Genome Organization, Phylogenies, Expression Patterns, and Three-Dimensional Protein Models of Two Acetylcholinesterase Genes from the Red Flour Beetle

Abstract

Since the report of a paralogous acetylcholinesterase (AChE, EC3.1.1.7) gene in the greenbug (Schizaphis graminum) in 2002, two different AChE genes (Ace1 and Ace2) have been identified in each of at least 27 insect species. However, the gene models of Ace1 and Ace2, and their molecular properties have not yet been comprehensively analyzed in any insect species. In this study, we sequenced the full-length cDNAs, computationally predicted the corresponding three-dimensional protein models, and profiled developmental stage and tissue-specific expression patterns of two Ace genes from the red flour beetle (Tribolium castaneum; TcAce1 and TcAce2), a globally distributed major pest of stored grain products and an emerging model organism. TcAce1 and TcAce2 encode 648 and 604 amino acid residues, respectively, and have conserved motifs including a choline-binding site, a catalytic triad, and an acyl pocket. Phylogenetic analysis show that both TcAce genes are grouped into two insect Ace clusters and TcAce1 is completely diverged from TcAce2, suggesting that these two genes evolve from their corresponding Ace gene lineages in insect species. In addition, TcAce1 is located on chromosome 5, whereas TcAce2 is located on chromosome 2. Reverse transcription polymerase chain reaction (PCR) and quantitative real-time PCR analyses indicate that both genes are virtually transcribed in all the developmental stages and predominately expressed in the insect brain. Our computational analyses suggest that the TcAce1 protein is a robust acetylcholine (ACh) hydrolase and has susceptibility to sulfhydryl agents whereas the TcAce2 protein is not a catalytically efficient ACh hydrolase.

Full text

Genome Organization, Phylogenies, Expression Patterns,
and Three-Dimensional Protein Models of Two
Acetylcholinesterase Genes from the Red Flour Beetle
Yanhui Lu
1,3
, Yuan-Ping Pang
2
*, Yoonseong Park
3
, Xiwu Gao
1
, Jianxiu Yao
3
, Xin Zhang
3
, Kun Yan Zhu
3
*
1Department of Entomology, China Agricultural University, Beijing, People’s Republic of China, 2Computer-Aided Molecular Design Laboratory, Mayo Clinic, Rochester,
Minnesota, United States of America, 3Department of Entomology, Kansas State University, Manhattan, Kansas, United States of America
Abstract
Since the report of a paralogous acetylcholinesterase (AChE, EC3.1.1.7) gene in the greenbug (Schizaphis graminum) in 2002,
two different AChE genes (Ace1 and Ace2) have been identified in each of at least 27 insect species. However, the gene
models of Ace1 and Ace2, and their molecular properties have not yet been comprehensively analyzed in any insect species.
In this study, we sequenced the full-length cDNAs, computationally predicted the corresponding three-dimensional protein
models, and profiled developmental stage and tissue-specific expression patterns of two Ace genes from the red flour
beetle (Tribolium castaneum;TcAce1 and TcAce2), a globally distributed major pest of stored grain products and an
emerging model organism. TcAce1 and TcAce2 encode 648 and 604 amino acid residues, respectively, and have conserved
motifs including a choline-binding site, a catalytic triad, and an acyl pocket. Phylogenetic analysis show that both TcAce
genes are grouped into two insect Ace clusters and TcAce1 is completely diverged from TcAce2, suggesting that these two
genes evolve from their corresponding Ace gene lineages in insect species. In addition, TcAce1 is located on chromosome 5,
whereas TcAce2 is located on chromosome 2. Reverse transcription polymerase chain reaction (PCR) and quantitative real-
time PCR analyses indicate that both genes are virtually transcribed in all the developmental stages and predominately
expressed in the insect brain. Our computational analyses suggest that the TcAce1 protein is a robust acetylcholine (ACh)
hydrolase and has susceptibility to sulfhydryl agents whereas the TcAce2 protein is not a catalytically efficient ACh
hydrolase.
Citation: Lu Y, Pang Y-P, Park Y, Gao X, Yao J, et al. (2012) Genome Organization, Phylogenies, Expression Patterns, and Three-Dimensional Protein Models of Two
Acetylcholinesterase Genes from the Red Flour Beetle. PLoS ONE 7(2): e32288. doi:10.1371/journal.pone.0032288
Editor: Israel Silman, Weizmann Institute of Science, Israel
Received April 1, 2011; Accepted January 26, 2012; Published February 16, 2012
Copyright: ß2012 Lu et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted
use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This study was supported by the Kansas Agricultural Experiment Station and the Arthropod Genomics Center funded by K-State Targeted Excellence
program at Kansas State University to KYZ, China Scholarship Council to YL, and the U.S. Department of Agriculture (USDA/NIFA 2009-05236) to YPP. The funders
had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing Interests: The authors have declared that no competing interests exist.
* E-mail: pang@mayo.edu (YPP); kzhu@ksu.edu (KYZ)
Introduction
Acetylcholinesterase (AChE, EC3.1.1.7) is an essential enzyme
at the synapses of cholinergic neurons in the central and peripheral
nervous systems in all animals. It catalyzes the hydrolysis of the
neurotransmitter acetylcholine (ACh), thus terminating neuro-
transmission. AChE has long been of academic and industrial
interest and studied extensively at the biochemical, biophysical,
and molecular levels in mammals because this enzyme is a target
of palliative Alzheimer drugs, nerve agents, and insecticides [1]. In
insects, AChE has also been extensively studied because it serves as
the target site for organophosphate and carbamate insecticides,
and involves in insecticide resistance known as target-site
insensitivity [2–8].
The first insect AChE gene (Ace) was sequenced from Drosophila
melanogaster in 1986 [9]. After the first Ace paralogous gene was
reported in the greenbug (Schizaphis graminum) in 2002 [10], the D.
melanogaster Ace gene was designated as Ace orthologous gene. It is
now clear that D. melanogaster has only one Ace gene as confirmed
by its genome sequence [11], whereas most other insect species
have two different Ace genes (i.e.,Ace1 and Ace2) [12]. Ace1
commonly refers to the Ace paralogous (AP-Ace) gene and Ace2 the
Ace orthologous (AO-Ace) gene in relation to the D. melanogaster Ace
[8].
To date, the cDNAs encoding AChEs have been sequenced
from at least 43 insect species. Among them, both Ace1 and Ace2
have been reported from each of 27 species, including Bombyx
mandarina (GenBank accession numbers: EU262633 for BmAce1
and EU262632 for BmAce2); Sitobion avenae [13]; Rhopalosiphum padi
[13]; Anopheles gambiae [14]; Liposcelis decolor (GenBank accession
numbers: FJ647186 for LdeAce1 and FJ647187 for LdeAce2);
Orchesella villosa [15]; Liposcelis entomophila (GenBank accession
numbers: EU854149 for LeAce1 and EU854150 for LeAce2);
Blattella germanica [16]; Bemisia tabaci [17]; Culex pipiens quinquefascia-
tus (GenBank accession numbers: XM_001847396 for CqAce1 and
XM_001842175 CqAce2); Bombyx mori [18]; Acyrthosiphon pisum
(GenBank accession numbers: XM_001948618 for ApAce1 and
XM_001948953 for ApAce2); Nasonia vitripennis (GenBank accession
numbers: XM_001600408 for NvAce1 and XM_001605518 for
NvAce2); Pediculus humanus corporis [19]; Cydia pomonella [20];
Helicoverpa assulta [21]; Aedes albopictus (GenBank accession
numbers: AB218421 for AaAce1 and AB218420 for AaAce2); Aphis
gossypii [22]; Culex tritaeniorhynchus [23]; Myzus persicae [24]; Culex
pipiens [25]; Plutella xylostella [26–28]; Chilo suppressalis [29]; Pediculus
PLoS ONE | www.plosone.org 1 February 2012 | Volume 7 | Issue 2 | e32288

