Poisoning of Mitochondrial Topoisomerase I by Lamellarin D

Abstract

Lamellarin D (Lam-D) is a hexacyclic pyrole alkaloid isolated from marine invertebrates whose biological properties have been attributed to mitochondrial targeting. Mitochondria contain their own DNA (mtDNA), and the only specific mitochondrial topoisomerase in vertebrates is mitochondrial topoisomerase I (Top1mt). Here, we show that Top1mt is a direct mitochondrial target of Lam-D. In vitro Lam-D traps Top1mt and induces Top1mt cleavage complexes (Top1mtcc). Using single molecule analyses we also show that Lam-D slows down supercoil relaxation of Top1mt and strongly inhibits Top1mt religation in contrast to the inefficacy of camptothecin on Top1mt. In living cells, we show that Lam-D accumulates rapidly inside mitochondria, induces cellular Top1mtcc and leads to mtDNA damage. This study provides evidence that Top1mt is a direct mitochondrial target of Lam-D and suggests that developing Top1mt inhibitors represent a novel strategy for targeting mitochondrial DNA.

Full text

1521-0111/86/2/193–199$25.00 http://dx.doi.org/10.1124/mol.114.092833
MOLECULAR PHARMACOLOGY Mol Pharmacol 86:193–199, August 2014
U.S. Government work not protected by U.S. copyright
Poisoning of Mitochondrial Topoisomerase I by Lamellarin D
Salim Khiati, Yeonee Seol, Keli Agama, Ilaria Dalla Rosa, Surbhi Agrawal, Katherine Fesen,
Hongliang Zhang, Keir C. Neuman, and Yves Pommier
Developmental Therapeutics Branch and Laboratory of Molecular Pharmacology, Center for Cancer Research, National Cancer
Institute (S.K., K.A., I.D.R., S.A., K.F., H.Z., Y.P.) and Laboratory of Molecular Biophysics, National Heart, Lung, and Blood
Institute (Y.S., K.C.N.), National Institutes of Health, Bethesda, Maryland
Received March 21, 2014; accepted May 28, 2014
ABSTRACT
Lamellarin D (Lam-D) is a hexacyclic pyrole alkaloid isolated
from marine invertebrates, whose biologic properties have been
attributed to mitochondrial targeting. Mitochondria contain their
own DNA (mtDNA), and the only specific mitochondrial topo-
isomerase in vertebrates is mitochondrial topoisomerase I
(Top1mt). Here, we show that Top1mt is a direct mitochondrial
target of Lam-D. In vitro Lam-D traps Top1mt and induces Top1mt
cleavage complexes (Top1mtcc). Using single-molecule analyses,
we also show that Lam-D slows down supercoil relaxation of
Top1mt and strongly inhibits Top1mt religation in contrast to the
inefficacy of camptothecin on Top1mt. In living cells, we show that
Lam-D accumulates rapidly inside mitochondria, induces cellular
Top1mtcc, and leads to mtDNA damage. This study provides
evidence that Top1mt is a direct mitochondrial target of Lam-D
and suggests that developing Top1mt inhibitors represents
a novel strategy for targeting mitochondrial DNA.
Introduction
The contribution of mitochondria to cellular functions
extends beyond their critical bioenergetics role in the form
of ATP production. Indeed, they also control cell death by
apoptosis, generate critical metabolites for macromolecular
synthesis, and regulate divalent metal pools. Mitochondrial
dysfunctions have been linked to a wide range of neuro-
degenerative and metabolic diseases, cancers, and aging
(Greaves et al., 2012). Mitochondria are the only cellular
organelle containing metabolically active DNA, other than the
nucleus (Chinnery and Hudson, 2013). The mammalian
mitochondrial genome (mtDNA) consists of circular DNA
molecules with 16,569 base pairs encoding 13 essential
polypeptides for complexes I, III, and IV of the mitochondrial
oxidative phosphorylation chain. It also encodes indispens-
able components for mitochondrial translation: 22 tRNAs and
two ribosomal RNAs (12S and 16S rRNAs for mitoribosomes).
The only noncoding region of mtDNA is a small regulatory
region (∼5% of the genome) with critical elements for
transcription (promoters for both strands) and replication
(origin of replication). Because mtDNA is essential for
mitochondria (Chinnery and Hudson, 2013), its targeting
with drugs offers potential for new therapeutics, as well as
molecular tools to study mtDNA homeostasis and their effects
on mitochondria (Rowe et al., 2001; Neuzil et al., 2013;
Olszewska and Szewczyk, 2013).
Given that mtDNA consists of relatively small DNA
circles with bidirectional transcription and replication, and
organization in nucleoids anchored to the mitochondrial
inner membrane, it is logical to assume that mitochondrial
topoisomerases are critical to ensure mtDNA replication
and transcription. To date, three topoisomerases have been
identified in vertebrate mitochondria: Top1mt (Zhang
et al., 2001), Top2b(Low et al., 2003), and Top3a(Wang
et al., 2002). Unlike TOP2Β(Low et al., 2003) and TOP3Α,
TOP1mt is the only topoisomerase gene coding for a single
polypeptide solely targeted to mitochondria (Zhang et al.,
2001; Chinnery and Hudson, 2013). In addition to studying
Top1mt’s roles in regulating mtDNA replication (Zhang
and Pommier, 2008), transcription (Sobek et al., 2013), and
mtDNA integrity (Medikayala et al., 2011), it has become
possible to examine Top1mt functions genetically. Murine
embryonic fibroblasts generated from TOP1mt knockout
mice exhibit mitochondrial defects with marked increase in
reactive oxygen species production, calcium signaling,
hyperpolarization of mitochondrial membranes, and in-
creased mitophagy (Douarre et al., 2012).
