al. 2012; Hillis 2020) and we do see merit in the use of
the subspecies category for incompletely separated lineages. de Queiroz (2020: 460) suggested „to conceptualize
subspecies as incompletely separated species (lineages) within a more inclusive species (lineage).“Thus, subspecies
are subsets of a species and all subspecies together constitute the species, and are distributed allopatrically (Köhler
2021). It has been argued that trinomials should be “used to indicate the nesting of incompletely separated lineages
within a more inclusive lineage” (de Queiroz 2020: 461). It has been emphasized that the recognition of subspecies
as defined above “requires that any hypothesized subspecies be supported by the same kinds of evidence that would
be required to infer that an entity is a species, as well as evidence that its separation from one or more other species
is incomplete” (de Queiroz 2020: 461).
As presented in this present study, the evaluation of genetic distance of various mtDNA markers, or even
complete mt genomes among the studied organisms, has been used as a proxy for distinguishing between completely
and incompletely separated lineages with a low level of mitochondrial divergences interpreted as evidence for
incompletely separated lineages (e.g., Hawlitschek et al. 2012; Köhler 2021; Kehlmaier et al. 2021).
Reproductive isolation by intrinsic isolation mechanisms has been proposed as a property of species level units
whereas subspecies differ from other subspecies of the same species but are still capable of interbreeding with them
(Mayr 1942; Patten 2010). Thus, subspecies of the same species always exist in allo- or parapatry but by definition
never coexist in sympatry.
Patterns in ecological and genetic variation among species and communities have been often attributed to the
geographic barriers such as rivers. In case of less vagile species such as amphibians, allopatric occurrence and
absence of gene flow across the Red River valley in China and Vietnam was shown in taxa such as Microhyla
fissipes, Nanorana yunnanensis, , and Ichthyophis bannanicus (Zhang et al. 2010a;
Zhang et al. 2010b; Wang et al. 2015).
The Brahmaputra river is considered a major biogeographic barrier for vertebrates in northeast India (Mani
1974; Ripley & Beehler 1990; Pawar et al. 2007; Lehman, S.M. & Fleagle, J.G. 2006; Sengupta et al. 2009; Deepak
& Karanth 2018). However, whether it is the Brahmaputra River or the Brahmaputra valley that is acting as a
barrier, remains to be tested in a phylogenetic framework. Similarly, the role of Brahmaputra as a barrier or faunal
filter (sensu Das 1996) also needs further research. Das et al. (2021) indicated that the Brahmaputra may not be a
strong barrier for some semiaquatic snake species such as Rhabdophis himalayanus which showed very low genetic
REVISION OF Zootaxa 5270 (2) © 2023 Magnolia Press · 185
differences among population of both side of the River. In contrast, the present study rather provides evidence that
the Brahmaputra might be acting as a barrier for typical Himalayan species such as and widespread
Southeast Asian species such as B. multomaculata that meets its northwestern distributional limit in northeast India.
However, among the material we examined is a single individual of (ZSIK 8476), supposedly from
Goalpara (Assam, India), directly from the south bank of the Brahmaputra. In this area the river is interspersed by
many small islands and sandbanks and it cannot be ruled out that this specimen drifted from the north bank of the
Brahmaputra to the south, e.g., during high water. The role of the Brahmaputra as a barrier and a prerequisite for
allopatric speciation in the region, should be further investigated by intensive sampling in a larger geographic area
along the river and extended to several other taxa
It seems possible that the blotched color morph of Boiga multomaculata is involved in a mimicry system
with the sympatrically distributed Daboia siamensis and D. russelii, respectively. The similarity in pattern and
coloration in the three taxa is astonishing and for a potential visually oriented predator (e.g., a bird) that would
avoid such a patterned snake it is not relevant whether it encounters the snake on the ground or in a tree. Müllerian
mimicry between Asian cat snakes and vipers in South Asia is discussed by Kroon (1975) between Boiga trigonata
melanocephala and . However, although a mimicry system seems plausible, Boiga multomaculata
and Daboia siamensis, vs. D. russelii, differ in so many ways (e.g., arboreal vs. terrestrial; slender vs. stout; silent
vs. noisy) that alternative hypotheses need to be considered. The large-spotted dorsal pattern might simply function
as a disruptive patterning whereas the unicolored morph may benefit from being better camouflaged. If clutches of
eggs contain hatchlings demonstrating both color patterns it might improve the chances for survival of one or the
other pattern in any given habitat type.
Not all subspecies of B. multomaculata exhibit polymorphism, the nominate form only appearing in the blotched
livery while B. m. ochracea and B. m. septentionalis both exhibit non-sexual, non-ontogenetic dichromatism. There
would seem to be a trend with the eastern and southern populations (B. m. multomaculata: southern China [including
Hainan], Thailand, Laos, Vietnam, Cambodia, Indonesia [Sunda Islands]) exhibiting only the grey blotched livery;
the western and northern forms (B. m. ochracea: northern Thailand, northern Laos, Myanmar, Bangladesh and
northeastern India [Mizoram], and B. m. septentionalis (northeastern India [Assam, Nagaland], peninsular India
and possible southwestern China [Yunnan]) are represented by specimens with both patterns, whereas the extreme
western populations of B. m. ochracea (Bangladesh and northeastern India [Mizoram]) as well as all known
populations of appear to exhibit the immaculate ocher phenotype (see also Fig. 1). Individuals that show
an intermediate color pattern are mostly unknown. See Fig. 16 for a specimen of B. m. septentrionalis that exhibits
a kind of intermediate color pattern having transverse series of dark dashes on a cream-colored background.
Such polymorphism is also seen in the highly arboreal Neotropical boid genus Corallus, especially in Caribbean
C. grenadensis and Amazonian C. hortulanus (Henderson 2015; MOS pers. obs.) which not only exhibit color
patterns similar to those observed in the B. multomaculata group, but other patterns comprised of reds or greens
that do not occur in these cat snakes. This may be a case of convergence based on some benefits received by
polymorphic Boiga or Corallus. However, the absence of Daboia from the Neotropics does not fully undermine
the mimicry argument since Corallus hortulanus exists in sympatry with a number of stocky-bodied, terrestrial
Bothrops, with patterning similar to the blotched morph, and also the arboreal pitviper, Bothrops taeniatus, which
exhibits a similar patterning.