humanus capitis [19]; Aedes aegypti [30]; Liposcelis bostrychophila
(GenBank accession numbers: FJ647185 for LbAce1 and
EF362950 for LbAce2) and Alphitobius diaperinus [31]. The
remaining insect species may also have two Ace genes but only
one Ace gene (Ace1 or Ace2) has been documented.
The existence of two Ace genes in insects has attracted much
attention to the study of their functions, particularly their roles in
insecticide resistance [8,32] and as targets for developing new
insecticides [12,33–37]. Beetles (coleopterans) are the most
evolutionarily successful metazoans, accounting for 25% of all
known animal species, far more than any other taxonomic orders
[31]. Despite the diversity and economic importance of coleopter-
ans, Ace genes have been reported from only two species: Leptinotarsa
decemlineata [5,6] and Alphitobius diaperinus [31]. Although T. castaneum
(the red flour beetle) is one of the most notorious stored grain pests in
the world and is now regarded as an emerging model organism, its
Ace genes were only predicted from genomic sequence and detailed
information on these genes has been limited.
In this paper, we report two Ace genes from T. castaneum. Our
study of the two genes focuses on the genome organization, three-
dimensional (3D) protein models, phylogenies, and expression
patterns of the two genes at different developmental stages of the
insect, in an effort to better understand the functions of the two
genes and obtain insights into better strategies for insect pest control.
Results
AChE cDNA and deduced amino acid sequences
Based on the predicted sequences of two T. castaneum Ace genes
in NCBI (XM_968369 and XM_965681), we designed specific
primers (Table 1) to determine the full-length cDNAs of the two
genes from the brain of T. castaneum. Each of several polymerase
chain reaction (PCR) primer pairs was able to generate overlapping
fragmentsforeachgeneanditwasthenpossibletoassembletheminto
its full-length cDNA of the protein coding region. The two deduced
amino acid sequences show significant similarities to AChE1 (AP-
AChE) and AChE2 (AO-AChE) proteins of other insects in GenBank
according to our BLASTP analysis. Therefore, the two T. castaneum Ace
genes are named TcAce1 (AP-Ace)andTcAce2 (AO-Ace), and their
protein products are named TcAce1 and TcAce2, respectively. The
TcAce1 cDNA contains 2148 base pairs (bp) and has an open reading
frame (ORF) of 1944 bp, encoding a protein of 648 amino acid
residues, whereas the TcAce2 cDNA contains 1,890 bp and has an
ORF of 1,812 bp, encoding a protein of 604 residues. However, we
were not able to obtain the 59-untranslated region (59-UTR) of the
TcAce2 cDNA (Fig. 1).
TcAce1 and TcAce2 belong to typical Ace1- and Ace2-type genes,
respectively, as judged by their sequence similarities with other
known insect Aces (Fig. 2). The deduced amino acid sequences
(TcAce1 and TcAce2) of TcAce1 and TcAce2 exhibit six and four N-
glycosylation sites (N-X-S or N-X-T) [38], respectively (Fig. 1).
Predicted isoelectric points (pI) and molecular masses of TcAce1
and TcAce2 are 6.58 and 5.39, and 72.81 and 68.15 kDa,
respectively (http://www.scripps.edu/,cdputnam/protcalc.html).
Both TcAce1 and TcAce2 are predicted to contain a cleavable
signal peptide, which suggests that these proteins can be secreted
and function in an extracellular environment. Both proteins have a
C-terminal Cys residue (C617 in TcAce1 and C600 in TcAce2)
that is likely to form an intermolecular disulfide bond. According
to the analysis using PredGPI (http://gpcr.biocomp.unibo.it/
Table 1. PCR primers used to amplify cDNA sequences of both TcAce1 and TcAce2 genes and to analyze their gene expressions.
Primer name Sequence (59-39)Tm(
6C) Product size (bp) Location
a
PCR for cDNA sequences
TcAce1-F
b
CGGCCTGCTTACTAGTGATTCTAC 60.66 1714 17-1730
TcAce1-R ACATCGAGGGTGAGAAACTCC 60.50
TcAce1S-F CAACGACCGTTGTGCAAATA 60.56 320 N/A-219
TcAce1S-R CAGGGGATCATCTTCGGAGT 61.39
TcAce1E-F CGTTTGGACACCCACTTTCT 60.01 402 1665-N/A
TcAce1E-R GTCGTGTTGATTTTGAATACCTCAC 60.99
TcAce2-F AGACCTCATCACGCTGTTTG 55.2 1034 750-1783
TcAce2-R CTGGGTTATCCCGAAGCTTG 61.86
TcAce2S-F GTCGTAGAGGCGTCGTCGT 61.44 1014 N/A-895
TcAce2S-R TCTCCCCCGACATGTAACTC 59.93
TcAce2E-F AACCAGTGACAGACGACGTG 59.78 267 1627-N/A
TcAce2E-R CGCAACCGATGCGTTTAATA 61.86
Quantitative real-time PCR
TcAce1(Q)-F CCGTTCGTCCCAGTCATTG 55.3 121 1069-1189
TcAce1(Q)-R AGTAGTAGCCTTCTTCTGTGTTAG 55.4
TcAce2(Q)-F AGACCTCATCACGCTGTTTG 55.2 179 750-928
TcAce2(Q)-R CCTCCACCAGGACCTTCC 54.9
TcRps3-F CCGTCGTATTCGTGAATTGAC 54.8 130 279-408
TcRps3-R TCTAAGAGACTCTGCTTGTGC 54.7
a
Product location refers to the PCR fragment corresponding to the Ace gene nucleotide sequence of T. castaneum from NCBI database (TcAce1: XM_968369; TcAce2:
XM_965681). N/A refers to the sequence based on the genomic sequence in Beetlebase (http://beetlebase.org/).
b
F and R refer to forward and reverse primers, respectively.
doi:10.1371/journal.pone.0032288.t001
Acetylcholinesterase Genes from Red Flour Beetle
PLoS ONE | www.plosone.org 2 February 2012 | Volume 7 | Issue 2 | e32288

Acetylcholinesterase Genes from Red Flour Beetle
PLoS ONE | www.plosone.org 3 February 2012 | Volume 7 | Issue 2 | e32288

predgpi/), TcAce1 appears to contain a GPI-anchor, which is
linked to the C-terminal residue after a proteolytic cleavage at the
vsite (D619 in TcAce1), whereas TcAce2 doesn’t seem to contain
a GPI-anchor. Both proteins have relatively high sequence identity
(47% for TcAce1 and 59% for TcAce2) to the C-terminal residues
526–543 (i.e., QTCAFWNRFLPKLLSAT) of the recombinant
mouse AChE (mAChE) [39,40]. This level of sequence identity is
identical or higher than the corresponding sequence identity (47%)
between mAChE and D. melanogaster AChE (DmAChE). All these
suggest that residues 589–605 in TcAce1 and residues 578–594 in
TcAce2 are likely responsible for the formation of a dimeric four-
helix bundle at the C-terminus as seen in mAChE [40] and
DmAChE [41].
Chromosomal locations of TcAce1 and TcAce2
The exon-intron organizations of TcAce1 and TcAce2 were
revealed by comparisons of the full-length cDNAs with their
corresponding genomic sequences (http://beetlebase.org/). The
lengths of TcAce1 and TcAce2 genomic DNA sequences are
2,986 bp and 32,243 bp, respectively. Genome structure analysis
shows that the two genes are located on different chromosomes of
T. castaneum;TcAce1 is located on chromosome 5, whereas TcAce2
on chromosome 2. TcAce1 has two exons and one intron, whereas
TcAce2 has six exons and five introns (Fig. 3).
Phylogenetic relationship of T. castaneum AChE to other
AChEs
The phylogenetic tree of the deduced amino acid sequences of
AChEs from the Pacific electric ray (Torpedo californica), twospotted
spider mite (Tetranychus urticae), and all the insect species available in
GenBank was generated using the neighbor-joining method.
Phylogenetic analysis suggests that there are two major groups
(Ace1 and Ace2); TcAce1 and TcAce2 belong to the Ace1-andAce2-
type genes, respectively (Fig. 4). As expected, the cDNA-deduced
TcAce1 has high protein sequence identities to BgAce1 (70%),
HaAce1 (64%), AgAce1 (61%), SaAce1 (57%), and SgAce1 (57%).
The cDNA-deduced TcAce2 has high protein sequence identities to
LdAce2 (84%), HaAce2 (69%), BgAce2 (68%), AgAce2 (60%),
SaAce2 (57%), and DmAce (55%) (Table 2). TcAce1 and TcAce2
exhibited 39% and 38% protein sequence identities to T. californica
AChE, respectively. However, the protein sequence identities of
Ace1 and Ace2 in the same insect species are 36% (between TcAce1
and TcAce2), 31% (between SaAce1 and SaAce2), 35% (between
AgAce1 and AgAce2), 35% (between BgAce1 and BgAce2), and
32% (between HaAce1 and HaAce2) (Table 2).
It is worth noting that, per the present nomenclature, the
reported PhAce1, PhcAce1, AgoAce1, MpAce1 and CtAce1 in the
Ace2 group should change to PhAce2, PhcAce2, AgoAce2,
MpAce2 and CtAce2, respectively, whereas the reported PhAce2,
PhcAce2, AgoAce2, MpAce2 and CtAce2 in the Ace1 group
should be named PhAce1, PhcAce1, AgoAce1, MpAce1 and
CtAce1, respectively (Fig. 4).
Three-dimensional models
TcAce1 (TcAP-AChE). Eighteen 10-ns molecular dynamics
simulations of the substrate-bound TcAce1 protein homology
model derived from a human butyrylcholinesterase (hBChE)
crystal structure (Protein Data Bank ID: 2J4C [42]) resulted in a
time-averaged model with a distorted catalytic triad and partial
unfold of the omega loop. This result indicates that the homology
model is structurally unstable, presumably due to the low sequence
identity of the omega loop between TcAce1 and hBChE that
results in gaps in the omega loop. Another homology model was
therefore built from a simulation-refined model of the African
malaria mosquito (A. gambiae) AP-AChE (Protein Data Bank ID:
2AZG) [33] that has a higher sequence identity to TcAce1 (73%)
than the identity between hBChE and TcAce1 (46%). Twenty-two
10-ns molecular dynamics simulations of this model liganded with
its substrate yielded a time-averaged model without distortions in
the catalytic triad and the omega loop. In this final model of
TcAce1 (Fig. 5), C354 is exposed to solvent and accessible to
covalent bonding at the opening of the active-site gorge [33]; R407
is enclosed by F143, F146, and F406 via cation-pi interactions;
Y189, Y396, and Y400 adopt conformations that make the gorge
relatively open; ACh adopts the fully extended conformation with
its ammonium group forming a cation-pi interaction with the
indole ring of W152 and its carbonyl oxygen atom anchored at the
oxyanion hole comprising of G186, G187, and A268; E266 forms
a hydrogen bond with Y198 at the bottom of the active-site gorge;
E393, H507, and S267 form the catalytic triad. The TcAce1 active
site is very similar to those of A. gambiae and S. graminum AP-AChEs
[33,34], and different from the human AChE active site in that
Y449 in the human enzyme is replaced by Asp creating void space
at the bottom of the TcAce1 active site (Fig. 6). In T. californica
AChE, rotation of Y442, which corresponds to Y449 of human
AChE, reportedly controls the opening of a 3.4-A
˚-wide channel
that enables rapid clearance of substrate hydrolysis products [43].
In DmAChE, the counterpart of Y449 is also mutated to Asp;
hence the crystal structure of DmAChE (Protein Data Bank ID:
1DX4 [41]) has a channel with a diameter of ,5A
˚that is formed
by G79, W83, W472, L479, and D482 and connects the active-site
gorge to solvent [44]. Because of the mutation Tyr of human to
Asp of TcAce1, the final model of TcAce1 has a similar channel
that is comprised of G148, W152, W499, M506, and D509. The
TcAce1 channel is, however, partially blocked by M151 and P498.
TcAce2 (TcAO-AChE). A homology study identified the
crystal structure of DmAChE (PDB ID: 1DX4 [41]) as a
template with a sequence identity of 60% and generated a
homology model of TcAce2. This model has a protruded large
loop conformation for residues 145–162, which is due to the
omission of the corresponding loop (residues 103–136) in the
1DX4 crystal structure. An initial set of 21 10-ns molecular
dynamics simulations of the TcAce2 homology model without
residues 145–162 resulted in a time-average model with the
catalytic triad distorted.
In the loop of residues 145–162, there are two histidine residues,
four arginine residues, two lysine residues, one aspartate residue,
and one glutamate residue. At the physiological pH of 7.4, this
loop has a net charge of +4. To avoid a possible effect of the
highly-charged loop on the catalytic triad distortion, a second set
of 21 10-ns simulations of the TcAce2 homology model possessing
residues 145–162 was performed. The triad was still distorted in an
average conformation of all trajectories saved at 1.0-ps intervals
Figure 1. The cDNA and deduced amino acid sequences of two
Ace
genes from
Tribolium castaneum
.The amino acid sequences were
numbered from the start of the mature proteins. The start codon ATG were bold and underlined, and the stop codon TAA at the end of the coding
region were bold and marked with asterisks. The putative signal peptides of the deduced amino acid sequences were underlined with red dots.
Potential N-linked glycosylation sites were bold and shaded. The sequences were deposited in the GenBank (accession numbers: HQ260968 for
TcAce1 and HQ260969 for TcAce2).
doi:10.1371/journal.pone.0032288.g001
Acetylcholinesterase Genes from Red Flour Beetle
PLoS ONE | www.plosone.org 4 February 2012 | Volume 7 | Issue 2 | e32288