Topoisomerases relax DNA supercoils by breaking the DNA
backbone and forming transient catalytic enzyme-linked DNA
breaks, which are referred to as cleavage complexes (Pommier
et al., 2010; Pommier and Marchand, 2012; Pommier, 2013). The
DNA-damaging effects and therapeutic activity of topoisomerase
inhibitors result from the trapping of topoisomerase cleavage
complexes by the binding of the inhibitors at the enzyme-DNA
interface rather than by catalytic inactivation of the enzymes
(reviewed in Nitiss and Wang, 1988; Pommier et al., 2010, 2013).
This work was supported by the Intramural Research Program of the
National Institutes of Health National Cancer Institute, Center of Cancer
Research [Z01 BC006161] and the National Heart, Lung, and Blood Institute.
dx.doi.org/10.1124/mol.114.092833.
ABBREVIATIONS: CPT, Camptothecin; ICE, immuno-complex of enzyme; Lam-D, lamellarin D; mtDNA, mitochondrial DNA; NCI_H23,
adenocarcinoma, human non–small cell lung cancer; SK-MEL-5, human skin melanoma cell line; Top1, topoisomerase I; Top1cc, Top1 cleavage
complexes; Top1mt, mitochondrial topoisomerase I; Top1mtcc, mitochondrial topoisomerase I cleavage complexes; Tw, twist density.
193
at ASPET Journals on February 21, 2015molpharm.aspetjournals.orgDownloaded from

Camptothecin (CPT) and its clinical derivatives (topotecan
and irinotecan) kill cancer cells by selectively trapping
(poisoning) nuclear topoisomerase I (Top1) (Hsiang et al.,
1985; Nitiss and Wang, 1988; Pommier et al., 2010;
Pommier and Marchand, 2012). Although DNA topoisom-
erases are among the most effective targets for antican-
cer and antibacterial agents (Pommier et al., 2010), no
drug has been shown to target mitochondrial topoisom-
erases, and camptothecins are inefficient Top1mt inhib-
itors, as they are rapidly inactivated in the mitochondrial
pH environment (Burke and Mi, 1994; Zhang et al., 2001;
Pommier et al., 2010) and require high drug concentrations to
target Top1mt (Zhang et al., 2001; Seol et al., 2012), which
otherwise extensively damage the nuclear genome (Hsiang et al.,
1985; Covey et al., 1989).
The purpose of the present study was to determine whether
lamellarin D (Lam-D; Fig. 1A) could poison Top1mt in
biochemical and cellular systems. Lamellarins (Bailly, 2004;
Pla et al., 2008) are hexacyclic pyrole alkaloids originally
isolated from marine invertebrates (genus Lamellaria); they
can also be obtained by total chemical synthesis (Li et al.,
2011). Lam-D is among the most cytotoxic molecules in the
series (Bailly, 2004). Its proapoptotic activity has been
associated with the generation of DNA breaks resulting from
the trapping of nuclear topoisomerase I [Top1-DNA covalent
complexes (Top1cc) (Facompre et al., 2003)]. However, Lam-D
has also been shown to directly target mitochondria (Kluza
et al., 2006; Ballot et al., 2009; Ballot et al., 2010), suggesting
that it may poison Top1mt and could act as a potential drug
targeting mtDNA by trapping Top1mt. In this study we
investigated the effects of Lam-D on Top1mt using in vitro
and in vivo DNA cleavage assays in addition to single-
molecule supercoil relaxation measurements. We found that
Lam-D indeed inhibits Top1mt by trapping the cleavage
complex efficiently, in striking contrast to the inefficacy
of CPT. More importantly, our study reveals that Lam-D
accumulates preferentially inside the mitochondria and ef-
ficiently induces Top1mtcc, resulting in mtDNA damage in
treated cells.
Materials and Methods
Mitochondrial Topoisomerase I-Mediated DNA Cleavage
Reactions. Human recombinant Top1 was purified from baculovirus
as previously described (Pourquier et al., 1999; Seol et al., 2012), and
Top1mt was expressed and purified in the same manner. DNA
Fig. 1. Lamellarin D induces Top1mt-mtDNA
cleavage complexes in vitro. (A) Chemical structure
of Lam-D. (B) Comparison of Top1mt cleavage
complex sites induced by Lam-D and CPT in a
39-end-labeled 117-bp oligonucleotide rich in Top1
sites. Lane 1: DNA alone; Lane 2: Top1mt alone;
Lane 3: Top1mt + CPT 1 mM; Lanes 4–6: Top1mt +
0.1, 1, and 10 mM Lam-D, respectively. Numbers
and arrows on the left indicate cleavage site
positions (see Materials and Methods). (C) Lam-D
inhibits Top1mtcc religation. The same oligonucle-
otide was reacted with Top1mt in the presence of
1mM CPT or Lam-D at 25°C for 20 minutes. DNA
cleavage was reversed by adding 0.35 M NaCl and
monitored over time. Numbers and arrows on the
left indicate cleavage site positions.
194 Khiati et al.
at ASPET Journals on February 21, 2015molpharm.aspetjournals.orgDownloaded from

cleavage reactions were prepared as previously reported with the
exception of the DNA substrate (Dexheimer and Pommier, 2008).
Briefly, a 117-bp DNA oligonucleotide contains a single 59-cytosine
overhang, which was 39end-labeled by fill-in reaction with [
32
P]-dGTP
in NEBuffer 2 (New England BioLabs Inc., Ipswich, MA) with 0.5
units of DNA polymerase I (New England BioLabs).