Acknowledgments
For the loan of and/or access to specimens, we are indebted to the following former and active staff of various
collections, in particular Colin McCarthy and Patrick Campbell (BMNH), Rahul Koth (BNHS), Jens Vindum and
Lauren Scheinberg (CAS), M. Farid Ahsan (CUZ), Alan Resetar (FMNH), José P. Rosado and James Hanken (MCZ),
Annemarie Ohler (MNHN), Karan B. Shah (NHMK), Urs Wüest and Ambros Hänggi (NMBA), Ulrich Scheidt
and Konrad Kürbis (NME), Esther Dondorp, Karien Lahaise, and Becky Desjardins (RMNH), Jakob Hallermann
(ZMH), B.H.C.K Murthy and Sujoy Raha (ZSIK). Erica J. Ely (CAS) sent us images of the holotype of Boiga m.
septentrionalis and Luhur Septiadi provided an image of Boiga m. multomaculata from Java in life. Van Wallach
send us copies of the relevant pages of an unpublished manuscript dated around 1825 by Johann Georg Wagler.
We are thankful to former and present staff of the ZMB library, Martina Rißberger and Hans-Ulrich Raake and the
KÖHLER
186 · Zootaxa 5270 (2) © 2023 Magnolia Press
Department of Historical Research at ZMB, Sandra Miehlbradt and Sabine Hackethal for permanent support in
procuring rare literature and access to archive material. We are grateful to Kristin Mahlow (MfN Berlin, Germany)
for providing several micro-CT scans of Boiga taxa relevant to this study. Ashok Captain (Pune, India), Kedar Bhide
(Mumbai, India), Viral Mistry (Mumbai, India), Ramana Athreya (Pune, India), Pratyush P. Mohapatra (Jabalpur,
Germany), Stephen Mahony (University College Dublin, Ireland), Krisitin Mahlow (MfN Berlin, Germany), Ulrich
Manthey (Berlin, Germany), Hendrik Müller (Halle, Germany), Ulrich Kuch (Frankfurt/M., Germany), Sanjib K.
Sharma (Dharan, Nepal), Karan B. Shah (Kathmandu, Nepal) supported us with personal information on specimens
or helped us with data recording during collection visits.
For the support during field work we would like to thank Akary Myat Tun (Gießen, Germany), Marcel Haas
(Gießen, Germany), Santanu Dey and Nilam Dutta (Assam, India), Karan B. Shah (Kathmandu, Nepal), Om Prakash
Subedi (Pokhara, Nepal) and local people of the Kaski District Nepal, Wolfgang Grossmann (Berlin, Germany),
Wolfgang Eckert (Berlin, Germany), Matthias Lorenz (Teltow, Germany). GK and MOS thank David A. Warrell
(Oxford), Julian White (Adelaide), and David Bacon (Adelaide) who arranged funding, logistics, drivers, etc. for
us in 2018 when we were in the field in Myanmar. We would like to express our gratitude to Dr. Nyi Nyi Kyaw,
Director General, Forest Department, Ministry of Natural Resources and Environmental Conservation, Myanmar,
for issuing our collecting permits, U Hla Maung Thein, Director General, Environmental Conservation Department,
Ministry of Natural Resources and Environmental Conservation, Myanmar, for issuing our permission to access
the genetic resources as in compliance with the Nagoya Protocol, and to Dr. Naing Zaw Htun, Director, Nature
and Wildlife Conservation Division, Ministry of Natural Resources and Environmental Conservation, Myanmar,
for issuing the exportation permits. Our special thanks are due to Dr. Kyaw Kyaw Khaung, Rector, East Yangon
University, Thanlyin, for supporting us to obtain all necessary permissions from the Ministry of Natural Resources
and Environmental Conservation, Myanmar. Thanks to Assam, Nagaland and Mizoram Forest Department for
research permission to AD. AD thank SERB, Government of India, vide grant number CRG/2018/000790 for
funding, and Director and Dean for support. This research was funded partly by Chulalongkorn University Grant
for Development of New Faculty Staff and Ratchadaphiseksomphot Endowment Fund and Science Engineering and
Research Board, Govt. of India Vide Grant CRG/2018/000790.
References
Agarwal, I., Mistry, V.K. & Athreya, R. (2010) A preliminary checklist of the reptiles of Eaglenest Wildlife Sanctuary, West
Kameng District, Arunachal Pradesh, India. Russian Journal of Herpetology, 17, 81–93.
Ahmed, M.F., Das, A. & Dutta S.K. (2009) Amphibians and Reptiles of Northeast India. A photographic Guide. Aaranyak,
Guwahati, India.
Ahmed, S. & Dasgupta, G. (1992) Reptilia. In: Gosh, A.K. (Ed.), Zoological Survey of India, State Fauna Series 3, Fauna of
West Bengal. Part 2, Calcutta, pp. 1–65.
Annandale, N. (1909) Major Wall on some forms of Dipsadomorphus. Records of the Indian Museum, 3, 281–282.
https://doi.org/10.26515/rzsi/v3/i3/1909/163284
Bauer, A.M. & Günther, R. (1992) A preliminary report on the reptile fauna of the Kingdom of Bhutan with the description of a
new species of scincid lizard. Asian Herpetological Research, 4, 23–36.
https://doi.org/10.5962/bhl.part.6178
Boie, F. (1827) Bemerkungen über Merrem’s Versuch eines Systems der Amphibien. Marburg, 1820 1te Lieferung, Ophidier.
Isis von Oken, Jena, 20, 508–566.
Boie, H. (1823–1825) (unpublished manuscript deposited in Naturalis, Leiden, the Netherlands, snake
section contains 30 pages).
Bouckaert, R. & Heled, J. (2014) DensiTree 2: Seeing trees through the forest.
https://doi.org/10.1101/012401
Boulenger, G.A. (1890) The Fauna of British India, including Ceylon and Burma. Reptilia and Batrachia. Taylor and Francis,
London, United Kingdom, xviii+541.
https://doi.org/10.5962/bhl.title.100797
Boulenger, G.A. (1896) . Trustees of the British
Museum (Natural History), London, United Kingdom, xiv+727.