Acetylcholinesterase Genes from Red Flour Beetle
PLoS ONE | www.plosone.org 5 February 2012 | Volume 7 | Issue 2 | e32288

during the last 1-ns period of all 21 simulations or in an average of
each cluster of the trajectories generated by a cluster analysis. As to
the loop conformation of residues 145–162, the cluster analysis
showed that 24% of the trajectories had residues 145–162 folded
in contact with surface residues such as R21, D148, D501, and
D203.
A third set of 22 10-ns simulations of TcAce2 with residues 145–
162 adopting the folded conformation was then carried out. The
initial conformation of the third set of simulations was obtained
from averaging all the trajectories of TcAce2 with the folded loop
conformation of residues 145–162 followed by manual adjustment
of the side-chain torsions to restore the hydrogen bond network of
the catalytic triad. A cluster analysis of all the trajectories saved at
1.0-ps intervals during the last 1.0-ns period of all 22 simulations
showed that residues 145–162 remain the folded conformation.
However, the average of all the trajectories had a distorted
catalytic triad. Visual inspection of all 22 simulations found that
conformations of the first of the 22 simulations have a catalytic
triad engaging in a hydrogen-bond network. The final model of
TcAce2 was then obtained from averaging all trajectories saved at
1.0-ps intervals during the last 1.0 ns period of the first simulation.
Although the homology model of TcAce2 was based on the
DmAChE crystal structure, the active site of the simulation-refined
TcAce2 model (Fig. 7) is very different from that of the DmAChE
crystal structure. It is also different from those of human AChE
and insect AP-AChEs (i.e., AChE1s). In the refined model of
TcAce2 (Fig. 7), Y114, Y345, Y395, and W342 form an aromatic
cluster that completely block the entrance of the active site; E388,
H502, and S259 form a catalytic triad; ACh has a cation-pi
interaction with W126, but it does not adopt the fully extended
conformation, nor is its carbonyl oxygen atom located in the
oxyanion hole. In contrast to the TcAce1 model with residues
146–154 and 493–509 that partially shield ACh from interacting
with solvent, the TcAce2 model has its corresponding residues
(120–128 and 488–504) adopt conformations that leave ACh to be
exposed to solvent (Fig. 8).
TcAce gene expression profiles
The transcript levels of TcAce1 and TcAce2 were evaluated by
reverse transcription PCR (RT-PCR) and quantitative real-time
PCR (qPCR) in tissues of T. castaneum at different developmental
stages (Fig. 9). Both TcAce genes were transcribed in all the stages
examined, including 1-day (d) and 3-d eggs; 5-d and 20-d larvae;
1-d, 3-d and 6-d pupae; and 2-d and 14-d adults. The lowest
expression levels of these genes were found in eggs, particularly for
TcAce2 whose expression level was undetectable by RT-PCR in 1-
d eggs (Fig. 9A and 9B). The expression patterns of TcAce1 and
TcAce2 were very similar. In addition, the TcAce1 and TcAce2 genes
also exhibited similar tissue-specific expression patterns (Fig. 9C
and 9D). As expected, these genes were predominately expressed
in the brain, although their expressions were also detected in the
gut and carcass after the brain and ventral nerve cord were
removed.
Discussion
Since the first insect AChE orthologous gene (i.e., the one later
named Ace2 or AO-Ace) and the first insect AChE paralogous gene
(i.e., the one later named Ace1 or AP-Ace) were reported in D.
melanogaster in 1986 [9] and in S. graminum in 2002 [10],
respectively, cDNAs encoding both Ace1 and Ace2 have been
sequenced from each of at least 27 insect species. However, the
gene models and the genomic organizations of Ace1 and Ace2 have
not been well established in insects. In this study, we confirmed the
two Ace gene (TcAce1 and TcAce2) models in T. castaneum by
sequencing the coding regions of their cDNAs followed by
comparative analyses of their cDNA and genomic sequences.
The TcAce1 and TcAce2 genes are significantly different not only in
the length of their genomic DNA (TcAce1 with 2,986 bp and
TcAce2 with 32,243 bp) but also in the intron/exon organizations.
Specifically, TcAce1 possesses only one intron whereas TcAce2 has
five introns. Furthermore, TcAce1 is located on chromosome 5
(ChLG5), whereas TcAce2 is on chromosome 2 (ChLG2; Fig. 3).
Apparently, the intron/exon organizations and the chromosomal
locations of these genes in T. castaneum are different from their
counterparts in other insect species [8,14,18,23,45].
Despite the significant differences in genomic structures and the
chromosomal locations of TcAce1 and TcAce2, the deduced protein
sequences of the two genes exhibit all the common features of an
AChE sequence wise. These features include (1) a conserved
active-site triad, including S267 in TcAce1 and S259 in TcAce2
(S200 in Torpedo), E393 in TcAce1 and E388 in TcAce2 (E327 in
Torpedo), and H507 in TcAce1 and H502 in TcAce2 (H440 in
Torpedo); (2) a choline binding site, W152 in TcAce1 and W126 in
TcAce2 (W84 in Torpedo); (3) three pairs of cysteines putatively
forming intramolecular disulfide bonding (C135,C162,
C321,C334, and C469,C591 in TcAce1; and C109,C136,
C313,C328, and C464,C580 in TcAce2); (4) a cysteine forming
intermolecular disulfide bonding (C617 in TcAce1 and C600 in
TcAce2); (5) 10 conserved aromatic amino acid residues out of 14
Figure 2. Alignment of deduced AChE protein sequences encoded by TcaAce (CAA27169,
Torpedo californica
Ace); TcAce1
(HQ260968,
Tribolium castaneum
Ace1, this paper); TcAce2 (HQ260969,
T. castaneum
Ace2, this paper); SaAce1 (AY819704,
Sitobion
avenae
Ace1); SaAce2 (AY707319,
S. avenae
Ace2); DmAce (X05893,
Drosophila melanogaster
Ace); AgAce1 (XM_321792,
Anopheles
gambiae
Ace1); AgAce2 (BN000067,
A. gambiae
Ace2); BgAce1 (DQ288249,
Blattella germanica
Ace1); BgAce2 (DQ288847,
B.
germanica
Ace2); HaAce1 (DQ001323,
Helicoverpa assulta
Ace1); HaAce2 (AY817736,
H. assulta
Ace2); SgAce1 (AF321574,
Schizaphis
graminum
Ace1) and LdAce2 (L41180,
Leptinotarsa decemlineata
Ace2). Numbering of the amino acid sequences was from the N-terminus of
mature proteins. Identical amino acids were indicated by asterisks and conservative substitutions by dots. The catalytic triad residues were marked
with arrowhead. The number 1, 2, 3 on the boxed amino acids indicated the residues forming intramolecular disulfide bonds. The positions of
aromatic residues lining the active site gorge in T. californica AChE were marked with block arrows. The cholinesterase signature sequence was
underlined.
doi:10.1371/journal.pone.0032288.g002
Figure 3. Schematic diagram of the organization of two
Ace
genes from
Tribolium castaneum
.The full lengths of the two
genomic sequences were 2,986 bp for TcAce1 and 32,243 bp for TcAce2.
Genome structure showed that two different Ace genes in T. castaneum
located on different chromosomes. TcAce1 located on chromosome 5
and TcAce2 on chromosome 2. TcAce1 has two exons and one intron,
whereas TcAce2 has six exons and five introns.
doi:10.1371/journal.pone.0032288.g003
Acetylcholinesterase Genes from Red Flour Beetle
PLoS ONE | www.plosone.org 6 February 2012 | Volume 7 | Issue 2 | e32288