For reversal experiments, the addition of SDS was preceded by the
addition of NaCl (final concentration of 0.35 M at 25°C for the
indicated times). Aliquots of each reaction mixture were subjected to
20% denaturing PAGE. Gels were dried and visualized by using
a phosphorimager and ImageQuant software (Molecular Dynamics/
GE Healthcare Life Sciences, Pittsburgh, PA). For simplicity,
cleavage sites were numbered as previously described in the 161-bp
fragment (Pourquier et al., 1999).
Single-Molecule Measurement and Analysis. Generation of
23-kb coilable DNA and sample preparation were done as previously
described (Seol et al., 2012). Measurements of supercoil relaxation by
Top1mt (50–500 pM) were performed in topoisomerase buffer [10 mM
Tris, pH 8, 50 mM KCl, 10 mM MgCl
2
, 0.3% w/v bovine serum albumin
(BSA), 0.04% Tween-20, 0.1 mM EDTA, and 5 mM dithiothreitol
(DTT)] with varying Lam-D concentrations (1–10 mM) and DNA twist
density (–0.008, 0.008, 0.016, and 0.032). DNA twist density (Tw)is
controlled via the force applied on the magnetic bead (Seol et al.,
2012). The overall Top1mt activity was measured by tracking the
height of the tethered bead at 100 Hz (Seol et al., 2012). The rates of
supercoil relaxation by Top1mt were obtained by analyzing the DNA
extension change using custom-written software (Seol et al., 2012).
The slow relaxation-rate probability was determined by calculating
the fraction of rates that were less than 30% of the mean rate obtained
in the absence of Lam-D for a given DNA twist density. The religation
inhibition probability was quantified from the ratio of futile to
productive supercoiling attempts, i.e., the fraction of events for which
there was no change in DNA linking-number difference (DL
k
) when
the magnets were rotated.
Confocal Microscopy in Live Cells. Human skin melanoma
cells (SK-MEL-5) growing on chamber slides (Nalge Nunc International/
Thermo Scientific, Rochester, NY) were incubated in medium con-
taining 100 nM MitoTracker Red 580 (Molecular Probe, Eugene,
Oregon) at 37°C for 1 hour. Lam-D (1 mM) was added and fluorescent
signals were accessed after 5–30 minutes under confocal microscope
(Zeiss 710). Images were collected and processed using the Zeiss
AIM software and fluorescence quantification was performed using
ImageJ software.
Detection of Top1 and Top1mt Cleavage Complexes by
Immuno Complex of Enzyme Bioassay. Cells (5 10
5
per well in
six-well plate) were grown for 1–2 days (70–80% confluence). After
treatments, cells were lysed by adding to each culture well 0.6 ml of
lysis buffer (6 M Guanidinium Thiocyanate, 10 mM Tris-HCL, pH 6.5,
20 mM EDTA, 4% Triton 100, 1% sarosyl, and 1% DTT). Lysates
were transferred to Eppendorf tubes and mixed with 0.4 ml of 100%
ethanol. After incubation at –20°C for 5 minutes, tubes were
centrifuged for 15 minutes. Supernatants were discarded and pellets
washed two times with 0.8 ml of 100% ethanol. Pellets were dissolved
in 0.2 ml 8 mM NaOH (freshly made) and sonicated for 10–20 seconds
at 20% power. For immunodetection, equal volumes and concen-
trations of isolated DNA were transferred to 96-well plates and
serially diluted with 8 mM NaOH. At least 100 ml of DNA solution
were applied to polyvinylidene difluoride membranes with a slot blot
apparatus. After 1 hour blocking with 5% milk in PBST (phosphate-
buffered saline, Tween-20 0.1%), membranes were incubated over-
night with Top1mt antibody (Douarre et al., 2012) or (nuclear) Top1
antibody (#556597; BD Biosciences, San Jose, CA) (Antony et al.,
2007). After three washes in PBST, membranes were incubated
with horseradish peroxidase–conjugated goat anti-mouse (1:5000
dilution) antibody (Amersham Biosciences, Piscataway, NJ) for
1 hour and washed three times. Immunoblots were detected using
enhanced chemiluminescence detection kit (Thermo Scientific,
Rockford, IL).
Quantification of mtDNA Damage. Mitochondrial DNA dam-
age was quantified by long-range polymerase chain reaction (PCR)
(Hunter et al., 2010) from total DNA isolated from whole cell after
treatment. A 10-Kb fragment and a shorter region of mtDNA (117 pb)
were amplified. PCR reactions were limited to 14 and 16 cycles, to
ensure that amplification process was still in the exponential phase.
The damage index is determined by the ratio P/Q of long-range PCR
product (P) by the short-range PCR product (Q). Primer sequences
used for mtDNA analysis are:
Results
Induction of Top1mt Cleavage Complexes by Lamel-
larin D. To determine whether Lam-D could target Top1mt,
we tested cleavage complex formation with recombinant
Top1mt using a 117-base-pair
32
P-39-end-labeled DNA oligo-
nucleotide substrate (Zhang et al., 2001; Antony et al., 2007).
Figure 1 demonstrates the induction of Top1mt cleavage
complexes by Lam-D. The cleavage sites were common to
those trapped by CPT. Yet, Lam-D showed differential
intensity at some sites (such as sites 70 and 106 in Fig. 1),
which is most probably related to the structural difference
between the polycyclic ring drug structures that intercalate at
the break sites (Stewart et al., 1998; Ioanoviciu et al., 2005).