Bourret, R. (1936) Les Serpents de l’Indochine. .
Burbrink, F.T., Lawson, R. & Slowinski, J.B. (2000) Mitochondrial DNA phylogeography of the polytypic North American rat
snake (): a critique of the subspecies concept. 54, 2107–2118.
REVISION OF Zootaxa 5270 (2) © 2023 Magnolia Press · 187
https://doi.org/10.1111/j.0014-3820.2000.tb01253.x
Burnham, K.P. & Anderson, D.R. (2002) Model Selection and Multimodel Inference. A Practical Information-Theoretic
Approach. Springer-Verlag New York Inc, New York, NY.
Chan-ard, T., Parr, J. & Nabhitabhata, J. (2015) A field guide to the reptiles of Thailand. Oxford University Press, Oxford, New
York, xxix+314.
Chandramouli, R.S. (2022) Snake fauna of the Andaman Islands, Bay of Bengal - A review of species richness, taxonomy,
distribution, natural history and conservation status. Zootaxa, 5209 (3), 301–331.
https://doi.org/10.11646/zootaxa.5209.3.1
Cope, E.D. (1860) Catalogue of the Colubridae in the Museum of the Academy of Natural Sciences of Philadelphia, with notes
and descriptions of new species. Part 2. Proceedings of the Academy of Natural Sciences of Philadelphia, 12, 241–266.
Das, A., Sharma, P., Surendran, H., Nath, A., Gosh, S., Dutta, D., Mondol, J. & Wangdi, Y. (2016) Additions to the herpetofauna
of Royal Manas National Park, Bhutan, with six new country records. Herpetology Notes, 9, 261–278.
Das, A., Smith, E.N., Sidik, I., Sarker, G.C., Boruah, B., Patel, N., Murthy, B. H. C. K. & Deepak, V. (2021) Hidden in the plain
sight: a new species of Rhabdophis (Serpentes: Natricinae) from the Rhabdophis himalayanus complex. Zootaxa, 5020 (3),
401–433.
https://doi.org/10.11646/zootaxa.5020.3.1
Das, I. (1996) Biogeography of the reptiles of South Asia. Krieger Publishing Co, Malabar FL, vii + 87.
Das, I. (2010) . New Holland Publishers (UK) Ltd., London, 376 pp.
Das, I., Dattagupta, B. & Gayen, N.C. (1998) History and catalogue of reptile types in the collection of the Zoological Survey
of India. Journal of South Asian Natural History, 3, 121–172.
David, P. & Vogel, G. (1996) The Snakes of Sumatra: An Annotated Checklist and Key with Natural History Notes. Eidtion
Chimaira, Frankfurt, 259 pp.
Deepak, V. & Karanth, P. (2018) Aridification driven diversification of fan-throated lizards from the Indian subcontinent.
Molecular phylogenetics and evolution, 120, 53–62.
https://doi.org/10.1016/j.ympev.2017.11.016
de Queiroz, K. (2007) Species concepts and species delimitation. Systematic biology, 56, 879–886.
https://doi.org/10.1080/10635150701701083
de Queiroz, K. (2020) An updated concept of subspecies resolves a dispute about the taxonomy of incompletely separated
lineages. Herpetological Review, 51, 459–461.
Dowling, H.G. (1951a) A proposed standard system of counting ventrals in snakes. British Journal of Herpetology, 1, 5, 97–
99.
Dowling, H.G. (1951b) A proposed method of expressing scale reductions in snakes. Copeia 1951, 2, 131–134.
Drummond, A.J., Suchard, M.A., Xie, D. & Rambaut, A. (2012) Bayesian phylogenetics with BEAUti and the BEAST 1.7.
29, 1969–1973.
https://doi.org/10.1093/molbev/mss075
Duméril, A., Bibron, G. & Duméril, A. (1854a) .
Roret/Fain et Thunot, Paris, xvi + 780.
https://doi.org/10.5962/bhl.title.118797
Duméril, A., Bibron, G. & Duméril, A. (1854b) .
Roret/Fain et Thunot, Paris.
https://doi.org/10.5962/bhl.title.118797
Edgar, R.C. (2004) MUSCLE: a multiple sequence alignment method with reduced time and space complexity. BMC
bioinformatics, 5, 1–19.
https://doi.org/10.1186/1471-2105-5-113
Evenhuis, N.L. (2003) Publication and dating of the journals forming the Annals and Magazine of Natural History and the
Journal of Natural History. Zootaxa, 385, 1–68.
https://doi.org/10.11646/zootaxa.385.1.1
Fitzinger, L.I. (1826)
. J.G. Heubner, Wien, 66
pp.
https://doi.org/10.5962/bhl.title.4683
Fleming, R.L., JR. & Fleming, R.L., SR. (1974) Some snakes of Nepal. Journal of the Bombay Natural History Society, 70,
426–437.
Frost, D.R. & Hillis, D.M. (1990) Species in concept and practice: Herpetological applications. Herpetologica, 46, 87–104.
Ganesh, S.R., Achyuthan, N.S., Chandramouli, S.R. & Vogel, G. (2020) Taxonomic revision of the Boiga ceylonensis group
(Serpentes: Colubridae): re-examination of type specimens, redefinition of nominate taxa and an updated key. Zootaxa,
4779 (3), 301–322.
https://doi.org/10.11646/zootaxa.4779.3.1
Ganesh, S.R., Mallik, A.K., Achyuthan, N.S., Shanker, K. & Vogel, G. (2021) A new species of Boiga (Serpentes: Colubridae)
from the Southern Western Ghats of India with a molecular phylogeny and expanded characterisation of related species.
Zootaxa, 4981 (3), 449–468.
KÖHLER
188 · Zootaxa 5270 (2) © 2023 Magnolia Press
https://doi.org/10.11646/zootaxa.4981.3.2
Gelman, A. & Rubin, D.B. (1992) Inference from iterative simulation using multiple sequences. Statistical Science, 7, 457–
472.
https://doi.org/10.1214/ss/1177011136
Giri, V.B., Deepak, V., Captain, A., Pawar, S. & Tillack, F. (2019) A new species of Boiga Fitzinger, 1826 (Serpentes: Colubridae)
from the northern Western Ghats of India. Journal of Bombay Natural History Society, 116, 71–81.