aromatic residues lining the catalytic gorge of AChE; and (6) the
conserved sequence FGESAG, flanking S267 in TcAce1 and S259
in TcAce2 (Fig. 2).
Ethanolmine and glucosamine residues are characteristic of a C-
terminal glycolipid anchor in most G2 AChE [46,47]. Our
analysis by using PredGPI predictor suggests that DmAChE and
TcAce1 contain a GPI-anchor at the C-terminal. Although
TcAce2 has higher sequence identity level with DmAChE than
TcAce1, TcAce2 does not appear to contain a GPI-anchor at the
C-terminal. Because the C-terminal Cys residue in AChE is
reportedly for the intermolecular disulfide linkage [48], C617 in
TcAce1 and C600 in TcAce2 are likely involved in the
intermolecular disulfide linkage, although the corresponding Cys
residue is missing in DmAChE [46]. We also analyzed the
hydrophilic and hydrophobic of non-homologous amino acid
residues of TcAce1 and TcAce2 and compared homologous
Figure 4. Rooted phylogenetic tree of deduced
Ace
amino acid
sequences from the Pacific electric ray (
Torpedo californica
),
two-spotted spider mite (
Tetranychus urticae
) and 43 insect
species constructed by the neighbor-jointing method. The
name is made up of a species abbreviation (first letter of the genus
followed by the first one or two letters of the specific name). Sequences
used: TcaAce (CAA27169, T. californica Ace); TcAce1 (HQ260968,
Tribolium castaneum Ace1, this paper); TcAce2 (HQ260969, T. castaneum
Ace2, this paper); BmAce1(EU262633, Bombyx mandarina Ace1);
BmAce2 (EU262632, B. mandarina Ace2); SaAce1 (AY819704, Sitobion
avenae Ace1); SaAce2 (AY707319, S. avenae Ace2); RpAce1 (AY667435,
Rhopalosiphum padi Ace1); RpAce2 (AY707318, R. padi Ace2); DmAce
(X05893, Drosophila melanogaster Ace); AgAce1 (XM_321792, Anopheles
gambiae Ace1); AgAce2 (BN000067, A. gambiae Ace2); LdeAce1
(FJ647186, Liposcelis decolor Ace1); LdeAce2 (FJ647187, L. decolor
Ace2); OvAce1 (FJ228227, Orchesella villosa Ace1); OvAce2 (FJ228228, O.
villosa Ace2); LeAce1 (EU854149, Liposcelis entomophila Ace1); LeAce2
(EU854150, L. entomophila Ace2); BgAce1 (DQ288249, Blattella germa-
nica Ace1); BgAce2 (DQ288847, B. germanica Ace2); BtAce1 (EF675188,
Bemisia tabaci Ace1); BtAce2 (EF675190, B. tabaci Ace2); CqAce1
(XM_001847396, Culex quinquefasciatus Ace1); CqAce2 (XM_001842175,
C. quinquefasciatus Ace2); BmoAce1 (NP_001037380 Bombyx mori Ace1);
BmoAce2 (NP_001108113 B. mori Ace2); ApAce1 (XM_001948618,
Acyrthosiphon pisum Ace1); ApAce2 (XM_001948953, A. pisum Ace2);
NvAce1 (XM_001600408, Nasonia vitripennis Ace1); NvAce2
(XM_001605518, N. vitripennis Ace2); PhAce1 (AB266605, Pediculus
humanus corporis Ace1); PhAce2 (AB266606, P. humanus corporis Ace2);
CpAce1 (DQ267977, Cydia pomonella Ace1); CpAce2 (DQ267976, C.
pomonella Ace2); HaAce1 (DQ001323, Helicoverpa assulta Ace1); HaAce2
(AY817736, H. assulta Ace2); AaAce1 (AB218421, Aedes albopictus Ace1);
AaAce2 (AB218420, A. albopictus Ace2); AgoAce1 (AF502081, Aphis
gossypii Ace1); AgoAce2 (AF502082, A. gossypii Ace2); CtAce1
(AB122151, Culex tritaeniorhynchus Ace1); CtAce2 (AB122152, C.
tritaeniorhynchus Ace2); SgAce1 (AF321574, Schizaphis graminum
Ace1); MpAce1 (AF287291, Myzus persicae Ace1); MpAce2 (AY147797,
M. persicae Ace2); CpiAce1 (AJ489456, Culex pipiens Ace1); CpiAce2
(AM159193, C. pipiens Ace2); MdAce (AY134873, Musca domestica Ace);
PxAce1 (AY970293, Plutella xylostella Ace1); PxAce2 (AY061975, P.
xylostella Ace2); CsAce1 (EF453724, Chilo suppressalis Ace1); CsAce2
(EF470245, C. suppressalis Ace2); CmAce2 (FN538987, Cnaphalocrocis
medinalis Ace2); PhcAce1 (AB266614, Pediculus humanus capitis Ace1);
PhcAce2 (AB266615, P. humanus capitis Ace2); TuAce (AY188448, T.
urticae Ace); AaeAce1 (EF209048, Aedes aegypti Ace1); LmAce1
(EU231603, Locusta migratoria manilensis Ace1); LbAce1 (FJ647185,
Liposcelis bostrychophila Ace1); LbAce2 (EF362950, L. bostrychophila
Ace2); NlAce (FM866396, Nilaparvata lugens Ace); CcAce (EU130781,
Ceratitis captitata Ace); AmAce (AB181702, Apis mellifera Ace); BdAce2
(AY155500, Bactrocera dorsalis Ace2); HiAce (AY466160, Haematobia
irritans Ace); CppAce1 (AY762905, Culex pipiens pallens Ace1); HarAce2
(AF369793, Helicoverpa armigera Ace2); BoAce (AF452052; Bactrocera
oleae Ace); LcAce (U88631, Lucilia cuprina Ace); NcAce (AF145235,
Nephotettix cincticeps Ace); LdAce2 (L41180, Leptinotarsa decemlineata
Ace2).
doi:10.1371/journal.pone.0032288.g004
Acetylcholinesterase Genes from Red Flour Beetle
PLoS ONE | www.plosone.org 7 February 2012 | Volume 7 | Issue 2 | e32288