These results demonstrate that Lam-D can effectively target
Top1mt cleavage complexes at submicromolar concentrations.
Lamellarin D Inhibits Top1mt Cleavage Complex
Religation and Supercoil Relaxation. To determine
whether Lam-D enhances Top1mt cleavage complexes by
inhibiting DNA religation, we first measured the reversal to
Top1mt cleavage complexes after addition of salt, which shifts
the nicking-religation activity of Top1 toward religation
(Tanizawa et al., 1994). To do so, we followed the reversal
kinetics of site 92 (Fig. 1C), using CPT as positive control as it
is known to enhance Top1 cleavage complexes by religation
inhibition because of its binding at the Top1-DNA interface
(Hsiang et al., 1985; Tanizawa et al., 1994; Stewart et al.,
1998; Ioanoviciu et al., 2005). The religation kinetics of site 92
was similar for Lam-D and CPT indicating that Lam-D traps
Top1mt and inhibits religation.
In line with this, we performed single-molecule measure-
ments of Top1mt to test the effect of Lam-D on supercoil
relaxation activity (Fig. 2A). The single-molecule supercoil
relaxation assay has proven to be a useful tool to test the
efficacy of topoisomerase inhibitors, since individual steps in
the topoisomerase reaction cycle and changes in these steps
upon inhibition by topoisomerase inhibitors such as CPT can
be monitored in detail (Koster et al., 2007; Seol et al., 2012).
In our assay, a 23-kb DNA tether was formed by attaching
one end of the DNA to the surface of a flow cell via multiple
digoxigenin-antidigoxigenin linkages and the other end to a
1-mm magnetic particle via multiple biotin-streptavidin link-
ages. By rotating small magnets above the flow cell, the DNA
can be supercoiled (change in linking number: DL
k
), resulting
in a decrease in the extension as plectonemes form in the DNA
(Fig. 2A). Supercoil relaxation by Top1mt was observed
through the increase in DNA extension. Relaxation rates
Long range PCR: 59-TCTAAGCCTCCTTATTCGAGCCGA-39and
59- TTTCATCATGCGGAGATGTTGGATGG -39
Short range PCR: 59-AAGTCACCCTAGCCATCATTCTAC-39and
59- GCAGGAGTAATCAGAGGTGTTCTT-39
Poisoning of Mitochondrial Topoisomerase I by Lamellarin D 195
at ASPET Journals on February 21, 2015molpharm.aspetjournals.orgDownloaded from

were quantified by a linear fit over the region where DNA
extension increases.
To determine the effects of Lam-D on Top1mt, we performed
DNA supercoil relaxation assays with Top1mt under varying
concentrations of Lam-D (0–10 mM) and Tw (–0.008, 0.008,
0.016, and 0.032). Varying Tw allows us to investigate the effect
of Lam-D for different topological states potentially present in
vivo. We observed two aspects of Lam-D effect on Top1mt
activity: a significant decrease in supercoil relaxation rate (Fig.
2B), which was identified as one of the signature effects of CPT
on nuclear topoisomerase (Koster et al., 2007), and religation
inhibition, i.e., events for which the DNA could not be super-
coiled upon rotating the magnets (Fig. 2B).
We quantified the effect on Top1mt attributable to Lam-D by
calculating the probabilities of religation inhibition and slow-
relaxation rate (see Materials and Methods).AsshowninFig.
2C, the religation inhibition probability generally increased as
DNA twist density increased, whereas the probability of slow
relaxation was more pronounced at lower twist density, in-
dicating that Tw modulates the effect of Lam-D on Top1mt
(Gentry et al., 2011). Surprisingly, the degree of Top1mt
inhibition at 1-mM Lam-D was similar to that higher concen-
trations, suggesting robust inhibition efficacy of Lam-D in
contrast to the poor inhibition efficiency of CPT (Seol et al.,
2012). Together, the gel-based religation assays (Fig. 1C) and
the single-molecule measurements (Fig. 2) demonstrate that
Lam-D interferes with Top1mt activity both by inhibiting
the religation of cleavage complexes and impeding the DNA
unwinding activities of Top1mt over a broad range of DNA
twist density.
Lamellarin D Accumulates Rapidly in Mitochondria
and Poisons Top1mt in Cells. To determine whether Lam-D
can directly target Top1mt in cells, we took advantage of the
fact that Lam-D is intrinsically fluorescent. This enabled us to
investigate the intracellular distribution of Lam-D in live cells
by confocal microscopy. After Lam-D treatment of SK-MEL-5
melanoma cells, which we chose for this study because they
possess large mitochondria, we observed prominent Lam-D
cytoplasmic staining coinciding with mitochondria (Fig. 3).
Localization of Lam-D to mitochondria was verified by co-
localization with the mitochondria-specific dye MitoTracker
(Fig. 3A, top panels). As shown in the magnified image
(bottompanel,Fig.3A),andinthe correlation between the
pixel intensities along a line in the two channels (Fig. 3B),
the fluorescent intensity distribution of Lam-D coincides with
that of mitochondria. These results demonstrate that Lam-D
penetrates and accumulates preferentially in mitochondria
within 5–30 minutes of drug exposure.
Next, we tested the trapping of Top1mt cleavage complexes
in Lam-D-treated cells using the ICE assay (immuno-complex
of enzyme assay). This technique allows the detection of
topoisomerases covalently linked to DNA by immunoblotting
after isolation of cellular DNA (Subramanian et al., 1995;
Takebayashi et al., 1999; Antony et al., 2007). After Lam-D
treatment, Top1mt signals were observed in both SK-MEL-5
melanoma cells and NCI_H23 lung cancer cells (Fig. 4, A and B,
Fig. 2. Lamellarin D inhibits Top1mt cleavage-complex religation and
hinders supercoil relaxation as determined by single-molecule analysis. (A)
Top panel: Schematic of the single-molecule assay with the 23-kb DNA tether
(blue), 1-mm magnetic particle (brown sphere), and recombinant Top1mt (red).