Glez-Peña, D., Gómez-Blanco, D., Reboiro-Jato, M., Fdez-Riverola, F. & Posada, D. (2010) ALTER: program-oriented
conversion of DNA and protein alignments. Nucleic Acids Research, 38, 14–18.
https://doi.org/10.1093/nar/gkq321
Greene, H.W. (1989) Ecological, evolutionary, and conservation implications of feeding biology in old world cat snakes, genus
Boiga (Colubridae). Proceedings of the California Academy of Science, 46, 193–207.
Gruber, U. (2002) Family Colubridae (colubrid snakes). In: Schleich, H.H. & Kästle, W. (Eds.). Amphibians and Reptiles of
Nepal. A.R.G. Gantner Verlag, Ruggell, pp. 803–950.
Guindon, S., Dufayard, J.-F., Lefort, V., Anisimova, M., Hordijk, W. & Gascuel, O. (2010) New algorithms and methods to
estimate maximum-likelihood phylogenies: assessing the performance of PhyML 3.0. Systematic biology, 59, 307–321.
https://doi.org/10.1093/sysbio/syq010
Günther, A. (1868) Sixth account of new species of snakes in the British Museum.
(4) 1, 425.
https://doi.org/10.1080/00222936808695725
Hasan, M., Islam, M.M., Kuramoto, M., Kurabayashi, A. & Sumida, M. (2014) Description of two new species of Microhyla
(Anura: Microhylidae) from Bangladesh. Zootaxa, 3755 (5), 401–418.
https://doi.org/10.11646/zootaxa.3755.5.1
Hawlitschek, O., Nagy, Z.T. & Glaw, F. (2012) Island evolution and systematic revision of Comoran snakes: why and when
subspecies still make sense. 7, e42970.
https://doi.org/10.1371/journal.pone.0042970
Henderson, R.W. (2015) Natural History of Neotropical Treeboas (genus Corallus). Edition Chimaira, Frankfurt, 338 pp.
Hillis, D.M. (2020) The detection and naming of geographic variation within species. Herpetological Review, 51, 52–56.
Hmar, G.Z., Muansanga, L., Biakzuala, L., Lalrinsanga, R. & Lalremsanga, H.T. (2020) Inventory survey on the ophidian fauna
of Reiek Community Reserved Forest, Mamit district, Mizoram, India. 41, 821–826.
https://doi.org/10.22438/jeb/41/4(SI)/MS_1906
Huelsenbeck, J.P. & Ronquist, F. (2001) MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics (Oxford,
England), 17, 754–755.
https://doi.org/10.1093/bioinformatics/17.8.754
ICZN (1999) International Code of Zoological Nomenclature. Available from http://www.nhm.ac.uk/hosted-sites/iczn/code.
ICZN (2012) Amendment of Articles 8, 9, 10, 21 and 78 of the International Code of Zoological Nomenclature to expand and
refine methods of publication. ZooKeys, 219, 1–10.
https://doi.org/10.3897/zookeys.219.3994
Iskandar, D.T. & Colijn, E. (2002) A checklist of Southeast Asian and New Guinean reptiles I. Serpentes. Biodiversity
Conservation Project, Indonesian Institute of Sciences, Bandung.
Ivanova, N.V., Waard, J. de & Hebert, P.D. (2006) An inexpensive, automation-friendly protocol for recovering high-quality
DNA. 6, 998–1002.
https://doi.org/10.1111/j.1471-8286.2006.01428.x
Jha, A. & Thapa K. (2002) Reptiles and Amphibians of Sikkim. Mrs. S. Jha Publ, Raipur.
Kearse, M., Moir, R., Wilson, A., Stones-Havas, S., Cheung, M., Sturrock, S., Buxton, S., Cooper, A., Markowitz, S., Duran,
C., Thierer, T., Ashton, B., Meintjes, P. & Drummond, A. (2012) Geneious Basic: An integrated and extendable desktop
software platform for the organization and analysis of sequence data. Bioinformatics, 28, 1647–1649.
https://doi.org/10.1093/bioinformatics/bts199
Kehlmaier, C., Albury, N.A., Steadman, D.W., Graciá, E., Franz, R. & Fritz, U. (2021) Ancient mitogenomics elucidates diversity
of extinct West Indian tortoises. Scientific Reports, 11, 3224.
https://doi.org/10.1038/s41598-021-82299-w
Kekkonen, M., Mutanen, M., Kaila, L., Nieminen, M. & Hebert, P.D.N. (2015) Delineating species with DNA Barcodes: A case
of taxon dependent method performance in moths. PloS one, Article ID e0122481.
https://doi.org/10.1371/journal.pone.0122481
Köhler, G. (2008) Reptiles of Central America. Second edition. Herpeton, Offenbach [Germany], 400 pp.
Köhler, G. (2012) Color Catalogue for Field Biologists. Herpeton, Offenbach.
Köhler, G. (2021) Taxonomy of horned lizards, genus Phrynosoma (Squamata, Phrynosomatidae). Taxonomy, 1, 83–115.
https://doi.org/10.3390/taxonomy1020009
Kopstein, F. (1938) Ein Beitrag zur Eierkunde und zur Fortpflanzung der Malaiischen Reptilien. Bulletin of the Raffles Museum,
14, 81–167, pl. vi–xxvii.
Kramer, E. (1977) Zur Schlangenfauna Nepals. Review Suisse de Zoologie, 84, 721–761.
https://doi.org/10.5962/bhl.part.91420
REVISION OF Zootaxa 5270 (2) © 2023 Magnolia Press · 189
Kroon, C. (1975) A possible Müllerian mimetic complex among snakes. Copeia, 75, 425–428.
https://doi.org/10.2307/1443639
Kumar, S., Stecher, G. & Tamura, K. (2016) MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets.
33, 1870–1874.
https://doi.org/10.1093/molbev/msw054
Lalremsanga, H.T. & Lalronunga, S. (2017) . Biodiversity and Nature
Conservation Network (BIOCONE), Aizwal, 132 pp.