sequences of TcAce1 and TcAce2 with mAChE and DmAChE at
the C-terminal for possible formation of the four-helix bundle.
Our analysis suggests that C-terminal sequences of both TcAce1
and TcAce2 may form the dimeric four-helix bundle.
According to comparisons of TcAce1 and TcAce2 with Ace
proteins from other insect species, TcAce1 showed high sequence
identities to the AChE1 (AP-AChE) proteins from Sitobion avenae
(57%), A. gambiae (61%), Blattella germanica (70%), S. graminum (57%),
and Helicoverpa assulta (64%; Table 2). Similarly, TcAce2 also
showed high amino acid identities to the AChE2 (AO-AChE)
proteins of S. avenae (57%), D. melanogaster (55%), A. gambiae (60%),
B. germanica (68%), Leptinotarsa decemlineata (84%), and H. assulta
(69%). Based on our analysis of deduced amino acid sequences
from the two genes among respective insect species, the sequence
identity levels within the paralogous (Ace1) or orthologous (Ace2)
genes range from 48 to 96%, whereas the sequence identity levels
between the Ace1 and Ace2 genes of the same insect species range
only from 31 to 36% in all insect species examined (Table 2).
These results support the hypothesis that the two Ace genes were
originated from an old duplication before the diversification of
insect species [32].
Furthermore, a phylogenetic tree, which was generated from
the highly conserved regions of all insect and T. urticae AChE
Figure 5. Close-up view of the active site of TcAce1 with a
perspective from the free cysteine at the opening of the active-
site gorge down to ACh and the catalytic triad at the bottom of
the gorge.
doi:10.1371/journal.pone.0032288.g005
Table 2. Percent identities of amino acid residues among the AChEs of Tribolium castaneum,Torpedo californica and other seven
insect species.
Name Tca TcAce1 SaAce1 AgAce1 BgAce1 SgAce1 HaAce1 DmAce TcAce2 SaAce2 AgAce2 BgAce2 LdAce2 HaAce2
Tca—39384240383935383737383737
TcAce1 — 57 61 70 57 64 31 36 31 34 36 34 34
SaAce1 —5159965532363133343334
AgAce1 —57515934373335393536
BgAce1 — 59 62 33 36 33 33 35 36 34
SgAce1 —5532363033343433
HaAce1 —31353032353432
DmAce —554862515351
TcAce2 —5760688469
SaAce2 —50535552
AgAce2 —555756
BgAce2 —6360
LdAce2 —66
HaAce2 —
NOTE: TcaAce, Torpedo californica; TcAce, Tribolium castaneum; SaAce, Sitobion avenae; DmAce, Drosophila melano gaster; AgAce, Anopheles gambiae; BgAce, Blattella
germanica; HaAce, Helicoverpa assulta; SgAce, Schizaphis graminum; LdAce, Leptinotarsa decemlineata.
doi:10.1371/journal.pone.0032288.t002
Figure 6. Comparison of the bottom of the active-site gorge in
TcAce1 to those in human AChE and
Anopheles gambiae
AP-
AChE. Tyr449 in human AChE (yellow) is mutated to Asp509 in TcAce1
(green) and Asp441 in A. gambiae AChE (cyan).
doi:10.1371/journal.pone.0032288.g006
Acetylcholinesterase Genes from Red Flour Beetle
PLoS ONE | www.plosone.org 8 February 2012 | Volume 7 | Issue 2 | e32288

amino acid sequences available in GenBank and the correspond-
ing one in T. californica using the neighbor-joining method,
revealed two insect AChE clusters. TcAce1 was grouped into the
insect Ace1 cluster and TcAce2 into the insect Ace2 cluster. The
significant divergence between TcAce1 and TcAce2 suggests that
these genes were evolved from their corresponding Ace gene
lineages in insect species [49]. These results also suggest, for the
first time, that the divergence of Ace1 and Ace2 might occur prior to
insect speciation and that the Ace1 gene might be lost in D.
melanogaster and other species in Cyclorrapha suborder of Diptera
during the evolutionary process [14,25,32]. Thus, it is likely that
both the Ace genes in insects may have different functions because
these genes have evolved during the evolutionary histories of these
insect species.
Using a reported simulation-refined model of A. gambiae AP-
AChE [33] and a crystal structure of DmAChE [41] with high
sequence identities to TcAce1 (73%) and TcAce2 (60%),
respectively, and the same multiple molecular dynamics simula-
tion method to model and refine TcAce1 and TcAce2, we
obtained models of TcAce1 and TcAce2 both which are in
complex with acetylcholine. The TcAce1 model has an active site
that is almost identical to those of A. gambiae and S. graminum AP-
AChEs, and it has C354 at the opening of the active-site gorge
just like the insect-specific C286 of A. gambiae and C289 of S.
graminum that are susceptible to sulfhydryl agents [33,34]. The
TcAce2 model has an active site with an entrance comprised of
G122, W126, W494, M501, and D504. This entrance corre-
sponds to the small opening at the bottom of the active-site gorge
of DmAChE [44] or T. californica AChE when Y442 moves away
from W84 [43]. In the TcAce2 model, the region that
corresponds to the entrance of TcAce1 is completely blocked
by Y114, Y345, Y395, and W342. Of the four aromatic residues,
Y395 and W342 correspond to Y334 and W279 of T. californica
AChE, respectively, and belong to the 14 conserved aromatic
residues that line the active-site gorge of T. californica AChE [50].
In other words, the entrance of the active-site gorge of TcAce2
appears to be reversed relative to that of TcAce1. Unlike ACh in
the TcAce1 model, ACh does not adopt the fully extended
conformation and its carbonyl oxygen atom is not placed in the
oxyanion hole in the TcAce2 model.
In addition, R576 in the TcAce2 model is close to E388 (the
separation between the side-chain N atom of R576 and the side-
chain O atom of E388 is 3.9 A
˚), a composite residue of the
catalytic triad, in contrast to the corresponding arginine residue
that is away from the catalytic glutamate residue in TcAce1, A.
gambiae AP-AChE and human AChE (Fig. 10). Analysis of all the
trajectories of the third set of simulations of TcAce2 showed that
95% of the trajectories has a hydrogen bond between R576 and
E388, accompanied by hydrogen bonds between H502 and E505
and between S259 and E258, leading to disruption of the catalytic
triad. These computational observations suggest that TcAce1 is a
robust ACh hydrolase and susceptible to sulfhydryl agents and that
TcAce2 is not a catalytically efficient ACh hydrolase, although
further study is needed to comprehensively elucidate physiological
functions of Ace1 and Ace2 genes. In view of these computational
results, it is logical to investigate whether TcAce2 functions more
as a cholinesterase-like adhesion molecule (CLAM) [51,52] than
TcAce1. However, our sequence analysis using ClustalW 2.0.12
shows that TcAce1 has a slightly higher sequence homology to D.
melanogaster gliotactin, which is one of the three D. melanogaster
CLAMs, than TcAce2 (Table 3); both TcAce1 and TcAce2 have
dipole moments that are comparable to those of other AChEs
(Table 4). The orientations of the dipole moments of TcAce1 and
TcAce2 are almost the same. The two dipole moments are
approximately along the beta strand that corresponds to Strand 5
of the T. californica AChE crystal structure [53] and nearly identical
to those of other AChEs but orthogonal to that of Galactomyces
geotrichum lipase [52,54]. These sequence and dipole moment
analyses do not support the hypothesis that TcAce2 functions as a
CLAM.
Figure 7. Close-up view of the active site of TcAce2 with a
perspective looking down to acetylcholine and the catalytic
triad at the bottom of the gorge.
doi:10.1371/journal.pone.0032288.g007
Figure 8. Comparison of loop conformations of residues 146–
154 and 493–509 in TcAce1 with the corresponding ones of
residues 120–128 and 488–504 in TcAce2.
doi:10.1371/journal.pone.0032288.g008
Acetylcholinesterase Genes from Red Flour Beetle
PLoS ONE | www.plosone.org 9 February 2012 | Volume 7 | Issue 2 | e32288

Figure 10. Separation of Arg from the catalytic triad in TcAce2 (A), TcAce1 (B),
Anopheles gambiae
AP-AChE (C), and human AChE
(D).
doi:10.1371/journal.pone.0032288.g010
Figure 9. The two
TcAce
genes mRNA expression levels of developmental stages and different tissues were determined by RT-PCR
as shown by gel pictures at the bottom of each panel and quantitative real-time PCR as shown by histograms. Real-time PCR data
were normalized to TcRps3 gene expression. E1, 1-d eggs; E3, 3-d eggs; L5, 5-d larvae; L20, 20-day larvae; P1, 1-d pupae; P3, 3-d pupae; P6, 6-d pupae;
A2, 2-d adults; A14, 14-d adults. Gut (including midgut and hindgut), Carcass (not including head, gut and nerve system). Standard error bars were
base on three replicates. One-Way ANOVA-Fisher’s LSD was used in statistical analysis of quantitative real-time PCR data.
doi:10.1371/journal.pone.0032288.g009
Acetylcholinesterase Genes from Red Flour Beetle
PLoS ONE | www.plosone.org 10 February 2012 | Volume 7 | Issue 2 | e32288