Bottom panel: example trace of Top1mt supercoil relaxation, which is observed
through an increase in DNA extension (blue arrow). Brown lines represent the
mechanical coiling of DNA. The resulting extension change is shown by dashed
lines. Relaxation rates were quantified by a linear fit over the region where
DNA extension increases (blue dashed lines). (B) DNA supercoil relaxation by
Top1mt in the absence (top panel) or presence of Lam-D at 1 mM(twomiddle
panels) and 10 mM (bottom panel). Lam-D interaction with Top1mt resulted in
periods of slow supercoil relaxation (red dashed lines) and periods of religation
inhibition (indicated by red arrows). (C) Quantification of religation (top panel)
and slow relaxation probabilities (bottom panel) under varying conditions of
DNA supercoil twist density and Lam-D concentration.
196 Khiati et al.
at ASPET Journals on February 21, 2015molpharm.aspetjournals.orgDownloaded from

respectively). The induction of Top1mt-mtDNA complexes
by Lam-D was concentration- and time-dependent; time-course
analysis showed that Lam-D induced Top1mt-mtDNA com-
plexes within 1 hour (Fig. 4C), which is consistent with the
rapid accumulation of Lam-D in mitochondria (Fig. 3 and
above). We also tested whether trapping of Top1mt-mtDNA
cleavage complexes by Lam-D damaged mtDNA using long-
range PCR, a well-established method to evaluate mtDNA
damage (Das et al., 2010). Accordingly, we observed a Lam-D
concentration-dependent reduction in long-range PCR product
(Fig. 4, D and E), confirming the damaging effect of Lam-D on
mtDNA.
Because Lam-D has previously been shown to also trap
nuclear Top1 (Facompre et al., 2003), we compared the
relative activity of Lam-D on the mitochondrial versus
nuclear genome. For this, we took advantage of the fact that
our Top1mt antibodies do not cross-react with nuclear Top1,
and that the monoclonal C21 Top1 antibody does not cross-
react against Top1mt (Fig. 4F). Figure 4, G and H, shows that
Lam-D is more potent at trapping Top1mt-mtDNA cleavage
complexes than camptothecin (Fig. 4G). On the other hand,
CPT is more potent at trapping nuclear Top1 than Lam-D
(Fig. 4H), which is consistent with lower accumulation of
Lam-D in the cell nucleus than in mitochondria (see Fig. 3 and
above).
Discussion
Cells typically contain hundreds to thousands of copies of
mtDNA. Replication of mtDNA is independent of nuclear
DNA synthesis and occurs throughout all phases of the
cell cycle including in postmitotic cells (Clayton, 1991). DNA
polymerase gamma and mitochondrial transcription factor A
are two essential proteins for replication and maintenance
of mammalian mtDNA. Some drugs have been reported to
deplete mitochondrial DNA by interfering with mitochon-
drial DNA polymerase gamma activity (Rowe et al., 2001;
Neuzil et al., 2013). Top1mt is also important for mitochon-
drial homeostasis (Douarre et al., 2012), mtDNA replication
(Zhang and Pommier, 2008), mtDNA transcription (Sobek
et al., 2013), and mtDNA integrity (Medikayala et al.,
2011). Yet, there are no drugs known to specifically target
Top1mt.
In this study, we provide evidence that Lam-D targets and
efficiently inhibits Top1mt by trapping the normally transient
Top1mt-DNA cleavage complexes. Trapping of Top1mt cleav-
age complexes was observed in both biochemical (Figs. 1 and 2)
and cellular assays (Fig. 4). Furthermore, confocal imaging dem-
onstrates that Lam-D accumulates rapidly (5–30 minutes) in
mitochondria (Fig. 3), consistent with Lam-D-induced mito-
chondrial alterations (Kluza et al., 2006; Ballot et al., 2009;
Ballot et al., 2010). In particular, Ballot et al. described a
Lam-D-induced mitochondrial cascade involving: inhibition of
complex III, decreased zeta potential, swelling of mitochondrial
matrix, and apoptosis. Our work reveals that Top1mt is a new
direct mitochondrial target of Lam-D.
The general mechanism of inhibition of Top1mt by Lam-D
appears to be similar to that of CPT. Yet, the detailed
molecularinteractionsappeartodiffersomewhatasthe
sequence-dependent cleavage patterns between CPT and
Lam-D show differences (Fig. 1), and Lam-D is a more robust
inhibitor of Top1mt compared with CPT (Fig. 2) (Seol et al.,
2012). Although a significant decrease in supercoil relaxation
rate was identified as a signature aspect of CPT inhibition of
nuclear Top1 (Koster et al., 2007; Seol et al., 2012), our study
reveals that religation inhibition by Lam-D is not absolutely
associated with a decrease in supercoil relaxation rate (Fig. 2).
This implies that DNA damage attributable to topoisomerase
I inhibition may not always be associated with hindering
positive supercoil relaxation and subsequent accumulation of
positive supercoils, as previously suggested (Koster et al.,
2007; Ray Chaudhuri et al., 2012).
Nuclear Top1 has proven to be a successful target for
anticancer drugs. Indeed, accumulation of Top1cc after Top1-
inhibitor treatment leads to DNA lesions and ultimately
triggers apoptosis and cell death (Hsiang et al., 1985; Covey
et al., 1989; Tanizawa et al., 1994; Pommier et al., 2010, 2013).