Lalremsanga, H.T., Sailo, S. & Chinliansiama, H. (2018) Diversity of snakes (Reptilia: Squamata) and role of environmental
factors in their distribution in Mizoram, Northeast India. 265–268.
Lanfear, R., Frandsen, P.B., Wright, A.M., Senfeld, T. & Calcott, B. (2017) PartitionFinder 2: New methods for selecting
partitioned models of evolution for molecular and morphological phylogenetic analyses.
34, 772–773.
https://doi.org/10.1093/molbev/msw260
Lehman, S.M. & Fleagle, J.G. (Ed.) (2006) Primate biogeography: progress and prospects. Springer Science & Business
Media.
https://doi.org/10.1007/0-387-31710-4
Mahony, S., Hasan, K., Kabir, M. & Ahmed, M, & Hossain, K. (2009) A catalogue of amphibians and reptiles in the collection
of Jahangirnagar University, Dhaka, Bangladesh. Hamadryad, 34, 80–94.
Mani, M.S. (1974) . Dr. W. Junk b.v. Publishers, The Hague, The Netherlands.
https://doi.org/10.1007/978-94-010-2331-3
Manier, M.K. (2004) Geographic variation in the long-nosed snake, Rhinocheilus lecontei (Colubridae): beyond the subspecies
debate. 83, 65–85.
https://doi.org/10.1111/j.1095-8312.2004.00373.x
Manthey, U. & Grossmann, W. (1997) Amphibien und Reptilien Südostasiens. Natur und Tier Verlag, Münster, 512 pp.
Mayr, E. (1942) Systematics and the origin of species, New York, 334 pp.
McKay, J.L. (2006) A field guide to the amphibians and reptiles of Bali. Krieger Publishing Co, Malabar FL, vii+138.
Mell, R. (1922) Beiträge zur Fauna sinica I. Die Vertebraten Südchinas, Feldlisten und Feldnoten der Säuger, Vögel, Reptilien,
Batrachier. Archiv für Naturgeschichte A, 88, 1–134.
Mell, R. (1931) List of Chinese snakes. 8, 199–219.
Minh, B.Q., Nguyen, M.A.T. & Haeseler, A. von (2013) Ultrafast approximation for phylogenetic bootstrap. Molecular Biology
30, 1188–1195.
https://doi.org/10.1093/molbev/mst024
Nepali, P.B. & Singh, N.B. (2020) Documentation of herpetofaunal diversity in Nawalparasi district, Nepal. Uttar Pradesh
Journal of Zoology, 41, 56–70.
Nguyen, V.S., Ho, T.C. & Nguyen, Q.T. (2009) . Edition Chimaira, Frankfurt, 768 pp.
Ogilvie, H.A., Bouckaert, R.R. & Drummond, A.J. (2017) StarBEAST2 brings faster species tree inference and accurate
estimates of substitution rates. 34, 2101–2114.
https://doi.org/10.1093/molbev/msx126
O’Shea, M. & Kaiser, H. (2018) Erroneous Environs or Aberrant Activities? Using Historical Accounts to Resolve Unexpected
Collection localities for specimens of New Guinea Worm-eating Snakes (Toxicocalamus, Serpentes, Elapidae).
Herpetological Review, 49, 189–207.
Patten, M.A. (2010) Chapter 3: Null Expectations in Subspecies Diagnosis. Ornithological Monographs, 67, 35–41.
https://doi.org/10.1525/om.2010.67.1.35
Pawar, S.S., Birand, A.C., Ahmed, M.F. & Sengupta, S. & Raman, T. R. (2007) Conservation biogeography in north-east India:
hierarchical analysis of cross-taxon distributional congruence. Diversity and Distributions, 13, 53–65.
Pope, C.H. (1935) New
York, 604 pp.
https://doi.org/10.5962/bhl.title.12104
Pradhan, A. (2021) Boiga ochracea, Tawny Cat Snake, Diet. Herpetological Review, 52, 147.
Puillandre, N., Lambert, A., Brouillet, S. & Achaz, G. (2012) ABGD, Automatic Barcode Gap Discovery for primary species
delimitation. Molecular ecology, 21, 1864–1877.
https://doi.org/10.1111/j.1365-294X.2011.05239.x
Purkayastha, J. (2013) . EBH Publishers, Guwahati, 146 pp.
Ripley, S.D. & Beehler, B.M. (1990) Patterns of speciation in Indian birds. Journal of Biogeography, 17, 639–648.
https://doi.org/10.2307/2845145
Ronquist, F. & Huelsenbeck, J.P. (2003) MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics
(Oxford, England), 19, 1572–1574.
https://doi.org/10.1093/bioinformatics/btg180
Ronquist, F., Teslenko, M., Mark, P., Ayres, D., Darling, A., Höhna, S., Larget, B., Liu, L., Suchard, M. & Huelsenbeck, J. (2012)
MrBayes 3.2: Efficient Bayesian Phylogenetic Inference and Model Choice Across a Large Model Space. Systematic
biology, 61, 539–542.
KÖHLER
190 · Zootaxa 5270 (2) © 2023 Magnolia Press
https://doi.org/10.1093/sysbio/sys029
Sabaj, M.H. (2020) Codes for natural history collections in ichthyology and herpetology. Copeia, 108, 593–669.
https://doi.org/10.1643/ASIHCODONS2020
Sanyal, D.P. & Gayen, N.C. (2006) Reptilia. In: Alfred, J. (Ed.). Zoological Survey of India. State Fauna Series 13. Part 1.
Fauna of Arunachal Pradesh., Kolkata, pp. 247–284.
Schlegel, H. (1826) Notice sur l’erpétologie de I’île de Java; par M Boié (ouvrage manuscrit). Bulletin des Sciences Naturelles
9, 233–240.
Schleich, H.H. & Kästle, W. (Eds.) (2002) Amphibians and Reptiles of Nepal. A.R.G. Gantner Verlag, Ruggell, 1201 pp.