Materials and Methods
Insect culture
The Georgia-1 (GA-1) strain of T. castaneum was reared on
whole-wheat flour containing 5% (by weight) of brewers’ yeast at
30uC and 65% relative humidity under standard conditions in the
laboratory of Kansas State University (Manhattan, Kansas, United
States of America) based on the method of Haliscak and Beeman
[55].
Total RNA isolation and reverse transcription
Total RNA was isolated from T. castaneum samples using TRIzol
reagent following the recommended procedure by Invitrogen
(Carlsbad, California, United States of America). The RNA was
treated with DNase I (Fermentas, Glen Burnie, Maryland, United
States of America) according to the manufacturer’s instruction and
the first-strand cDNA template was synthesized from 3.0 mgof
total RNA by using First Strand cDNA Synthesis Kit (Fermentas)
with oligo (dT)
18
as the primer.
Subcloning and sequencing of cDNA
To obtain the cDNAs corresponding to the entire protein
coding regions of TcAce1 and TcAce2, we designed specific primers
based on TcAce gene predictions and their genomic organization
(Table 1). The PCR products of each reaction were subjected to
electrophoresis on 1% agarose gel containing ethidium bromide.
The PCR bands were excised and purified using QIAEX II
Agarose Gel Extraction Kit (Qiagen, Valencia, California, United
States of America). The purified fragment was subcloned into a
pGEM-T Easy Vector (Invitrogen) according to the manufactur-
er’s instruction. The ligation DNA mixtures were used to
transform bacterial cells by using Z-Competent E. coli Transfor-
mation Kit and Buffer Set
TM
(Zymo Research Corporation,
Irvine, California, United States of America). Plasmids were
isolated from the bacterial cells and used for DNA sequencing
(KSU DNA Sequencing and Genotyping Facility, Manhattan,
Kansas, United States of America). Signal P software was used to
predict signal peptide [56].
Phylogenetic analysis of AChEs
ClustalW software (www.ebi.ac.uk/clustalw/) [57], was used to
perform multiple sequence alignments prior to phylogenetic
analysis. Phylogenetic analysis was done using MEGA 4.0 [58]
for construction a neighbor-joining tree to examine the evolution-
ary relationships among T. californica,T. urticae and 43 insect
species. To evaluate the branch strength of the phylogenetic tree, a
bootstrap analysis of 1000 replications was performed.
AChE model prediction
Model preparation. The starting conformations of TcAce1
and TcAce2 used in the multiple molecular dynamics simulations
were generated by the SWISSMODEL homology program using
a computer model (Protein Data Bank ID: 2AZG [33]) and a
crystal structure (Protein Data Bank ID: 1DX4 [41]) as templates,
respectively. ACh was manually docked into the active site of
TcAce1 or TcAce2 according to the bound ACh conformation in
the crystal structure of T. californica AChE (Protein Data Bank ID:
2ACE [59]). All His, Glu, Asp, Arg, and Lys residues of the ACh-
bound TcAce1 or TcAce2 were treated as HIP, GLU, ASP, ARG,
and LYS, respectively. The topology and coordinate files were
generated by the PREP, LINK, EDIT, and PARM modules of the
AMBER 5.0 program [60]. The complex was refined by energy
minimization using the SANDER module of the AMBER 5.0
program with a dielectric constant of 1.0 and 500 cycles of
Table 3. Percentages of amino acid sequence identity of TcAce1 and TcAce2 to cholinesterase-like lipase and adhesion proteins.
AChE
Gc
NeutralLipase
Dm
Neuroligin
Dm
Neurotactin
Dm
Gliotactin
Torpedo californica AChE 23 19 17 25
TcAChE1 19 21 17 27
TcAChE2 20 20 18 25
The NCBI session numbers of GcNeutralLipase, DmNeuroligin, DmNeurotactin, and DmGliotactin are P79066, AAF52450, CAA37831, and AAC41579, respectively.
doi:10.1371/journal.pone.0032288.t003
Table 4. The electrostatic characteristics of TcAce1, TcAce2, and other proteins.
PDB ID (Species)
Total
atoms
Total
residues
Net charge
of N terminal
deletion (
e
)
Net charge
of C terminal
deletion (
e
)
Net charge of
deletion
between N and
C termini (
e
)
Net charge
of the
structure
or model (
e
)
Dipole
moment
(Debye)
Dipole
moment per
atom
(Debye)
TcAce1 (Tribolium castaneum, AP)42015292500 23 1490 0.35
TcAce2 (Tribolium castaneum, AO)435354521+10 219 1163 0.27
1QO9 (Drosophila melanogaster, AO) 4273 540 0 22+1218 669 0.16
2AZG (Anopheles gambiae, AP) 4243 536 0 210 28 1718 0.40
2HCP (Schizaphis graminum, AP)430254027+20 28 1312 0.30
2ACE (Torpedo californica)414352722212128 1819 0.44
1J06 (Mus musculus)4177535+2220 29 867 0.21
2X8B (Homo sapiens) 4179 536 0 220 210 1384 0.33
1THG (Galactomyces geotrichum, lipase) 4287 543 +100 215 814 0.19
doi:10.1371/journal.pone.0032288.t004
Acetylcholinesterase Genes from Red Flour Beetle
PLoS ONE | www.plosone.org 11 February 2012 | Volume 7 | Issue 2 | e32288

steepest-descent minimization followed by 10,000 cycles of
conjugate-gradient minimization. The energy-minimized ACh
complex with TcAce1 or TcAce2 was solvated with 5,897 or 6,744
TIP3P water molecules [61], leading to a system of 20,703 or
23,244 atoms, respectively. The water molecules were obtained
from solvating the complex using a pre-equilibrated box of
216,000 TIP3P molecules, whose hydrogen atom charge was set to
0.4170, where any water molecule was removed if it had an
oxygen atom closer than 2.2 A
˚to any solute atom or a hydrogen
atom closer than 2.0 A
˚to any solute atom, or if it was located
further than 10.0 A
˚along the x-, y-, or z-axis from any solute
atom.
Multiple molecular dynamics simulations. The solvated
protein complex was energy-minimized for 100 cycles of steepest-
descent minimization followed by 100 cycles of conjugate-gradient
minimization to remove close van der Waals contacts in the
system, then heated from 0 to 300 K at a rate of 10 K/ps under
constant temperature and volume, and finally simulated
independently with a unique seed number for initial velocities at
300 K under constant temperature and pressure using the
PMEMD module of the AMBER 8.0 program [62] with the
AMBER force field (ff99SB) [63,64]. All simulations used (1) a
dielectric constant of 1.0, (2) the Berendsen coupling algorithm
[65], (3) a periodic boundary condition at a constant temperature
of 300 K and a constant pressure of 1 atm with isotropic molecule-
based scaling, (4) the Particle Mesh Ewald method to calculate
long-range electrostatic interactions [66], (5) a time step of 1.0 fs,
(6) the SHAKE-bond-length constraints applied to all the bonds
involving the H atom, (7) saving the image closest to the middle of
the ‘‘primary box’’ to the restart and trajectory files, (8) formatted
restart file, and (9) default values of all other inputs of the PMEMD
module. All simulations were performed on a cluster of Apple Mac
Pros with 80 Intel Xeon cores (3.0 GHz) and a cluster of Apple
Xserves with 590 G5 processors (2.2/2.3 GHz).
Simulation analysis. Average structures were obtained by
using the CARNAL module of AMBER 5.0. Cluster analyses were
performed by using the PTRAJ module [67] of AMBER 10.
Dipole moment calculations. All dipole moment
calculations were performed using the Protein Dipole Moments
Server (http://bioinfo.weizmann.ac.il/dipol/indexj.html) [68].
Protein structures with minimal deletions were used and ligands
and structural water molecules were removed before the dipole
moment calculations.
Analysis of expression of TcAce1 and TcAce2 by RT-PCR
and qPCR
The expression patterns of both TcAce1 and TcAce2 genes were
analyzed at various developmental stages including embryos (1 day
and 3 days eggs), early larvae (5 days larvae), late larvae (20 days
larvae), early pupae (1 day pupae), middle pupae (3 days larvae),
late pupae (6 days pupae), early adults (2 days adults) and two
weeks old adults. To analyze tissue specific expression, we
collected samples from the following dissected late pupa tissues
(pooled from thirty late pupae): brain, gut (midgut and hind gut)
and carcass (the whole body excluding brain, ganglia and gut). For
all the samples, 3.0 mg of total RNA were treated with DNase I
(Fermentas) to remove any genomic DNA contaminations, and
then used as templates for the first strand cDNA synthesis. The
cDNAs prepared from total RNA were used as templates for
amplification and detection of specific TcAce sequences. The gene-
specific primers were designed by using the Beacon Designer 2.0
software (Premier Biosoft International, Palo Alto, California,
United States of America) and are shown in Table 1. For reverse
transcription PCR (RT-PCR), cDNA fragments of each TcAce
were amplified using the PCR conditions as follows: 94uC for
1.5 min followed by 30 cycles (26 cycles for TcRps3 gene) of 94uC
30 s, 55uC 30 s and 72uC 45 s. A final extension at 72uC for
5 min was added at the end of the PCR. The relative mRNA
expression of each TcAce was assessed by qRT-PCR using SYBR-
Green in the Bio-Rad iCycler iQ
TM
multi-coclor real-time PCR
detection system (Bio-Rad Laboratories, Hercules, CA, USA)
based on the method of Giulietti et al. [69]. All the experiments
were performed in triplicate and normalized to the mRNA level of
ribosomal protein S3 (Rps3) as a reference gene for each sample
[70]. The relative mRNA expression levels were calculated
according to the 2
2DDCt
method [71].
Statistical analysis
The data from the qPCR analysis were subjected to ANOVA
followed by Fisher’s least significant difference (LSD) multiple
comparisons to separate the means among the treatments by using
ProStat software (Poly Software International, Pearl River, New
York, United States of America).
Acknowledgments
The authors thank Dr. Ming-Shun Chen for his helpful comments on an
earlier draft of this manuscript. The computational studies were supported
in part by the University of Minnesota Supercomputing Institute. Mention
of trade names or commercial products in this publication is solely for the
purpose of providing specific information and does not imply recommen-
dation or endorsement by Kansas State University or the Mayo Clinic.
This paper is contribution No. 11-210-J from the Kansas Agricultural
Experiment Station. The T. castaneum voucher specimens (voucher
No. 159) are located in the Kansas State University Museum of
Entomological and Prairie Arthropod Research, Manhattan, Kansas,
United States of America.
Author Contributions
Conceived and designed the experiments: YL YPP XG YP KYZ.
Performed the experiments: YL JY XZ YPP KYZ. Analyzed the data:
YL YPP YP JY XZ KYZ. Contributed reagents/materials/analysis tools:
YP KYZ. Wrote the paper: YL YPP KYZ. Contributed with revisions: YL
YPP XG YP JY XZ KYZ.
References
1. Taylor P, Radic Z (1994) The cholinesterases: from genes to proteins. Annu Rev
Pharmacol Toxicol 34: 281–320.
2. Soderlund DM, Bloomquist JR (1990) Molecular mechanism of insecticide
resistance, In: Pesticide resistance in Arthropods
Roush RT, Tabashnik BE,
eds. Chapman and Hall, New York. pp 58–96.
3. Zhu KY, Brindley WA (1992) Enzymological and inhibitory properties of
acetylcholinesterase purified from Lygus hesperus Knight (Hemiptera: Miridae).
Insect. Biochem Mol Biol 22: 245–251.
4. Fournier D, Mut ero A (1994) Modificat ion of acetylcholinesterase as a
mechanism of resistance to insecticides. Comp Biochem Physiol 108C: 19–31.
5. Zhu KY, Clark JM (1995) Cloning and sequencing of a cDNA encoding
acetylcholinesterase in Colorado potato beetle, Leptinotarsa decemlineata (Say).
Insect Biochem Mol Biol 25: 1129–1138.
6. Zhu KY, Lee SH, Clark JM (1996) A point mutation of acetylcholinesterase
associated with azinphosmethyl resistance and reduced fitness in Colorado
potato beetle. Pestic Biochem Physiol 55: 100–108.
7. Guedes RNC, Zhu KY, Kambhampa ti S, Dover BA (1997) An altered
acetylcholinesterase conferring negative cross-insensitivity to different insecti-
cidal inhibitors in organophosphate resistant lesser grain borer, Rhyzopertha
dominica. Pestic Biochem Physiol 58: 55–62.
Acetylcholinesterase Genes from Red Flour Beetle
PLoS ONE | www.plosone.org 12 February 2012 | Volume 7 | Issue 2 | e32288