In our study we show that treating cells with Lam-D results in
both the trapping of Top1mt on, and significant damage to,
mtDNA (Fig. 4). These findings suggest a direct role of Top1mt
trapping in the generation of mtDNA damage as an alterna-
tive, or in addition, to damage resulting from mitochondrial
defects reported by Ballot et al. (2009, 2010).
Several studies have demonstrated that mtDNA muta-
tions are common in cancer (Lu et al., 2009) and numerous
Fig. 3. Lamellarin D accumulates preferentially inside mitochondria. (A)
Representative confocal images demonstrating prominent cytoplasmic
and mitochondrial staining of Lam-D in SK-MEL-5 melanoma cells,
monitored by the intrinsic fluorescence (blue channel, left and right
panels) of Lam-D, which co-localizes with MitoTracker (red channel,
middle and right panels). Right panels show the merged images. The lower
panels are expanded views of the boxed images in the upper panels. (B)
Quantitation of the pixel intensity of fluorescence along with the arrow
indicated in the expanded view of the merged image. The arrow was drawn
arbitrarily over a section of interest.
Poisoning of Mitochondrial Topoisomerase I by Lamellarin D 197
at ASPET Journals on February 21, 2015molpharm.aspetjournals.orgDownloaded from

polymorphisms and mutations of mtDNA correlate with an
increased risk of developing malignancies, including breast
(Canter et al., 2005) and prostate cancers (Petros et al., 2005).
Moreover, recent evidence revealed that mtDNA amounts
regulate response to chemotherapy (Singh et al., 1999; Naito
et al., 2008; Hsu et al., 2010). Different strategies have been
reported for targeting drugs to mitochondria (Heller et al.,
2012; Yousif et al., 2009), including nanoparticles (Marrache
and Dhar, 2012). Recently, the two most used anticancer
agents, cisplatin (Wisnovsky et al., 2013) and doxorubicin
(Chamberlain et al., 2013), have been targeted to mitochon-
drial DNA. The robust Top1mt inhibition activity of Lam-D
displayed in our study suggests that Lam-D can be poten-
tially used as an anticancer reagent targeted to Top1mt in
mitochondria.
In summary, our study demonstrates that the marine
alkaloid lamellarin D is the first drug to target mitochondrial
DNA by trapping Top1mt cleavage intermediates (Top1mt
cleavage complexes) and suggests that developing Top1mt
inhibitors could be an alternative strategy for targeting
mitochondrial DNA.
Acknowledgments
The authors thank Dr. Carmen Cuevas Marchante and José M.
Fernandez Sousa-Faro, PharmaMar, for providing lamellarin D.
Authorship Contributions
Participated in research design: Khiati, Seol, Agama, Dalla Rosa,
Zhang, Neuman, Pommier.
Conducted experiments: Khiati, Seol, Agama, Agrawal, Fesen.
Performed data analysis: Khiati, Seol, Agama, Dalla Rosa, Neuman,
Pommier.
Wrote or contributed to the writing of the manuscript: Khiati, Seol,
Agama, Dalla Rosa, Neuman, Pommier.
Fig. 4. Lamellarin D traps Top1mt in
human cells. (A and B) Top1mt cleavage
complexes in melanoma SK-MEL-5 and
lung carcinoma NCI_H23 cells treated
with Lam-D for 3 hours, respectively. (C)
Time course of Top1mtcc after Lam-D
treatment at 10 mM in SK-MEL-5 cells.
Top1mtcc were detected by ICE bioassay.
(D) Induction of mtDNA damage. Repre-
sentative agarose gel images of mtDNA
long- and short-fragment PCR (Long F
PCR and Short F PCR, respectively) in
SK-MEL-5 cells treated with Lam-D for
24 hours. (E) Quantification of mtDNA
damage using the ratio of the long versus
short fragment PCR products (Tukey’s
multiple comparison test; **P,0.01 and
***P,0.001). (F) Specificity of the
Top1mt and Top1 antibodies demon-
strated by a representative Western blot
with recombinant Top1mt and Top1 blot-
ted with Top1mt antibody (left panel) and
Top1 antibody (right panel). (G) Compar-
ison of Top1mtcc induced by CPT and
Lam-D. (H) Comparison of nuclear Top1cc
induced by CPT and Lam-D under similar
conditions.
198 Khiati et al.
at ASPET Journals on February 21, 2015molpharm.aspetjournals.orgDownloaded from

References
Antony S, Agama KK, Miao ZH, Takagi K, Wright MH, Robles AI, Varticovski L,
Nagarajan M, Morrell A, and Cushman M et al. (2007) Novel indenoisoquinolines
NSC 725776 and NSC 724998 produce persistent topoisomerase I cleavage com-
plexes and overcome multidrug resistance. Cancer Res 67:10397–10405.
Bailly C (2004) Lamellarins, from A to Z: a family of anticancer marine pyrrole
alkaloids. Curr Med Chem Anticancer Agents 4:363–378.
Ballot C, Kluza J, Martoriati A, Nyman U, Formstecher P, Joseph B, Bailly C,
and Marchetti P (2009) Essential role of mitochondria in apoptosis of cancer cells
induced by the marine alkaloid Lamellarin D. Mol Cancer Ther 8:3307–3317.
Ballot C, Kluza J, Lancel S, Martoriati A, Hassoun SM, Mortier L, Vienne JC, Briand
G, Formstecher P, and Bailly C et al. (2010) Inhibition of mitochondrial respiration
mediates apoptosis induced by the anti-tumoral alkaloid lamellarin D. Apoptosis
15:769–781.