Sclater, W.L. (1891) . Trustees of the Indian Museum, Calcutta, 79 pp.
https://doi.org/10.5962/bhl.title.8746
Sengupta, S., Das, A., Das, S., Hussain, B., Choudhury, N.K. & Dutta, S.K. (2009) Taxonomy and biogeography of Kaloula
Species of Eastern India. The Natural History Journal of Chulalongkorn University, 9, 2, 209–222.
Shah, K.B. & Tiwari, S. (2004) Herpetofauna of Nepal: A conservation companion. IUCN Nepal, Kathmandu, viii+237.
Shaw, G.E., Shebbeare, E.O. & Barker, P.E. (1941) The snakes of northern Bengal and Sikkim, Part IX. Journal of the Darjeeling
Natural History Society, 15, 60–68.
Smith, M.A. (1923) On a collection of reptiles and batrachians from the island of Hainan. The Journal of the Natural History
Society of Siam, 6.
Smith, M.A. (1928) The status of some recently described genera and species of snakes.
History, 1, 494–497.
https://doi.org/10.1080/00222932808672813
Smith, M.A. (1930) The Reptilia and Amphibia of the Malay Peninsula from the Isthmus of Kra to Singapore including the
adjacent islands (A supplement to Dr. G. A. Boulenger’s Reptilia and Batrachia, 1912). Bulletin of the Raffles Museum, 3,
i–xviii + 1–149.
Smith, M.A. (1941) The herpetology of the Andaman and Nicobar Islands. 153,
152–158.
https://doi.org/10.1111/j.1095-8312.1941.tb00277.x
Smith, M.A. (1943) The Fauna of British India, Ceylon and Burma, including the whole of the Indo-Chinese Subregion. Reptilia
. Taylor & Francis, London, 583 pp.
Smith, M.A. (1951) Frank Wall, 1868-1950. Copeia, 1951, 113–114.
https://doi.org/10.2307/1437539
Stejneger, L.H. (1902) A new opisthoglyph snake from Formosa. Proceedings of the Biological Society of Washington, 15,
15–17.
Stoliczka, F. (1870) Observations on some Indian and Malayan Amphibia and Reptilia.
Ser. 4. 6, 105–109.
https://doi.org/10.1080/00222937008696209
Taylor, E.H. (1965) The serpents of Thailand and adjacent waters. The University of Kansas Science Bulletin, 45, 609–1096.
Theobald, W. (1868a) Catalogue of reptiles in the Museum of the Asiatic Society of Bengal. Journal of the Asiatic Society of
Bengal, Extra Number, vi+82 pp., Appendix i–iii.
https://doi.org/10.5962/bhl.title.5477
Theobald, W. (1868b) Catalogue of the reptiles of British Birma, embracing the provinces of Pegu, Martaban, and Tenasserim;
with descriptions of new or little-know species. 10, 4–67.
https://doi.org/10.1111/j.1096-3642.1868.tb02007.x
Tillack, F. (1999) Das Portrait: . Sauria, 21, 1–2.
Trifinopoulos, J., Nguyen, L.-T., Haeseler, A. von & Minh, B.Q. (2016) W-IQ-TREE: a fast online phylogenetic tool for
maximum likelihood analysis. Nucleic Acids Research, 44, W232–W235.
https://doi.org/10.1093/nar/gkw256
Uetz, P., Cherikh, S., Shea, G., Ineich, I., Campbell, P.D., Doronin, I.V., Rosado, J., Wynn, A., Tighe, K.A., McDiarmid, R., Lee,
J.L., Köhler, G., Ellis, R., Doughty, P., Raxworthy, C.J., Scheinberg, L., Resetar, A., Sabaj, M., Schneider, G., Franzen,
M., Glaw, F., Böhme, W., Schweiger, S., Gemel, R., Couper, P., Amey, A., Dondorp, E., Ofer, G., Meiri, S. & van Wallach
(2019) A global catalog of primary reptile type specimens. Zootaxa, 4695 (5), 438–450.
https://doi.org/10.11646/zootaxa.4695.5.2
Uetz, P., Freed, P. & Hošek, J. (2022) The Reptile Database. Available from http://www.reptile-database.org (accessed 6 February
2022)
Wall, F. (1908) A popular treatise on the common Indian snakes, Part VIII. Journal of the Bombay Natural History Society, 18,
711–735.
Wall, F. (1909) Remarks on some forms of Dipsadomorphus. Records of the Indian Museum, 3, 151–155.
https://doi.org/10.26515/rzsi/v3/i2/1909/163268
Wall, F. (1910) A popular treatise on the common Indian snakes, Part XII. Journal of the Bombay Natural History Society, 19,
775–792.
Wall, F. (1921) Ophidia Taprobanica or the snakes of Ceylon. H. R. Cottle, Government Printer, Colombo, 581 pp.
https://doi.org/10.5962/bhl.title.53694
REVISION OF Zootaxa 5270 (2) © 2023 Magnolia Press · 191
Wallach, V., Williams, K.L. & Boundy, J. (2014) . Taylor and
Francis, CRC Press, Boca Raton, Florida, USA, xxvii+1237.
Wang, H., Luo, X., Meng, S., Bei, Y., Song, T., Meng, T., Li, G. & Zhang, B. (2015) The phylogeography and population
demography of the Yunnan caecilian (Ichthyophis bannanicus): massive rivers as barriers to gene flow. 10,
e0125770.
https://doi.org/10.1371/journal.pone.0125770
Wangyal, J.T. & Das, I. (2021) A guide to the reptiles of Bhutan. Bhutan Ecological Society, Thimphu, 109 pp.
Weinell, J.L., Barley, A.J., Siler, C.D., Orlov, N.L., Ananjeva, N.B., Oaks, J.R., Burbrink, F.T. & Brown, R.M. (2021) Phylogenetic
relationships and biogeographic range evolution in cat-eyed snakes, Boiga (Serpentes: Colubridae). Zoological Journal of
192, 169–184.
https://doi.org/10.1093/zoolinnean/zlaa090
Werner, F. (1900) Reptilien und Batrachier aus Sumatra, gesammelt Herrn Gustav Schneider jr. im Jahre 1897-98. Zoologische
Jahrbücher. Abtheilung für Systematik, Geographie und Biologie der Thiere, 13, 479–508, pl. 31–35.