8. Kono Y, Tomita T (2006) Amino acid substitutions conferring insecticide
insensitivity in Ace-paralogous acetylcholinesterase. Pestic Biochem Physiol 85:
123–132.
9. Hall LMC, Spierer P (1986) The Ace locus of Drosophila melanogaster: structural
gene for acetylcholinesterase with an unusual 59leader. Embo J 5: 2949–2954.
10. Gao J-R, Kambhampati S, Zhu KY (2002) Molecular cloning and character-
ization of a greenbug (Schizaphis graminum) cDNA encoding acetylcholinesterase
possibly evolved from a duplicate gene lineage. Insect Biochem Mol Biol 32:
765–775.
11. Myers EW, Sutton GG, Delcher AL, Dew IM, Fasulo DP, et al. (2000) A whole-
genome assembly of Drosophila. Science 5461: 2196–2204.
12. Pang Y-P, Brimijoin S, Ragsdale DW, Zhu KY, Suranyi R (2011) Novel and
viable acetylcholinesterase target site for developing effective and environmen-
tally safe insecticides. Curr Drug Targets;(in press).
13. Chen MH, Han ZJ (2006) Cloning and sequence analysis of 2 different
acetylcholinesterase genes in Rhopalosiphum padi and Sitobion avenae. Genome 49:
239–243.
14. Weill M, Fort P, Berthomieu A, Dubois MP, Pasteur N, et al. (2002) A novel
acetylcholinesterase gene in mosquitoes codes for the insecticide target and is
non-homologous to the ace gene in Drosophila. Proc R Soc Lond Ser B 269:
2007–2016.
15. Nardi F, Barazzuoli B, Ciolfi S, Carapelli A, Dallai R, et al. (2009)
Acetylcholinesterase genes in the basal Hexapod Orchesella villosa. Insect Mol
Biol 18: 45–54.
16. Kim JI, Jung CS, Koh YH, Lee SH (2006) Molecular, biochemical and
histochemical characterization of two acetylcholinesterase cDNAs from the
German cockroach Blattella germanica. Insect Mol Biol 15: 513–522.
17. Alon M, Alon F, Nauen R, Morin S (2008) Organophosphates resistance in the
B-biotype of Bemisia tabaci (Hemiptera: Aleyrodidae) is associated with a point
mutation in an ace1-type acetylcholinesterase and overexpression of carbox-
ylesterase. Insect Biochem Mol Biol 38: 940–949.
18. Seino A, Kazuma T, Tan AJ, Tanaka H, Kono Y, et al. (2007) Analysis of two
acetylcholinesterase genes in Bombyx mori. Pestic Biochem Physiol 88: 92–101.
19. Lee SW, Kasai S, Komagata O, Kobayashi M, Agui N, et al. (2007) Molecular
characterization of two acetylcholinesterase cDNAs in Pediculus human lice.
J Med Entomol 44: 72–79.
20. Cassanelli S, Reyes M, Rault M, Manicardi CG , Sauphanor B (2006)
Acetylcholinesterase mutation in an insecticide-resistant population of the
codling moth Cydia pomonella (L.). Insect Biochem Mol Biol 36: 642–653.
21. Lee DW, Kim SS, Shin SW, Kim WT, Boo KS (2006) Molecular
characterization of two acetylcholinesterase genes from the oriental tobacco
budworm, Helicoverpa assulta (Guene´e). Biochim Biophys Acta 1760: 125–133.
22. Li F, Han ZJ (2002) Two different genes encoding acetylcholinesterase existing
in cotton aphid (Aphis gossypii). Genome 45: 1134–1141.
23. Nabeshima T, Mori A, Kozaki T, Iwata Y, Hidoh O, et al. (2004) An amino acid
substitution attributable to insecticide-insensitivity of acetylcholinesterase in a
Japanese encephalitis vector mosquito, Culex tritaeniorhynchus. Biochem Biophys
Res Commun 313: 794–801.
24. Nabeshima T, Kozaki T, Tomita T, Kono Y (2003) An amino acid substitution
on the second acetylcholinesterase in the pirimicarb-resistant strains of the peach
potato aphid, Myzus persicae. Biochem Biophys Res Commun 307: 15–22.
25. Huchard E, Martinez M, Alout H, Douzery EJ, Lutfalla G, et al. (2006)
Acetylcholinesterase genes within the Diptera: Takeover and loss in true flies.
Proc R Soc Lond Ser B 273: 2595–2604.
26. Ni X-Y, Tomita T, Kasai S, Kono Y (2003) cDNA and deduced protein
sequence of acetylcholinesterase from the diamondback moth, Plutella xylostella
(L.) (Lepidoptera: Plutellidae). Appl Entomol Zool (Jpn) 38: 49–56.
27. Baek JH, Kim JI, Lee DW, Chung BK, Miyata T, et al. (2005) Identification and
characterization of ace1-type acetylcholinesterase likely associated with organ-
ophosphate resistance in Plutella xylostella. Pestic Biochem Physiol 81: 164–175.
28. Lee DW, Choi JY, Kim WT, Je YH, Song JT, et al. (2007) Mutations of
acetylcholinesterase 1 contribute to prothiofos-resistance in Plutella xylostella (L.).
Biochem Biophys Res Commun 353: 591–597.
29. Jiang X, Qu M, Denholm I, Fang J, Jiang W, et al. (2009) Mutation in
acetylcholinesterase1 associated with triazophos resistance in rice stem borer,
Chilo suppressalis (Lepidoptera: Pyralidae). Biochem Biophys Res Commun 378:
269–272.
30. Mori A, Lobo NF, de Bruyn B, Severson DW (2007) Molecular cloning and
characterization of the complete acetylcholinesterase gene (Ace1) from the
mosquito Aedes aegypti with implications for comparative genome analysis. Insect
Biochem Mol Biol 37: 667–674.
31. Kozaki T, Kimmelblatt BA, Hamm RL, Scott JG (2008) Comparison of two
acetylcholinesterase gene cDNAs of the lesser mealworm, Alphitobius diaperinus,in
insecticide susceptible and resistant strains. Arch Insect Biochem Physiol 67:
130–138.
32. Chen HJ, Liao Z, Liu XM, Li GQ, Li F, et al. (2009) Ace2, rather than Ace1,is
the major acetylcholinesterase in the silkworm, Bombyx mori. Insect Sci 16:
297–303.
33. Pang Y-P (2006) Novel acetylcholinesterase target site for malaria mosquito
control. PLoS ONE 1: e58.
34. Pang Y-P (2007) Species marker for developing novel and safe pesticides. Bioorg
Med Chem Lett 17: 197–199.
35. Pang Y-P, Singh SK, Gao Y, Lassiter TL, Mishra RK, et al. (2009) Selective and
irreversible inhibitors of aphid acetylcholinesterases: steps toward human-safe
insecticides. PLoS ONE 4: e4349.
36. Pang Y-P, Ekstro¨m F, Polsinelli GA, Gao Y, Rana S, et al. (2009) Selective and
irreversible inhibitors of mosquito acetylcholinesterases for controlling malaria
and other mosquito-borne diseases. PLoS ONE 4: e6851.
37. Lang GJ, Zhang XH, Zhang MY, Zhang CX (2010) Comparison of catalytic
properties and inhibition kinetics of two acetylcholinesterases from a
lepidopteran insect. Pestic Biochem Physiol 98: 175–182.
38. von Heijne G (1987) Sequence Analysis in Molecular Biology Academic Press
San Diego.
39. Bourne Y, Grassi J, Bougis PE, Marchot P (1999) Conformational flexibility of
the acetylcholinesterase tetramer suggested by X-ray crystallography. J Biol
Chem 274: 30370–30376.
40. Bourne Y, Taylor P, Bougis PE, Marchot P (1999) Crystal structure of mouse
acetylcholinesterase: A peripheral site-occluding loop in a tetrameric assembly.
J Biol Chem 274: 2963–2970.
41. Harel M, Kryger G, Rosenberry TL, Mallender WD, Lewis T, et al. (2000)
Three-dimensional structures of Drosophila melanogaster acetylcholinesterase and of
its complexes with two potent inhibitors. Protein Sci 9: 1063–1072.
42. Nicolet Y, Lockridge O, Masson P, Fontecilla-Camps JC, Nachon F (2003)
Crystal structure of human butyrylcholinesterase and of its complexes with
substrate and products. J Biol Chem 278: 41141–41147.
43. Sanson B, Colletier JP, Xu Y, Therese Lang P, Jiang H, et al. (2011) Backdoor
opening mechanism in acetylcholinesterase based on X-ray crystallography and
MD simulations. Protein Sci 20: 1114–1118.
44. Nachon F, Stojan J, Fournier D (2008) Insights into substrate and product traffic
in the Drosophila melanogaster acetylcholinesterase active site gorge by enlarging a
back channel. FEBS J 275: 2659–2664.
45. Mori A, Tomita T, Hidoh O, Kono Y, Severson DW (2001) Comparative
linkage map development and identification of an autosomal locus for insensitive
acetylcholinesterase-mediated insecticide resistance in Culex tritaeniorhynch us.
Insect Mol Biol 10: 197–203.
46. Gnagey AL, Forte M, Rosenberry TL (1987) Isolation and characterization of
acetylcholinesterase from Drosophila. J Biol Chem 262: 13290–13298.
47. Haas R, Marshall TL, Rosenberry TL (1988) Drosophila acetylcholinesterase:
demonstration of a glycoinositol phospholipid anchor and an endogenous
proteolytic cleavage. Biochemistry 27: 6453–6457.
48. MacPhee-Quigley K, Vedvick TS, Taylor P, Taylor SS (1986) Profile of the
disulfide bonds in acetylcholinesterase. J Biol Chem 261: 13565–13570.
49. Page RDM, Holmes EC (1998) Molecular Evolution: A Phylogenetic Approach
Blackwell Science, Oxford, UK.
50. Xu Y, Colletier JP, Weik M, Jiang H, Moult J, et al. (2008) Flexibili ty of
aromatic residues in the active-site gorge of acetylcholinesterase: X-ray versus
molecular dynamics. Biophys J 95: 2500–2511.
51. Auld VJ, Fetter RD, Broadie K, Goodman CS (1995) Gliotactin, a novel
transmembrane protein on peripheral glia, is required to form the blood-nerve
barrier in Drosophila. Cell 81: 757–767.
52. Botti SA, Felder CE, Sussman JL, Silman I (1998) Electrotactins: a class of
adhesion proteins with conserved electrostatic and structural motifs. Protein Eng
11: 415–420.
53. Raves ML, Harel M, Pang Y-P, Silman I, Kozikowski AP, et al. (1997) Structure
of acetylcholinesterase complexed with the nootropic alkaloid (-)-huperzine A.
Nature Struct Biol 4: 57–63.
54. Schrag JD, Cygler M (1993) 1?8A
˚refined structure of the lipase from Geotrichum
candidum. J Mol Biol 230: 575–591.
55. Haliscak JP, Beeman RW (1983) Status of malathion resistance in genera of
beetles infesting farm-stored corn, wheat, and oats in the United States. J Econ
Entomol 76: 717–722.
56. Bendtsen JD, Nielsen H, von Heijne G, Brunak S (2004) Improved prediction of
signal 459 peptides: SignalP 3.0. J Mol Biol 340: 783–795.
57. Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, et al. (2007)
ClustalW and ClustalX version 2.0. Bioinformatics 23: 2947–2948.
58. Tamura K, Dudley J, Nei M, Kumar S (2007) Molecular evolutionary genetics
analysis (MEGA) software version 4.0. Mol Biol Evol 24: 1596–1599.
59. Sanson B, Nachon F, Colletier JP, Froment MT, Toker L, et al. (2009)
Crystallographic snapshots of nonaged and aged conjugates of soman with
acetylcholinesterase, and of a ternary complex of the aged conjugate with
pralidoxime (dagger). J Med Chem 52: 7593–7603.
60. Pearlman DA, Case DA, Caldwell JW, Ross WS, Cheatham TE, III, et al. (1995)
AMBER, a package of computer programs for applying molecular mechanics,
normal mode analysis, molecular dynamics and free energy calculations to
simulate the structural and energetic properties of molecules. Comput Phys
Commun 91: 1–41.
61. Jorgensen WL, Chandreskhar J, Madura JD, Impey RW, Klein ML (1982)
Comparison of simple potential functions for simulating liquid water. J Chem
Phys 79: 926–935.
62. Case DA, Cheatham TE, III, Darden T, Gohlke H, Luo R, et al. (2005) The
Amber biomolecular simulation programs. J Comput Chem 26: 1668–1688.
63. Hornak V, Abel R, Okur A, Strockbine B, Roitberg A, et al. (2006) Comparison
of multiple Amber force fields and development of improved protein backbone
parameters. Proteins 65: 712–725.
64. Wickstrom L, Okur A, Simmerling C (2009) Evaluating the performance of the
ff99SB force field based on NMR scalar coupling data. Biophys J 97: 853–856.
Acetylcholinesterase Genes from Red Flour Beetle
PLoS ONE | www.plosone.org 13 February 2012 | Volume 7 | Issue 2 | e32288