Burke TG and Mi Z (1994) The structural basis of camptothecin interactions with
human serum albumin: impact on drug stability. J Med Chem 37:40–46.
Canter JA, Kallianpur AR, Parl FF, and Millikan RC (2005) Mitochondrial DNA
G10398A polymorphism and invasive breast cancer in African-American women.
Cancer Res 65:8028–8033.
Chamberlain GR, Tulumello DV, and Kelley SO (2013) Targeted delivery of doxo-
rubicin to mitochondria. ACS Chem Biol 8:1389–1395.
Chinnery PF and Hudson G (2013) Mitochondrial genetics. Br Med Bull 106:135–159.
Clayton DA (1991) Replication and transcription of vertebrate mitochondrial DNA.
Annu Rev Cell Biol 7:453–478.
Covey JM, Jaxel C, Kohn KW, and Pommier Y (1989) Protein-linked DNA strand
breaks induced in mammalian cells by camptothecin, an inhibitor of topoisomerase
I. Cancer Res 49:5016–5022.
Das BB, Dexheimer TS, Maddali K, and Pommier Y (2010) Role of tyrosyl-DNA
phosphodiesterase (TDP1) in mitochondria. Proc Natl Acad Sci USA 107:
19790–19795.
Dexheimer TS and Pommier Y (2008) DNA cleavage assay for the identification of
topoisomerase I inhibitors. Nat Protoc 3:1736–1750.
Douarre C, Sourbier C, Dalla Rosa I, Brata Das B, Redon CE, Zhang H, Neckers L,
and Pommier Y (2012) Mitochondrial topoisomerase I is critical for mitochondrial
integrity and cellular energy metabolism. PLoS ONE 7:e41094.
Facompré M, Tardy C, Bal-Mahieu C, Colson P, Perez C, Manzanares I, Cuevas C,
and Bailly C (2003) Lamellarin D: a novel potent inhibitor of topoisomerase I.
Cancer Res 63:7392–7399.
Gentry AC, Juul S, Veigaard C, Knudsen BR, and Osheroff N (2011) The geometry of
DNA supercoils modulates the DNA cleavage activity of human topoisomerase I.
Nucleic Acids Res 39:1014–1022.
Greaves LC, Reeve AK, Taylor RW, and Turnbull DM (2012) Mitochondrial DNA and
disease. JPathol 226:274–286.
Heller A, Brockhoff G, and Goepferich A (2012) Targeting drugs to mitochondria. Eur
J Pharm Biopharm 82:1–18.
Hsiang YH, Hertzberg R, Hecht S, and Liu LF (1985) Camptothecin induces protein-
linked DNA breaks via mammalian DNA topoisomerase I. J Biol Chem 260:
14873–14878.
Hsu CW, Yin PH, Lee HC, Chi CW, and Tseng LM (2010) Mitochondrial DNA content
as a potential marker to predict response to anthracycline in breast cancer
patients. Breast J 16:264–270.
Hunter SE, Jung D, Di Giulio RT, and Meyer JN (2010) The QPCR assay for analysis
of mitochondrial DNA damage, repair, and relative copy number. Methods 51:
444–451.
Ioanoviciu A, Antony S, Pommier Y, Staker BL, Stewart L, and Cushman M (2005)
Synthesis and mechanism of action studies of a series of norindenoisoquinoline
topoisomerase I poisons reveal an inhibitor with a flipped orientation in the ter-
nary DNA-enzyme-inhibitor complex as determined by X-ray crystallographic
analysis. J Med Chem 48:4803–4814.
Kluza J, Gallego MA, Loyens A, Beauvillain JC, Sousa-Faro JM, Cuevas C, Marchetti
P, and Bailly C (2006) Cancer cell mitochondria are direct proapoptotic targets for
the marine antitumor drug lamellarin D. Cancer Res 66:3177–3187.
Koster DA, Palle K, Bot ESM, Bjornsti M-A, and Dekker NH (2007) Antitumour
drugs impede DNA uncoiling by topoisomerase I. Nature 448:213–217.
Li Q, Jiang J, Fan A, Cui Y, and Jia Y (2011) Total synthesis of lamellarins D, H, and
R and ningalin B. Org Lett 13:312–315.
Low RL, Orton S, and Friedman DB (2003) A truncated form of DNA topoisomerase
IIbeta associates with the mtDNA genome in mammalian mitochondria. Eur J
Biochem 270:4173–4186.
Lu J, Sharma LK, and Bai Y (2009) Implications of mitochondrial DNA mutations
and mitochondrial dysfunction in tumorigenesis. Cell Res 19:802–815.
Marrache S and Dhar S (2012) Engineering of blended nanoparticle platform for
delivery of mitochondria-acting therapeutics. Proc Natl Acad Sci USA 109:
16288–16293.
Medikayala S, Piteo B, Zhao X, and Edwards JG (2011) Chronically elevated glucose
compromises myocardial mitochondrial DNA integrity by alteration of mitochon-
drial topoisomerase function. Am J Physiol Cell Physiol 300:C338–C348.
Naito A, Carcel-Trullols J, Xie CH, Evans TT, Mizumachi T, and Higuchi M (2008)
Induction of acquired resistance to antiestrogen by reversible mitochondrial DNA
depletion in breast cancer cell line. Int J Cancer 122:1506–1511.
Neuzil J, Dong LF, Rohlena J, Truksa J, and Ralph SJ (2013) Classification of
mitocans, anti-cancer drugs acting on mitochondria. Mitochondrion 13:199–208.