Whitaker, R. & Captain, A. (2004) Snakes of India. The field guide. Draco Books, Chennai, 479 pp.
Wilson, L.D. (1999) Checklist and key to the species of the genus Tantilla (Serpentes: Colubridae), with some commentary on
distribution. Smithsonian Herpetological Information Service, 1–36.
https://doi.org/10.5479/si.23317515.122.1
Yang, Z., Landry, J.-F. & Hebert, P.D.N. (2016) A DNA barcode library for North American Pyraustinae (Lepidoptera: Pyraloidea:
Crambidae). PloS one, 11, e0161449.
https://doi.org/10.1371/journal.pone.0161449
Zhang, D.R., Chen, M.Y., Murphy, R.W., Che, J., Pang, J.F., Hu, J.S., Luo, J., Wu, S.J., Ye, H. & Zhang, Y.P. (2010a) Genealogy
and palaeodrainage basins in Yunnan Province: phylogeography of the Yunnan spiny frog, Nanorana yunnanensis
(Dicroglossidae). Molecular ecology, 19, 3406–3420.
https://doi.org/10.1111/j.1365-294X.2010.04747.x
Zhang, M., Rao, D., Yang, J., Yu, G. & Wilkinson, J.A. (2010b) Molecular phylogeography and population structure of a mid-
elevation montane frog in a fragmented habitat of southwest China. Molecular phylogenetics
and evolution, 54, 47–58.
https://doi.org/10.1016/j.ympev.2009.10.019
Zhao, E.-M. & Adler, K. (1993) Herpetology of China. Society for the Study of Amphibians and Reptiles (Contributions to
Herpetology, 10), Oxford, OH, 522 pp.
APPENDIX 1. Specimens Examined.
Boiga multomaculata multomaculata—China: Guangdong: no specific locality: CHS760; Nan’aodao: CHS580; Hainan:
Haikou: CHS112. Indonesia: “N. Celebes” [in error]: ZMB 7470; Java: no specific locality: NK 2078, RMNH 978(2),
979(1–6), SMF 19672, ZMB 2640–44, 4851, 7149, 75944; Djakarta: MNHN 0974, 3881, 1864.0050; Provinz Jawa Barat,
Bogor: SMF 19670–71; Samarang: RMNH 978(1), ZMB 14348, 90183. Thailand: Kanchanburi: Thong Pha Phum: PT3083;
Petchaburi: near Nong Ya Plong: PT3484–85; Ban Thung Kham: MNHN 1998.0519; Tak: near Tak: PT3084; between Bangkok
and Chanthaburi: MNHN 1985.392. Vietnam: no specific locality: MNHN 1911.102; Bana Nature Reserve: MNHN
1997.4368; Lai Châu: no specific
locality: MNHN 1935.95; Lào Cay: Haut Tonkin: MNHN 1902.83; Bông-Miêu: MNHN 97-428-4551/2526-6/3;
Tonkin: Pointe Pagode: MNHN 1911.46; Tam Dao: MNHN 1935.96.
Boiga multomaculata ochracea—Bangladesh: Chittagong: Chittagong: CAS 95252; Chittagong Uni Campus: CUZ 31, 37.
India: Mizoram: no specific locality: HT R 190, 224, 230–31; Dampa Tiger Reserve, 414 m: WIIADR 1156; Nagaland:
Kohima–Meluri road, 650 m: WIIADR 856. Laos: Louangphrabang: Ban Nammadao: NME R 499/06; Pak Gaeng Noi, Louang
Prabang, 1200 m: NME R 0733/12, 0948/13; Vientiane: Phon Khoun, ca. 40 km SE of Ban Nammadao, 1100 m: NME R
0499/06. Myanmar: Ayeyarwady: near Kan Ywa: SMF 103792, 103827; outskirts of Pantanaw: SMF 103826; Bago: Bago:
BMNH 1946.1.12.60–61; Chin: Min Dat Township, Nat Ma Taung National Park: CAS 220037; Kayin: Hakha, Chin hill:
BNHS 1780; Magwe: Gangaw Township, Mauk village: CAS 243048, 243030; near Taungdwingyi: SMF 104722; Mandalay:
Kyaukpadaung Township, near Myauk Taw Village: CAS 210680; Kyaukse: CAS 205049; Meiktila: ZSIK 13250; Tha Baik Kyin
Township, Shwe U Daung Wildlife Sanctuary, Kyauk Kyi Village, 22 59 06.8 N, 96 06 40.3 E: CAS 216182; Mon: Kawkareik:
BNHS 1778; Rakhine: An Township, Singaung village: CAS 240123; Pleasant Beach Resort: CAS 205002; Sagaing: no specific
locality: CAS 215542; Alaungdaw Kathapa National Park, Thaipeitsae (Log Cabin Camp: CAS 215603; Yin Ma Bin Township,
Yinpaungtaing Village: CAS 215390; Tanguyi: no specific locality: BNHS 1781; Tanintharyi: Yebyu Township, Yepone village:
CAS 243733; Yangon: Mingalardon Township, Hlawga Wildlife Park: CAS 213324; Yangon: CAS 210834; Thanlyin: SMF
KÖHLER
192 · Zootaxa 5270 (2) © 2023 Magnolia Press
104138; Thanlyin, near East Yangon University: PaPa 008. Thailand: Loei: Phu Luang: ZMB 55191; Nan: near Ban Khueng:
PT1711; near Ban Mon: PT2316.
Boiga multomaculata septentrionalis—India: Nagaland: Kohima–Meluri Road: WIIADR 856; Sivasagar: ZSIK 7933.
Myanmar: Kachin: Bhamo: BMNH 1889.3.25.37–39, MNHN 1893.0412, ZMH R09334; Moenyin Township, Indawgyi Lake
Wildlife Sanctuary, E of Nat Mouk Kan village: CAS 241150, 241272, 241550; Sagaing: Khandi Township, Linpha village:
SMF 106288.