65. Berendsen HJC, Postma JPM, van Gunsteren WF, Di Nola A, Haak JR (1984)
Molecular dynamics with coupling to an external bath. J Chem Phys 81:
3684–3690.
66. Darden TA, York DM, Pedersen LG (1993) Particle mesh Ewald: an N log(N)
method for Ewald sums in large systems. J Chem Phys 98: 10089–10092.
67. Shao J, Tanner SW, Thompson N, Cheatham TE, III (2007) Clustering
molecular dynamics trajectories: 1. Characterizing the performance of different
clustering algorithms. J Chem Theory Comput 3: 2312–2334.
68. Felder CE, Prilusky J, Silman I, Sussman JL (2007) A server and database for
dipole moments of proteins. Nucleic Acids Res 35: W512–521.
69. Giulietti A, Overbergh L, Valckx D, Decallonne B, Bouillon R, et al. (2001) An
overview of real-time quantitative PCR: Applications to quantify cytokine gene
expression. Methods 25: 386–401.
70. Li HR, Oppert B, Higgins RA, Huang FN, Buschman LL, et al. (2005)
Characterization of cDNAs encoding three trypsin-like proteinases and
quantitative analysis of mRNA in Bt-resistant and -susceptible strains of Ostrinia
nubilalis. Insect Biochem Mol Biol 35: 847–860.
71. Togawa T, Dunn WA, Emmons AC, Nagao J, Willis JH (2008) Developmental
expression patterns of cuticular protein genes with the R&R Consensus from
Anopheles gambiae. Insect Biochem Mol Biol 38: 508–519.
Acetylcholinesterase Genes from Red Flour Beetle
PLoS ONE | www.plosone.org 14 February 2012 | Volume 7 | Issue 2 | e32288