Nitiss J and Wang JC (1988) DNA topoisomerase-targeting antitumor drugs can be
studied in yeast. Proc Natl Acad Sci USA 85:7501–7505.
Olszewska A and Szewczyk A (2013) Mitochondria as a pharmacological target:
magnum overview. IUBMB Life 65:273–281.
Petros JA, Baumann AK, Ruiz-Pesini E, Amin MB, Sun CQ, Hall J, Lim S, Issa MM,
Flanders WD, and Hosseini SH et al. (2005) mtDNA mutations increase tumori-
genicity in prostate cancer. Proc Natl Acad Sci USA 102:719–724.
Pla D, Albericio F, and Alvarez M (2008) Recent advances in lamellarin alkaloids:
isolation, synthesis and activity. Anticancer Agents Med Chem 8:746–760.
Pommier Y (2013) Drugging topoisomerases: lessons and challenges. ACS Chem Biol
8:82–95.
Pommier Y, Leo E, Zhang H, and Marchand C (2010) DNA topoisomerases and their
poisoning by anticancer and antibacterial drugs. Chem Biol 17:421–433.
Pommier Y and Marchand C (2012) Interfacial inhibitors: targeting macromolecular
complexes. Nat Rev Drug Discov 11:25–36.
Pourquier P, Ueng LM, Fertala J, Wang D, Park HJ, Essigmann JM, Bjornsti MA,
and Pommier Y (1999) Induction of reversible complexes between eukaryotic DNA
topoisomerase I and DNA-containing oxidative base damages. 7, 8-dihydro-8-
oxoguanine and 5-hydroxycytosine. J Biol Chem 274:8516–8523.
Ray Chaudhuri A, Hashimoto Y, Herrador R, Neelsen KJ, Fachinetti D, Bermejo R,
Cocito A, Costanzo V, and Lopes M (2012) Topoisomerase I poisoning results in
PARP-mediated replication fork reversal. Nat Struct Mol Biol 19:417–423.
Rowe TC, Weissig V, and Lawrence JW (2001) Mitochondrial DNA metabolism tar-
geting drugs. Adv Drug Deliv Rev 49:175–187.
Seol Y, Zhang H, Pommier Y, and Neuman KC (2012) A kinetic clutch governs reli-
gation by type IB topoisomerases and determines camptothecin sensitivity. Proc
Natl Acad Sci USA 109:16125–16130.
Singh KK, Russell J, Sigala B, Zhang Y, Williams J, and Keshav KF (1999) Mito-
chondrial DNA determines the cellular response to cancer therapeutic agents.
Oncogene 18:6641–6646.
Sobek S, Dalla Rosa I, Pommier Y, Bornholz B, Kalfalah F, Zhang H, Wiesner RJ, von
Kleist-Retzow JC, Hillebrand F, Schaal H, Mielke C, Christensen MO and Boege F
(2013) Negative regulation of mitochondrial transcription by mitochondrial top-
oisomerase I. Nucleic Acids Res 41:9848–9457.
Stewart L, Redinbo MR, Qiu X, Hol WG, and Champoux JJ (1998) A model for the
mechanism of human topoisomerase I. Science 279:1534–1541.
Subramanian D, Kraut E, Staubus A, Young DC, and Muller MT (1995) Analysis of
topoisomerase I/DNA complexes in patients administered topotecan. Cancer Res
55:2097–2103.
Takebayashi Y, Pourquier P, Yoshida A, Kohlhagen G, and Pommier Y (1999) Poi-
soning of human DNA topoisomerase I by ecteinascidin 743, an anticancer drug
that selectively alkylates DNA in the minor groove. Proc Natl Acad Sci USA 96:
7196–7201.
Tanizawa A, Fujimori A, Fujimori Y, and Pommier Y (1994) Comparison of top-
oisomerase I inhibition, DNA damage, and cytotoxicity of camptothecin derivatives
presently in clinical trials. J Natl Cancer Inst 86:836–842.
Wang Y, Lyu YL, and Wang JC (2002) Dual localization of human DNA top-
oisomerase IIIalpha to mitochondria and nucleus. Proc Natl Acad Sci USA 99:
12114–12119.
Wisnovsky SP, Wilson JJ, Radford RJ, Pereira MP, Chan MR, Laposa RR, Lippard
SJ, and Kelley SO (2013) Targeting mitochondrial DNA with a platinum-based
anticancer agent. Chem Biol 20:1323–1328.
Yousif LF, Stewart KM, and Kelley SO (2009) Targeting mitochondria with
organelle-specific compounds: strategies and applications. ChemBioChem 10:
1939–1950.
Zhang H, Barceló JM, Lee B, Kohlhagen G, Zimonjic DB, Popescu NC, and Pommier
Y (2001) Human mitochondrial topoisomerase I. Proc Natl Acad Sci USA 98:
10608–10613.
Zhang H and Pommier Y (2008) Mitochondrial topoisomerase I sites in the regulatory
D-loop region of mitochondrial DNA. Biochemistry 47:11196–11203.
Address correspondence to: Dr. Yves Pommier, Laboratory of Molecular
Pharmacology and Developmental Therapeutics Branch, Center for Cancer
Research, National Cancer Institute, NIH, Bldg. 37, Rm. 5068, 37 Convent
Drive, MSC 4255, Bethesda, MD 20814. E-mail: pommier@nih.gov
Poisoning of Mitochondrial Topoisomerase I by Lamellarin D 199
at ASPET Journals on February 21, 2015molpharm.aspetjournals.orgDownloaded from