—Bhutan: Chukha: Phuntsholing: NMB 22730; Zhemgang: near Manas: WIIADR 858. India: Arunachal
Pradesh: Dirang: no reg. no.; N.E. Bengal: no specific locality: ZSIK 12565; India: West Bengal: Darjeeling: BMNH 72.4.17.119,
72.4.17.386, 94.12.31.55, ZMB 10335, ZSIK 7869, 7873, 7878, 8476, 11367; Goalpara: ZSIK 7932; Kurseong: BNHS 1781,
2745 (1–2); Mal Dist. Doars, N. Bengal: BMNH 1936.7.6.16–19; near Darjeeling: BMNH 1909.3.9.13; Sureil (near Mirik)
Darjeeling: ZSIK 15207, 17297; Tindharia: BNHS 1772–73, 1780; Phubeseng, Darjeeling district: BNHS 1774, 1778. Nepal:
Bagmati: Bhadgaon: CAS 90726; Ichangu, Kathmandu: NHMK 3 (unregistered); Kulekhani, Makwanpur District: NHMK 1–2
(unregistered); Swoyambhu, Kathmandu: NHMK 17B-0119; Naudanda-Serachaur, District Kaski, Zone Gandaki: ZMB 73660;
Pyaudi, District Kaski, Zone Gandaki: ZMB 73661; Serachaur, District Kaski, Zone Gandaki: ZMB 73662.
APPENDIX 2. GenBank accession numbers of specimens included in the molecular analyses. Sequences generated in
this study are marked with an asterisk (Genbank accession number to be included).
Species Voucher CYTB ND4 16S c-mos
Boiga barnesii RAP 0452 KC347469 KC347499 KC347345 -
Boiga beddomei CESS 387 MT733290 MT733317 MT734904 -
Boiga beddomei CESS 417 MT733291 MT733318 MT734905 -
Boiga beddomei CESS 418 MT733292 MT733319 MT734906 -
Boiga beddomei CESS 444 MT733294 MT733321 MT734908 -
Boiga cyanea SMF 103893 ON932767* ON932766* ON782358* -
Boiga dendrophila annectens FMNH 230060 - - - MN962087
LSUHC 7295 KX660482 KX660608 KX660210 -
Boiga multomaculata CAS 205002 - - - MN962143
Boiga multomaculata CAS 215390 - - - MN962144
Boiga multomaculata CAS 215542 ON932768* ON932753* ON782359* -
Boiga multomaculata CAS 215603 ON932769* ON932752* ON782360* -
Boiga multomaculata CAS 216182 ON932770* ON932751* ON782361* -
Boiga multomaculata CAS 241150 ON932772* ON932765* ON782359* -
Boiga multomaculata CAS 241272 ON932773* ON932764* ON782360* -
Boiga multomaculata CAS 241550 ON932774* ON932763* ON782361* ON805810*
Boiga multomaculata CAS 243030 ON932775* ON932749* ON782362* ON805809*
Boiga multomaculata CAS 243048 ON932776* ON932762* ON782363* ON805808*
Boiga multomaculata CAS 243733 ON932777* ON932761* ON782364* -
Boiga multomaculata NK2078 ON932778* ON932759* ON782365* -
Boiga multomaculata PaPa 008 ON932779* ON932757* ON782366* -
Boiga multomaculata PT1711 ON932780* ON932758* ON782367* -
Boiga multomaculata PT2316 ON932781* ON932756* ON782368* -
Boiga multomaculata PT3083 ON932782* ON932755* ON782369* -
Boiga multomaculata PT3084 ON932783* ON932754* ON782370* -
Boiga multomaculata SMF 103792 ON932784* ON932760* ON782371* -
Boiga multomaculata SMF 103826 ON932785* ON932748* ON782372* -
......continued on the next page
REVISION OF Zootaxa 5270 (2) © 2023 Magnolia Press · 193
APPENDIX 2. (Continued)
Species Voucher CYTB ND4 16S c-mos
Boiga multomaculata SMF 103827 ON932786* ON932747* ON782373* -
Boiga multomaculata SMF 104722 ON932787* ON932746* ON782374* -
Boiga multomaculata SMF 106288 ON932771* ON932750* ON782362* ON805811*
Boiga multomaculata WIIADR 856 ON932788* - ON782379* -
Boiga multomaculata ZISP 32537 - - - MN962139
Boiga multomaculata ZISP 32539 - - - MN962140
Boiga nigriceps ZISP 25392 - - - MN962141
Boiga nigriceps ZISP 25393 - - - MN962142
Boiga nuchalis CESS 094 MT733277 MT733304 MT734890 -
Boiga nuchalis CESS 192 MT733282 MT733308 MT734895 -
Boiga nuchalis CESS 270 MT733285 MT733311 MT734898 -
Boiga nuchalis CESS 310 MT733288 MT733314 MT734901 -
Boiga nuchalis CESS 315 MT733289 MT733316 MT734903 -
Boiga nuchalis CESS 504 MT733295 MT733322 MT734909 -
Boiga philippina KU 304855 - - - MN962145
Boiga philippina KU 327777 - - - MN962146
Boiga quincunciata CAS 221434 KX660451 KX660579 KX660177 -
Boiga quincunciata CAS 224439 - - - MN962147
Boiga quincunciata CAS 235862 KX660450 KX660578 KX660176 -
Boiga siamensis CAS 215627 KX660449 KX660577 KX660175 -
Boiga siamensis CAS 215635 - - - MN962149
Boiga siamensis LSUHC 8502 KX660487 KX660612 KX660215 -
Boiga siamensis LSUHC 8527 KX660488 KX660613 KX660216 -
Boiga siamensis ZISP 32742 - - - MN962150
WIIADR 858 OQ079990* OQ079991* OQ078743* -
Boiga tanahjampeana ZISP 21938 - - - MN962151
Boiga tanahjampeana ZISP 21942 - - - MN962153
Boiga tanahjampeana ZISP 21943 - - - MN962154
Boiga trigonata LSUMZ 6964 - - - MN962155
Boiga trigonata LSUMZ 6965 - - - MN962156
Boiga trigonata LSUMZ 6966 - - - MN962157
Boiga trigonata RS 143 KC347475 KC347515 KC347349 -
Boiga whitakeri CESS 255 MT733284 MT733310 MT734897 -
Telescopus tripolitanus BEV 9377 JX315531 MK373166 MK372141 MK373205
